Surface plasmon resonance biosensor for real-time detection of genetically modified organisms

Transcription

1 (2010) Surface plamon reonance bioenor for real-time detection of genetically modified organim 1,2* Yoke-Kqueen, C. and 3 Son, R. 1 Department of Biomedical Science, Faculty of Medicine and Health Science, Univeriti Putra Malayia, UPM Serdang, Selangor, Malayia 2 Intitute of Biocience, Univeriti Putra Malayia, UPM Serdang, Selangor, Malayia 3 Centre of Excellence for Food Safety Reearch, Faculty of Food Science and Technology, Univeriti Putra Malayia, UPM Serdang, Selangor, Malayia Abtract: Application of urface plamon reonance (SPR) bioenor in detection of genetically modified organim (GMO) i demontrated. A total of four biotinylated probe namely Tnob, P35Sb, LECb and TSQb were uccefully immobilized onto the SA chip. Reult analyi indicated that the SPR ytem with the enor chip immobilized with the Tnob, P35Sb, LECb and TSQb biotinylated probe potentially detect complementary tandard fragment a low a 1 nm. Biopecific interaction analyi (BIA), employing urface plamon reonance (SPR) and bioenor technologie provide eay, rapid and automatable approach in detection of GMO. Short aay time, label free DNA hybridization reaction and no toxic compound are required, i.e. ethidium bromide, and the reuability of the enor urface are ome of the factor that contribute to the general advantage of the urface plamon reonance (SPR) bioenor ytem in detection of GMO. Keyword: SPR bioenor, GMO Introduction Genetically modified organim are of great interet due to it broad geographic ditribution and tremendou diverity and currently, great advance have been achieved in the detection of genetically modified organim. In Malayia, it i now etablihed that GMO related product are available in the market (Tung et al., 2008; Tung et al., 2009; Jabeer et al., 2009), and thi may aroued ideological and ethical concern among the public in relation to the iue of afety and labelling, and raiing the need for the accuracy of GMO quantification and make GMO labelling poible. For example, biopecific interaction analyi (BIA) wa performed uing urface plamon reonance (SPR) and bioenor technologie to detect genetically modified Roundup Ready oybean, lectin, 35S promoter and NOS terminator gene equence. Moreover, the SPR baed bioenor enable real time monitoring variety of molecule reaction via BIA. The adorption of biomolecule to an immobilized ligand on a enor chip i meaured in the ame time and place a it occur. The analytical ytem, Biacore, i baed on a bioenor that utilize *Correponding author. ykcheah@medic.upm.edu.my Tel: ; Fax: SPR to monitor the adorption of biomolecule on a enor chip. Thi optical technique meaure change in refractive index in the vicinity of the enor chip urface. Such change are directly proportional to the change in adorbed ma, which make it uitable for the detection of biomolecule. Since the ligand in thi tudy i a biotinylated ingle-tranded DNA, SPR technology could eaily monitor DNA-DNA hybridization in the ame time a it occur (Wood, 1993; Nilon et al., 1995). A molecule are immobilized on a enor urface, the refractive index at the interface between the urface and a olution flowing over the urface change, altering the angle at which reduced-intenity polarized light i reflected from a upporting gla plane. The change in angle, caued by binding or diociation of molecule from the enor urface, i proportional to the ma of bound material and i recorded in a enorgram. When ample i paed over the enor urface, the enorgram how an increaing repone a molecule interact. The repone remain contant if the interaction reache equilibrium. When ample i replaced by buffer, the repone decreae a the interaction partner diociate. Complete profile of recognition, binding and diociation All Right Reerved

