IMMUNOHEMATOLOGY. The molecular basis of the Rhesus antigen E w

Transcription

1 Blackwell Science, LtdOxford, UKTRFTransfusion American Association of Blood BanksMarch Original ArticleMOLECULAR BASIS OF THE RHESUS ANTIGEN EWSTROBEL ET AL. IMMUNOHEMATOLOGY The molecular basis of the Rhesus antigen E w Erwin Strobel, France Noizat-Pirenne, Sabine Hofmann, Jean Pierre Cartron, and Matthias F. Bauer BACKGROUND: The Rhesus antigen E w (ISBT designation ) was first described in It is defined by a specific antibody, but its molecular genetic basis has not yet been resolved. STUDY DESIGN AND METHODS: Two individuals serologically characterized to express the rare Rhesus antigen E w were analyzed by sequencing of all 10 exons of the RHCE gene. RESULTS: A nucleotide exchange at position 500 (T500A) resulting in a Met167Lys amino acid substitution was found in both individuals. Moreover, we show that an individual carrying the E w antigen is capable to produce an alloantibody against the wild-type E antigen. CONCLUSION: The single-point mutation T500A in exon 4 of the RHCE gene is a molecular basis of the rare Rhesus antigen E w. The Rhesus antigens represent the most complex blood group system on human RBCs, with at least 48 serologic entities described so far. 1 It is encoded by two highly homologous genes (RHD and RHCE) located on chromosome 1p34 through p36 that are inherited together. 2,3 The RHCE gene product carries the C or c antigen together with either the E or e antigen. 4 In addition, several closely related variant antigens, recognized serologically by their corresponding antibodies, are known. One of them, the Rhesus antigen E w (ISBT designation ) was first described by Greenwalt and Sanger in E w seems to be a rare antigen (<0.1% in Caucasians) and only few reports were published so far. 5-9 It is defined by a specific antibody, which in some cases is able to cause HDN. 5,8 Furthermore, it has been reported, that some, though not all polyclonal anti- E sera and some anti-e MoAbs can recognize RBCs carrying the E w antigen. 5,7,9,10 In this study, we investigated the molecular genetic basis of the rare E w antigen in two individuals. From the Institute for Medical Microbiology, Immunology and Hygiene, Academic Hospital Schwabing, Munich, Germany; National Institute for Blood Transfusion, Paris, France; Institute for Diabetes Research at the Academic Hospital Schwabing, Munich, Germany; Unite INSERM U76, Paris, France; and Institute for Clinical Chemistry, Molecular Diagnostics and Mitochondrial Genetics, Academic Hospital Schwabing, Munich, Germany. F. Noizat-Pirenne is currently at the EFS Ile de France, Hopital Henri Mondor, Creteil, France. Schwabing, Munich, Germany. F Noizat-Pirenne is currently at the EFS Ile de France, Hôpital Henri Mondor, Créteil, France. Address reprint requests to: Erwin Strobel, MD, PhD, Institut für Medizinische Mikrobiologie, Immunologie und Krankenhaushygiene, Städtisches Krankenhaus München- Schwabing, Kölner Platy 1, D München, Germany; mikrobiologie@kms.mhn.de. Supported by the Deutsche Forschungsgemeinschaft (Ba1438/4) (M.F.B.) and (Ho2374/1) (S.H.) and by the Stiftung für Pathobiochemie der Deutschen Gesellschaft für Klinische Chemie (M.F.B.). Received for publication August 1, 2003; revision received October 7, 2003, and accepted October 13, TRANSFUSION 2004;44: Patients MATERIALS AND METHODS Two unrelated adult male individuals showing the E w antigen were examined on the molecular level. Individual 1 had been recognized some years ago in a family study, when his newborn daughter was found to be E w She had shown discrepant results upon testing the Rhesus status using an incomplete polyclonal anti-e reagent and an anti-e MoAb reagent of the IgM-class. The presence of the E w antigen in both, father and daughter, was confirmed using a specific anti-e w serum (serum no. 861, Bavarian Red Cross Blood Donation Service, Munich, Germany, containing anti-e w and weak anti-e, the latter absorbed by E + RBCs). 11 The blood group of Individual 1 was established to be O and D+, C, E+, c+, e, C w, E w +. His RBCs showed positive reactions with all anti-e MoAbs tested, but no reactivity with 11 anti-e MoAbs of the IgM-class. The DAT of his RBCs and the antibody screening test of his serum were negative. Individual 2 was hospitalized due to a gastrointestinal bleeding. In his serum we found a weak irregular antibody of anti-e specificity, although in routine typing he seemed to be E+. Using the gel- Volume 44, March 2004 TRANSFUSION 407

