Surface plasmon resonance biosensor for real-time detection of genetically modified organisms
|
|
- Morgan Hancock
- 6 years ago
- Views:
Transcription
1 (2010) Surface plamon reonance bioenor for real-time detection of genetically modified organim 1,2* Yoke-Kqueen, C. and 3 Son, R. 1 Department of Biomedical Science, Faculty of Medicine and Health Science, Univeriti Putra Malayia, UPM Serdang, Selangor, Malayia 2 Intitute of Biocience, Univeriti Putra Malayia, UPM Serdang, Selangor, Malayia 3 Centre of Excellence for Food Safety Reearch, Faculty of Food Science and Technology, Univeriti Putra Malayia, UPM Serdang, Selangor, Malayia Abtract: Application of urface plamon reonance (SPR) bioenor in detection of genetically modified organim (GMO) i demontrated. A total of four biotinylated probe namely Tnob, P35Sb, LECb and TSQb were uccefully immobilized onto the SA chip. Reult analyi indicated that the SPR ytem with the enor chip immobilized with the Tnob, P35Sb, LECb and TSQb biotinylated probe potentially detect complementary tandard fragment a low a 1 nm. Biopecific interaction analyi (BIA), employing urface plamon reonance (SPR) and bioenor technologie provide eay, rapid and automatable approach in detection of GMO. Short aay time, label free DNA hybridization reaction and no toxic compound are required, i.e. ethidium bromide, and the reuability of the enor urface are ome of the factor that contribute to the general advantage of the urface plamon reonance (SPR) bioenor ytem in detection of GMO. Keyword: SPR bioenor, GMO Introduction Genetically modified organim are of great interet due to it broad geographic ditribution and tremendou diverity and currently, great advance have been achieved in the detection of genetically modified organim. In Malayia, it i now etablihed that GMO related product are available in the market (Tung et al., 2008; Tung et al., 2009; Jabeer et al., 2009), and thi may aroued ideological and ethical concern among the public in relation to the iue of afety and labelling, and raiing the need for the accuracy of GMO quantification and make GMO labelling poible. For example, biopecific interaction analyi (BIA) wa performed uing urface plamon reonance (SPR) and bioenor technologie to detect genetically modified Roundup Ready oybean, lectin, 35S promoter and NOS terminator gene equence. Moreover, the SPR baed bioenor enable real time monitoring variety of molecule reaction via BIA. The adorption of biomolecule to an immobilized ligand on a enor chip i meaured in the ame time and place a it occur. The analytical ytem, Biacore, i baed on a bioenor that utilize *Correponding author. ykcheah@medic.upm.edu.my Tel: ; Fax: SPR to monitor the adorption of biomolecule on a enor chip. Thi optical technique meaure change in refractive index in the vicinity of the enor chip urface. Such change are directly proportional to the change in adorbed ma, which make it uitable for the detection of biomolecule. Since the ligand in thi tudy i a biotinylated ingle-tranded DNA, SPR technology could eaily monitor DNA-DNA hybridization in the ame time a it occur (Wood, 1993; Nilon et al., 1995). A molecule are immobilized on a enor urface, the refractive index at the interface between the urface and a olution flowing over the urface change, altering the angle at which reduced-intenity polarized light i reflected from a upporting gla plane. The change in angle, caued by binding or diociation of molecule from the enor urface, i proportional to the ma of bound material and i recorded in a enorgram. When ample i paed over the enor urface, the enorgram how an increaing repone a molecule interact. The repone remain contant if the interaction reache equilibrium. When ample i replaced by buffer, the repone decreae a the interaction partner diociate. Complete profile of recognition, binding and diociation All Right Reerved
2 478 Yoke-Kqueen, C. and Son, R. are generated in real time. From thee profile, data uch a pecificity, affinity, kinetic behavior and ample concentration can be determined. For mot application, a dextran matrix covering the gold layer enable molecule to be immobilized to a enor urface and provide a hydrophilic environment for interaction. Surface pecificity i determined by the nature of the immobilized molecule. Since light doe not penetrate the ample, interaction can be followed in colored, turbid or opaque ample. No label are required and detection i intantaneou. In Biacore ytem, SPR phenomenon occur when polarized light, under condition of total internal reflection, trike an electrically conducting gold layer at the interface between media of different refractive index: the gla of a enor urface (high refractive index) and a buffer (low refractive index). A wedge of polarized light, covering a range of incident angle, i directed toward the gla face of the enor urface. Reflected light i detected within a Biacore ytem. Electric field intenity, known a an evanecent wave, i generated when the light trike the gla. Thi evanecent wave interact with, and i aborbed by, free electron cloud in the gold layer, generating electron charge denity wave called plamon and cauing a reduction in the intenity of the reflected light. The reonance angle at which thi intenity minimum occur i a function of the refractive index of the