2 478 Yoke-Kqueen, C. and Son, R. are generated in real time. From thee profile, data uch a pecificity, affinity, kinetic behavior and ample concentration can be determined. For mot application, a dextran matrix covering the gold layer enable molecule to be immobilized to a enor urface and provide a hydrophilic environment for interaction. Surface pecificity i determined by the nature of the immobilized molecule. Since light doe not penetrate the ample, interaction can be followed in colored, turbid or opaque ample. No label are required and detection i intantaneou. In Biacore ytem, SPR phenomenon occur when polarized light, under condition of total internal reflection, trike an electrically conducting gold layer at the interface between media of different refractive index: the gla of a enor urface (high refractive index) and a buffer (low refractive index). A wedge of polarized light, covering a range of incident angle, i directed toward the gla face of the enor urface. Reflected light i detected within a Biacore ytem. Electric field intenity, known a an evanecent wave, i generated when the light trike the gla. Thi evanecent wave interact with, and i aborbed by, free electron cloud in the gold layer, generating electron charge denity wave called plamon and cauing a reduction in the intenity of the reflected light. The reonance angle at which thi intenity minimum occur i a function of the refractive index of the olution cloe to the gold layer on the oppoing face of the enor urface. Probe molecule ued in thi technology can be varying from mall metabolite or drug to large trancription complexe, and their interaction with the target range from the highly pecific to the nonpecific. In interaction procee that are complicated, there can be multiple binding ite, cooperative interaction, and o forth. No labeling of molecule i required in the SPR detection method, and the binding of probe with molecular weight greater than 200 dalton can uually be detected quite accurately. With thi BIACORE technology, the SPR angle change i reported a reonance unit (), where correpond to an angle change of approximate 0.1. The exact relation between and nanogram of material bound will vary with the refractive index (Davi and Wilon, 2000). If the added molecule doe not bind to a target or receptor, the SPR angle change in the ample and reference flow cell will be the ame, and, after ubtraction, will give a zero net repone that indicate no binding occurred. Only bound molecule generate a poitive SPR ignal. That ignal, recorded over time, produce a enorgram. In a typical enorgram, a baeline ignal with no change in over time i followed by ample injection, which produce the aociation phae where increae with time. If the reaction rate are fat enough, it i poible to reach a teady tate region, where the rate of aociation and diociation are equal. Reuming buffer flow caue the complex to diociate, and the kinetic of the diociation can be recorded. At a deired time, a regeneration olution can be injected to remove remaining bounded molecule from the urface, and the original value i re-etablihed. Thu, both kinetic and the equilibrium contant can be determined from a ingle experiment (Myzka, 1999; Myzka, 2000). In thi tudy, purified DNA wa choen a target of invetigation. The objective of thi tudy i to develop a method for the GMO detection uing SPR bioenor technology. Material and Method DNA extraction Teting ample and Roundup Ready oybean powder (IRMM, Geel, Belgium) were ubjected to DNA iolation uing DNeay Plant Mini Kit (QIAGEN, Germany). The extraction procedure wa according to the manufacturer intruction. The DNA concentration of olution wa determined by meauring the UV aborption at 260 nm. The purity of the extracted DNA wa evaluated by agaroe gel electrophorei uing UV aborption ratio of 260/280 nm and 260/230 nm. Synthetic oligonucleotide The target oligonucleotide, the biotinylated oligonucleotide probe, and the PCR primer ued in thi tudy are reported a in Table 1. Aymmetry polymerae chain reaction The PCR wa performed in a final volume of 100 µl volume containing 1X PCR buffer (10 mm Tri- HCl, ph 8.8, 1.5 mm MgCl 2, 50 mm KCl and 0.1% Triton X-100) (Finnzyme, Epoo, Finland), 100 µm dntp (Finnzyme, Epoo, Finland), 0.5 µm of forward primer, 0.01 µm of revere primer, 2U of DyNAzyme TM II DNA polymerae (Finnzyme, Epoo, Finland), terile ultrapure deionized water and 30 ng of genomic DNA template. Amplification wa performed in the peronal Eppendorf thermal-cycler (Eppendorf, Germany) with a temperature program coniting of the initial denaturation at 94 o C for 4 minute followed by 50 cycle of denaturation at 94 o C for 1 minute, annealing for 45 econd at 58 o C and polymerization at 72 o C for 90 minute. Final elongation wa at 72 o C for 5 minute.