2 STROBEL ET AL. centrifugation-method (DiaMed-ID microtyping system, Bensheim, Germany), the serum of Individual 2 reacted with R2R2 (ccdee) RBCs in the polyspecific antiglobulin test and with R2R2 and r r (ccddee) RBCs in the two-stage enzyme (papain) technique. The DAT was negative. He was transfused with seven E+ RBC concentrates 2 years ago. The blood group of Individual 2 was O and D+, C+, c+, e+, f, C w. His RBCs showed a positive result with the anti-e w serum (Bavarian Red Cross Blood Donation Service serum no. 861), as they did with a subset of four anti- E MoAbs of the IgM-class, but not with six others. However they were reactive with all anti-e MoAbs tested. Molecular analyses Total DNA was isolated from peripheral EDTA blood using a standard extraction method (Qiagen, Hilden, Germany). Genomic fragments encompassing the entire coding region of the RHCE gene were PCR-amplified using specific intron primers as shown in Table 1. Two different primer pairs were designed for specific amplification of exon 2 of either the C or c allele. Accordingly, exon 2 of Individual 1 was investigated only with c-specific primers, whereas for Individual 2 the primer pair specific for the C and D antigen was additionally used. PCR reactions were performed by 1 cycle (2 min, 94 C), 30 cycles (30 sec, 94 C; 30 sec, 55 C for Ex1-Ex6, 50 C for Ex7, 60 C for Ex8, 50 C for Ex9, 56 C for Ex10; 45 sec, 72 C) and 1 cycle (10 min, 72 C). After electrophoresis on a 2-percent agarose gel and purification using a commercially available kit (GFX PCR DNA and Gel Band Purification Kit, Amersham Biosciences Corp, Piscataway, NJ), the products of all PCR reactions were sequenced on both strands with the above-mentioned primers using a sequencing kit (ABI PRISM TM BigDye TM Terminator Cycle Sequencing Ready Reaction Kit, PE Biosystems, Weiterstadt, Germany) on an analyzer (ABI PRISM TM 310 Genetic Analyzer). RESULTS Molecular analysis of the RHCE gene of Individuals 1 and 2 revealed a single-point mutation in exon 4 (T500A) (Fig. 1). No other mutations except the specific polymorphisms encoding the C/c and E/e alleles could be detected. Thus, the T500A nucleotide substitution leading to a methionine-to-lysine exchange at amino acid position 167 (Met167Lys) is a molecular basis of the rare Rhesus antigen E w. DISCUSSION The E and e antigens differ by a single nucleotide substitution in the RHCE gene at position C676G, leading to an amino acid exchange Pro226Ala. 12 Several E variants have been identified by serologic means in the past decades, one them, E T (RH24), now being obsolete because the specific antibody is no longer available. 17 Recently, five E variants have been resolved on the molecular level One of these, previously named E variant I (E var I), is TABLE 1. Primers for amplification of the 10 exons of the RHCE gene Exon Orientation Specificity Position* Nucleotide sequence Temperature 1 sense CE specific -150 to -132 catagacaggccagcacag 55 C antisense CE specific +43 to +24 cctgctatctgctcctgtga 2 sense D/C specific -32 to -14 ctcgtccttctcgccatct 55 C antisense D/C specific +225 to +202 ggattccttgtgatacacggagta 2 sense c specific -32 to -14 ctcctccttctcaccatct 55 C antisense c specific +225 to +202 ggattccttgtggtacacagagta 3 sense CE specific -26 to -8 atcctggctctccttctca 55 C antisense CE specific +137 to +117 caagtgatcttccctcctcaa 4 sense CE specific -82 to -62 tgaactttctccaaggaccat 55 C antisense CE specific +158 to +132 aatttagcaaacactactcaaagaag 5 sense D/CE common -46 to -27 tggagcaggagtgtgattct 55 C antisense CE specific +164 to +146 gtgaccacccagcattctt 6 sense CE specific -134 to -115 agaggtggtttcaggatcag 55 C antisense D/CE common +37 to +18 agccaaagcagagagcatta 7 sense CE specific -163 to -143 ccattgatgtgagtacacatt 50 C antisense CE specific +166 to +148 gtaggggctggacataatt 8 sense CE specific -135 to -116 agccagggagaggacccttg 60 C antisense CE specific +105 to +84 gggaaggagatggggcaaatag 9 sense CE specific -112 to -92 aaggatttctgttgagacact 50 C antisense CE specific +81 to +60 agcaagtcaacatatataccca 10 sense D/CE common -310 to -291 cccagggaggtgcagtataa 56 C antisense D/CE common +89 to +68 gcgtttctcacgtacaaatgc * The positions of the primers are indicated relative to their distance from the first nucleotide or the last nucleotide of each exon, respectively. In the list of the primers, the nucleotides specific for RHCE exons are underlined. Temperature indicates annealing temperature. 408 TRANSFUSION Volume 44, March 2004