3 SPR bioenor of GMO detection 479 Table 1. Nucleotide equence ued in Bioenor (Surface Plamon Reonance) analyi Oligonucleotide Ue Sequence (5 3 ) Reference 35S-2 PCR primer (forward) GATAGTGGGATTGTGCGTCA 35S-1 PCR primer (revere) GCTCCTACAAATGCCATCA P35b Biotinylated probe biotin-ggccatcgttgaagatgcctctgc Target P35b Synthetic Target GGCAGAGGCATCTTCAACGATGGCC Tno-1 PCR primer (forward) GAATCCTGTTGCCGGTCTTG Mannelli et al., 2003 Tno-2 PCR primer (revere) TTATCCTAGTTTGCGCGCTA Tnob Biotinylated probe biotin-aatgattaattgcgggactctaatc Target Tnob Synthetic Target GATTAGAGTCCCGCAATTAATCATT TSQf PCR primer (forward) GTCTTCCCGTTACCTTGCGC TSQr PCR primer (revere) CTCGATGACCGTCGTGATGC TSQb Biotinylated probe biotin-aggtgatcggcgtcggcgtcttcg Target TSQb Synthetic Target CGAAGACGCCGACGCCGATCACCT LQf PCR primer (forward) CTCTTCCCGAGTGGGTGAGG Thi work LQr PCR primer (revere) AAGCACGTCATGCGATTCCC LECb Biotinylated probe biotin-gagtcccgtggcagcagagaaccct Target LECb Synthetic Target AGGGTTCTCTGCTGCCACGGGACTC Surface plamon reonance BIAcore analytical ytem (BIAcore AB, Uppala, Sweden) wa ued in thee experiment. Senor chip SA (reearch grade), recoated with treptavidin were from BIAcore AB (Uppala, Sweden). Running buffer wa HEPES buffered aline EP (HBS-EP), which contain 10 mm HEPES (ph 7.4), 0.15 M NaCl, 3 mm EDTA, and 0.005% (v/v) urfactant P20 (BIAcore AB, Uppala, Sweden). The experiment were conducted at 25 o C. The flow rate wa 5µl/min. Senorgram were analyzed with BIAevaluation 2.1 oftware. The flow cell were regenerated by performing a 5 µl pule of regeneration buffer that contain 50 mm NaOH and 1 M NaCl for 1 minute. Immobilization of biotinylated probe Biotinylated probe (P35b, Tnob, TSQb, LECb) were immobilized onto different flow cell of SA enor chip (Biacore AB, Uppala, Sweden). The immobilization of the biotinylated oligonucleotide (probe 80 pmol) on to the gold enor chip wa performed at 25 o C; the liquid flow wa et at 5 µl/ min. The total volume of biotinylated probe ued in the immobilization wa 20 µl. Hybridiation with ynthetic oligoncleotide The ynthetic oligonucleotide (Target P35b, Target Tnob, Target TSQb, and Target LECb) fully complementary to the immobilied probe were ued for the characterization of the bioenor. The hybridization with the target oligonucleotide wa performed at 25 o C injecting the oligonucleotide olution in hybridization buffer in the SPR flow cell; the flow rate wa et at 5 µl/min. The oligonucleotide were diluted in the HBS-EP in the preence of 0.5 M NaCl. NaCl top electrotatic repulion of the oligonucleotide. The reaction wa monitored for few min and the enor chip wa then wahed with the hybridization buffer to remove the unbound oligonucleotide. The analytical ignal, reported a reonance unit (), i the difference between the

4 480 Yoke-Kqueen, C. and Son, R. value after the hybridization value and the value recorded before the hybridization (baeline). Both value are taken when the enor chip i in contact with the ame buffer olution (hybridization buffer) o that the hift i related only to compound fixed on the enor chip during the reaction. In all the experiment, the ingle tranded probe wa regenerated by a 1 min treatment with regeneration buffer. After each regeneration cycle a ucceive hybridization reaction can to be monitor. Such treatment could be performed up to time without affecting the hybridization efficiency of the immobilized probe (Mariotti et al., 2002). Reult and Dicuion In urface conditioning tet, all of the flow cell were uccefully well conditioned and the urface performance tet