3 MOLECULAR BASIS OF THE RHESUS ANTIGEN E W Fig. 1. Molecular analysis of exon 4 of the RHCE gene of an E w + individual. Individual 1 was found to carry a T-to-A transversion at nucleotide position 500 of the coding sequence of one of the two RHCE genes leading to a methionine-to-lysine (ATG-to- AAG) exchange. The antisense strands of the genomic fragments of RHCE exon 4 (corresponding to position RHCE cdna) are shown. The same mutation could be detected in Individual 2. characterized by a single-point mutation at nucleotide position 500 (T500A) of the RHCE gene. 18 This mutation was also detected in our E w individuals. Thus, we conclude that the T500A exchange is a molecular basis for the Rhesus antigen E w, which might be identical with E var I published in Because no c-dna analysis could be performed, the presence of an additional gene conversion could not be excluded. Moreover, Individual 2 is the first E w patient reported to have produced an anti-e. This may be of practical importance for transfusion medicine because not only an alloantibody can be made by E individuals against the rare variant E w, 5,8 but that also individuals with the rare variant E w can produce an alloantibody against the wildtype E. This situation resembles that found in rare individuals carrying distinct partial D antigens presenting with low-incidence marker antigens and sometimes making an allo-anti-d. 21 ACKNOWLEDGMENTS The authors thank Bettina Treske, Institut für Diabetesforschung am Städtischen Krankenhaus Schwabing, Munich, for her excellent technical assistance. REFERENCES 1. Daniels GL, Cartron JP, Fletcher A, et al. International Society of Blood Transfusion Committee on terminology for red cell surface antigens. Vancouver Report. Vox Sang 2003;84: Avent ND, Reid M. The Rh blood group system: a review. Blood 2000;95: Cartron JP, Bailly P, Le Van Kim C, et al. Insights into the structure and function of membrane polypeptides carrying blood group antigens. Vox Sang 1998;74(Suppl 2): Smythe JS, Avent ND, Judson PA, et al. Expression of RHD and RHCE gene products using retroviral transduction of K562 cells establishes the molecular basis of Rh blood group antigens. Blood 1996;87: Greenwalt TJ, Sanger R. The Rh antigen E W. Br J Haematol 1955;1: Kaita H, Lewis M, Chown B. The Rh antigen E. Transfusion 1964;114: Winter N, Milkovich L, Konugres AA. A third example of the Rh antigen E w. Transfusion 1966;6: Grobel RK, Cardy JD. Hemolytic disease of the newborn due to anti-e w. A fourth example of the Rh antigen E w. Transfusion 1971;11: Henke J, Kasulke D. The first example of the Rh antigen E w in Western Europe. Vox Sang 1976;30: Strobel E, Lonicer C. Recognition of the antigens E and E w by monoclonal antibodies. Clin Lab 1996;42: Strobel E, Wüllenweber J, Lonicer C. [Detection of rare Rhesus antigens C x and E w using monoclonal and polyclonal antibodies in routine laboratory tests]. Infusionsther Transfusionsmed 1993;20: Mouro I, Colin Y, Chérif-Zahar B, et al. Molecular genetic basis of the human Rhesus blood group system. Nature Genet 1993;5: Skradski KJ, Rose RR, Balk MC, et al. E variant detected by allo-anti-e produced by an E positive individual (abstract). Transfusion 1989;29:35S. 14. Lubenko A, Burslem SJ, Fairclough LM, et al. A new qualitative variant of the RhE antigen revealed by heterogeneity among anti-e sera. Vox Sang 1991;60: Okubo Y, Yamano H, Nagao N, et al. A partial E antigen in the Rh system? (letter) Transfusion 1994;34: Voss GH, Kirk RL. A natural occurring anti-e which distinguishes a variant of the E antigen in Australian aborigines. Vox Sang 1962;7: Daniels GL, Anstee DJ, Cartron JP, et al. Blood group terminology ISBT Working Party on terminology for red cell surface antigens. Vox Sang 1995;69: Noizat-Pirenne F, Mouro I, Gane P, et al. Heterogeneity of blood group RhE variants revealed by serological analysis and molecular alteration of the RHCE gene and transcript. Br J Haematol 1998;103: Noizat-Pirenne F, Mouro I, Le Pennec PY, et al. Molecular basis of category EIV variant phenotype (abstract). Transfusion 1999;39:103S. 20. Kashiwase K, Ishikawa Y, Hyodo H, et al. E variants found in Japanese and c antigenicity alteration without substitution in the second extracellular loop. Transfusion 2001;41: Tippett P, Lomas-Francis C, Wallace M. The Rh antigen D: partial D antigens and associated low incidence antigens. Vox Sang 1996;70: Volume 44, March 2004 TRANSFUSION 409

4

5 Copyright of Transfusion is the property of Wiley-Blackwell and its content may not be copied or ed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or articles for individual use.