indicated that the regeneration olution i not affecting the baeline or ligand (peronal communication with Rick Filonzi, BIACORE, Autralia). The ample bind reproducibly over a erie of injection indicate reproducibility of the ytem. The urface performance tet wa uccefully performed eparately on each of the immobilized flow cell with the injection of repective ingle tranded ynthetic oligonucleotide (Target P35b, Target Tnob, Target TSQb and Target LECb) at the flow rate of 5 µl/min for 2min. Beide that, the repone level indicate that the value obtained i between 10% difference and therefore can be tolerate for every urface performance tet (peronal communication with Henry, GE Healthcare, U.S.A). In the SPR meaurement of the immobilized biotinylated probe, the reonance unit after injection of the Tnob, P35b, LECb and TSQb were , , and repectively. Thee quantitie of immobilized biotinylated probe were enough to detected minute amount of GMO material (verbal communication with Rick Filonzi, BIACORE, Autralia). Reult hown in Table 2 indicated that the SPR ytem with the immobilized biotinylated probe onto the SA enor chip capable detecting complementary tandard fragment a low a 1 nm. On the other hand, Wolcott (1992) concluded that the SPR ytem i enitive enough to detect 320 fg (3.2 X g) of a 97-bp molecule or 24 fg of a 7,200-bp DNA molecule (compared with 100 fg of DNA on a Southern blot). The reult of the SPR analyi hown in Table 3 indicate that ample labeled a POP gave the lowet average repone value among all the ample teted with Tno, P35S, LEC and TSQ gene fragment detection with the reonance unit of 10.70, 21.58, and repectively. However, the highet average repone value recorded from the SPR analyi of Tno, P35S, LEC and TSQ gene fragment detection derived from the 5% GMO tandard, with the reonance unit of 18.78, 26.54, and repectively. Senorgram generated from the SPR analyi a hown in Figure 1, Figure 2, Figure 3 and Figure 4 that correpond with the reonance unit lited in Table 3 uggeted that mer oligonucleotide were appropriate probe for the detection of genetically modified Roundup Ready oybean in food ample. On the other hand, reult obtained from the tudie conducted by Feriotto et al. (2002) indicated that 15- mer oligonucleotide were uitable probe for the detection of genetically modified Roundup Ready oybean in food under tandard BIA experimental condition. By contrat, when 11-mer DNA probe were employed, no efficient hybridization wa obtained becaue of the low tability of the hybridization complexe generated (Feriotto et al., 2002). According to Malmqvit (1993), the table binding of the pecific ligand on the enor chip allow regeneration of the enor urface and analytical cycle can be performed on one and the ame urface. Furthermore, the SPR i an eay to ue programming environment for automating analytical procedure allow the ytem to run overnight and at weekend, leaving the daytime free for developing new analye and evaluation of reult (Malmqvit, 1993). Beide that, the ytem can alo be ued for tandardized concentration analyi. Concluion In thi tudy, the Tnob, P35Sb, LECb and TSQb biotinylated probe were uccefully immobilized onto the SA enor chip with the reonance unit of , , and repectively. Reult analyi indicated that the SPR ytem with the enor chip immobilized with the Tnob, P35Sb, LECb and TSQb biotinylated probe potentially detected complementary tandard fragment a low a 1 nm. Thi tudy trongly ugget that biopecific interaction analyi (BIA), utilizing urface plamon reonance (SPR) i appropriate for GMO detection. In conequence with the tudy conducted by Mannelli et al. (2003), the bioenor clearly demontrated the applicability to GMO detection both in environmental and food analyi. Moreover, the advantage of the ytem veru the electrophorectical pot PCR detection i the label free DNA hybridiation reaction

5 SPR bioenor of GMO detection 481 Table 2. Reonance unit of SPR after injection of tandard into the repective flow cell containing immobilized biotinylated probe on a enor chip SA Cycle Flow Cell ** RelRep1 RelRep2 Average Concentration mm Tno 1, , , , , , S 1, , , , , LEC 1, , , , , , TSQ 1, , , , , , * RelRep Real Repone Reonance Unit ** FC1: Tnob, FC2: P35Sb, FC3: LECb, FC4: TSQb Table 3. Reonance unit of SPR after injection of ample into the repective flow cell containing immobilized biotinylated probe on a enor chip SA Sample Flow RelRep 1 Cell ** RelRep 2 Average Tno 5% (tandard) SBH (oy bean hull pellet) POP (chicken feed) AFM (animal feed) S 5% (Standard) SBH (Soy bean hull pellet) POP (chicken feed) AFM (animal feed) LEC 5% (Standard) SBH (Soy bean hull pellet) POP (chicken feed) AFM (animal feed) TSQ 5% (Standard) SBH (Soy bean hull pellet) POP (chicken feed) AFM (animal feed) * RelRep Real Repone Reonance Unit ** FC1: Tnob, FC2: P35Sb, FC3: LECb, FC4: TSQb LEC conc aay with un Fc=3-1 LEC conc aay with un Fc=3-2 LEC conc aay with un Fc=3-3 LEC conc aay with un Fc=3-4 LEC conc aay with un Fc=3-5 LEC conc aay with un Fc=3-6 LEC conc aay with un Fc=3-7 LEC conc aay with un Fc=3-8 LEC conc aay with un Fc=3-9 LEC conc aay with u Fc=3-10 LEC conc aay with u Fc=3-11 LEC conc aay with u Fc=3-12 LEC conc aay with u Fc=3-21 LEC conc aay with u Fc=3-22 LEC conc aay with u Fc=3-23 LEC conc aay with u Fc=3-24 LEC conc aay with u Fc=3-25 LEC conc aay with u Fc=3-26 LEC conc aay with u Fc=3-27 LEC conc aay with u Fc= Figure 1. Senorgram obtained after injection of LEC tandard and aymmetry PCR product into the flow cell containing immobilized biotinylated probe (LECb) on a SA enor

6 482 Yoke-Kqueen, C. and Son, R. 35S unknown aay Fc=2-5 35S unknown aay Fc=2-6 35S unknown aay Fc=2-7 35S unknown aay Fc=2-8 35S unknown aay Fc=2-9 35S unknown aay Fc= S unknown aay Fc= S unknown aay Fc= S conc aay Fc=2-1 35S conc aay Fc=2-2 35S conc aay Fc=2-3 35S conc aay Fc=2-4 35S conc aay Fc=2-5 35S conc aay Fc=2-6 35S conc aay Fc=2-7 35S conc aay Fc=2-8 35S conc aay Fc=2-9 35S conc aay Fc= Figure 2. Senorgram obtained after injection of P35S tandard and aymmetry PCR product into the flow cell containing immobilized biotinylated probe (P35Sb) on a SA enor TNo conc aay with u Fc=1-1 TNo conc aay with u Fc=1-2 TNo conc aay with u Fc=1-3 TNo conc aay with u Fc=1-4 TNo conc aay with u Fc=1-5 TNo conc aay with u Fc=1-6 TNo conc aay with u Fc=1-7 TNo conc aay with u Fc=1-8 TNo conc aay with u Fc=1-9 TNo conc aay with Fc=1-10 TNo conc aay with Fc=1-11 TNo conc aay with Fc=1-12 TNo conc aay with Fc=1-13 TNo conc aay with Fc=1-14 TNo conc aay with Fc=1-15 TNo conc aay with Fc=1-16 TNo conc aay with Fc=1-17 TNo conc aay with Fc=1-18 TNo conc aay with Fc=1-19 TNo conc aay with Fc=1-20 TNo conc aay with Fc=1-21 TNo conc aay with Fc=1-22 TNo conc aay with Fc=1-23 TNo conc aay with Fc= Figure 3. Senorgram obtained after injection of Tno tandard and aymmetry PCR product into the flow cell containing immobilized biotinylated probe (Tnob) on a SA enor TSQ conc aay with un Fc=4-1 TSQ conc aay with un Fc=4-2 TSQ conc aay with un Fc=4-3 TSQ conc aay with un Fc=4-4 TSQ conc aay with un Fc=4-5 TSQ conc aay with un Fc=4-6 TSQ conc aay with un Fc=4-7 TSQ conc aay with un Fc=4-8 TSQ conc aay with un Fc=4-9 TSQ conc aay with u Fc=4-10 TSQ conc aay with u Fc=4-11 TSQ conc aay with u Fc=4-12 TSQ conc aay with u Fc=4-13 TSQ conc aay with u Fc=4-14 TSQ conc aay with u Fc=4-15 TSQ conc aay with u Fc=4-16 TSQ conc aay with u Fc=4-17 TSQ conc aay with u Fc=4-18 TSQ conc aay with u Fc=4-19 TSQ conc aay with u Fc= Figure 4. Senorgram obtained after injection of TSQ tandard and aymmetry PCR product into the flow cell containing immobilized biotinylated probe (TSQb) on a SA enor

7 SPR bioenor of GMO detection 483 and no toxic compound are required, i.e. ethidium bromide, and the reuability of the enor urface for more than 20 meaurement cycle. Since light doe not penetrate the ample, interaction can be followed in colored, turbid or opaque ample. No label are required and detection i intantaneou. According to Malmqvit (1993), biopecific interaction analyi (BIA), employing urface plamon reonance (SPR) and bioenor technologie are an eay, rapid and automatable technique and thi tudy revealed the application of thi approach to detect GMO. Therefore, all the SPR-baed format introduced in thi tudy were found to be ueful for the detection of Roundup Ready, lectin, 35S promoter and NOS terminator gene equence. Acknowledgement The author thank Dr. Henry K.L. Tan, Mr. T.M. Chang (G.E. Healthcare, Biocience, Malayia) and Mr. Rick Filonzi (BIACORE, Autralia) for the valuable technical advice, and Intitute of Biocience, Univeriti Putra Malayia for the facilitie. Thi work wa upported by Reearch Univerity Funding (04/01/07/0062). Reference Davi, T. and Wilon, W. D Determination of the refractive index increment of mall molecule for correction of urface plamon reonance data. Analytical Biochemitry 284: Feriotto, G., Borgatti, M., Michiati, C., Bianchi, N. and Gambari, R Bioenor Technology and Surface Plamon Reonance for Real- Detection of Genetically Modified Roundup Ready Soybean Gene Sequence. Journal of Agricultural and Food Chemitry 50: organim detection. Analytica Chimica Acta 453: Myzka, D.G Survey of the 1998 optical bioenor literature. Journal of Molecular Recognition 12: Myzka, D.G Kinetic, equilibrium and thermodynamic analyi of macromolecular interaction with BIACORE. Method Enzymology 323: Nilon, P., Peron, B., Uhlen, M. and Nygren, P. A Real-time monitoring of DNA manipulation uing bioenor technology. Analytical Biochemitry 224: Tung Nguyen, C. T., Son, R., Raha, A. R., Lai, O. M. and Clemente Michael Wong, V. L Comparion of DNA extraction efficiencie uing variou method for thedetection of genetically modified organim (GMO). International Food Reearch Journal 16: Tung Nguyen, C. T., Son, R., Raha, A. R., Lai, O. M. and Clemente Michael Wong, V. L Detection of Genetically Modified Organim (GMO) Uing Molecular Technique in Food and Feed Sample from Malayia and Vietnam. International Food Reearch Journal 15: Wolcott, M. J Advance in Nucleic Acid-Baed Detection Method. Clinical Microbiology Review 5: Wood, S. J DNA-DNA hybridization in real time uing BIAcore. Microchemical Journal 47: Jabeer, K., Son, R., Farinazleen, M. G. and Cheah, Y. K Real-time PCR evaluation of even DNA extraction method for the purpoe of GMO analyi. International Food Reearch Journal 16: Malmqvit, M Biopecific interaction analyi uing bioenor technology. Nature. 361: Mannelli, I., Minunni, M., Tombelli, S. and Macini, M Quartz crytal microbalance (QCM) affinity bioenor for genetically modified organim (GMO) detection. Bioenor and Bioelectronic 18: Mariotti, E., Minunni, M. and Macini, M Surface plamon reonance bioenor for genetically modified