olution cloe to the gold layer on the oppoing face of the enor urface. Probe molecule ued in thi technology can be varying from mall metabolite or drug to large trancription complexe, and their interaction with the target range from the highly pecific to the nonpecific. In interaction procee that are complicated, there can be multiple binding ite, cooperative interaction, and o forth. No labeling of molecule i required in the SPR detection method, and the binding of probe with molecular weight greater than 200 dalton can uually be detected quite accurately. With thi BIACORE technology, the SPR angle change i reported a reonance unit (), where correpond to an angle change of approximate 0.1. The exact relation between and nanogram of material bound will vary with the refractive index (Davi and Wilon, 2000). If the added molecule doe not bind to a target or receptor, the SPR angle change in the ample and reference flow cell will be the ame, and, after ubtraction, will give a zero net repone that indicate no binding occurred. Only bound molecule generate a poitive SPR ignal. That ignal, recorded over time, produce a enorgram. In a typical enorgram, a baeline ignal with no change in over time i followed by ample injection, which produce the aociation phae where increae with time. If the reaction rate are fat enough, it i poible to reach a teady tate region, where the rate of aociation and diociation are equal. Reuming buffer flow caue the complex to diociate, and the kinetic of the diociation can be recorded. At a deired time, a regeneration olution can be injected to remove remaining bounded molecule from the urface, and the original value i re-etablihed. Thu, both kinetic and the equilibrium contant can be determined from a ingle experiment (Myzka, 1999; Myzka, 2000). In thi tudy, purified DNA wa choen a target of invetigation. The objective of thi tudy i to develop a method for the GMO detection uing SPR bioenor technology. Material and Method DNA extraction Teting ample and Roundup Ready oybean powder (IRMM, Geel, Belgium) were ubjected to DNA iolation uing DNeay Plant Mini Kit (QIAGEN, Germany). The extraction procedure wa according to the manufacturer intruction. The DNA concentration of olution wa determined by meauring the UV aborption at 260 nm. The purity of the extracted DNA wa evaluated by agaroe gel electrophorei uing UV aborption ratio of 260/280 nm and 260/230 nm. Synthetic oligonucleotide The target oligonucleotide, the biotinylated oligonucleotide probe, and the PCR primer ued in thi tudy are reported a in Table 1. Aymmetry polymerae chain reaction The PCR wa performed in a final volume of 100 µl volume containing 1X PCR buffer (10 mm Tri- HCl, ph 8.8, 1.5 mm MgCl 2, 50 mm KCl and 0.1% Triton X-100) (Finnzyme, Epoo, Finland), 100 µm dntp (Finnzyme, Epoo, Finland), 0.5 µm of forward primer, 0.01 µm of revere primer, 2U of DyNAzyme TM II DNA polymerae (Finnzyme, Epoo, Finland), terile ultrapure deionized water and 30 ng of genomic DNA template. Amplification wa performed in the peronal Eppendorf thermal-cycler (Eppendorf, Germany) with a temperature program coniting of the initial denaturation at 94 o C for 4 minute followed by 50 cycle of denaturation at 94 o C for 1 minute, annealing for 45 econd at 58 o C and polymerization at 72 o C for 90 minute. Final elongation wa at 72 o C for 5 minute.
3 SPR bioenor of GMO detection 479 Table 1. Nucleotide equence ued in Bioenor (Surface Plamon Reonance) analyi Oligonucleotide Ue Sequence (5 3 ) Reference 35S-2 PCR primer (forward) GATAGTGGGATTGTGCGTCA 35S-1 PCR primer (revere) GCTCCTACAAATGCCATCA P35b Biotinylated probe biotin-ggccatcgttgaagatgcctctgc Target P35b Synthetic Target GGCAGAGGCATCTTCAACGATGGCC Tno-1 PCR primer (forward) GAATCCTGTTGCCGGTCTTG Mannelli et al., 2003 Tno-2 PCR primer (revere) TTATCCTAGTTTGCGCGCTA Tnob Biotinylated probe biotin-aatgattaattgcgggactctaatc Target Tnob Synthetic Target GATTAGAGTCCCGCAATTAATCATT TSQf PCR primer (forward) GTCTTCCCGTTACCTTGCGC TSQr PCR primer (revere) CTCGATGACCGTCGTGATGC TSQb Biotinylated probe biotin-aggtgatcggcgtcggcgtcttcg Target TSQb Synthetic Target CGAAGACGCCGACGCCGATCACCT LQf PCR primer (forward) CTCTTCCCGAGTGGGTGAGG Thi work LQr PCR primer (revere) AAGCACGTCATGCGATTCCC LECb Biotinylated probe biotin-gagtcccgtggcagcagagaaccct Target LECb Synthetic Target AGGGTTCTCTGCTGCCACGGGACTC Surface plamon reonance BIAcore analytical ytem (BIAcore AB, Uppala, Sweden) wa ued in thee experiment. Senor chip SA (reearch grade), recoated with treptavidin were from BIAcore AB (Uppala, Sweden). Running buffer wa HEPES buffered aline EP (HBS-EP), which contain 10 mm HEPES (ph 7.4), 0.15 M NaCl, 3 mm EDTA, and 0.005% (v/v) urfactant P20 (BIAcore AB, Uppala, Sweden). The experiment were conducted at 25 o C. The flow rate wa 5µl/min. Senorgram were analyzed with BIAevaluation 2.1 oftware. The flow cell were regenerated by performing a 5 µl pule of regeneration buffer that contain 50 mm NaOH and 1 M NaCl for 1 minute. Immobilization of biotinylated probe Biotinylated probe (P35b, Tnob, TSQb, LECb) were immobilized onto different flow cell of SA enor chip (Biacore AB, Uppala, Sweden). The immobilization of the biotinylated oligonucleotide (probe 80 pmol) on to the gold enor chip wa performed at 25 o C; the liquid flow wa et at 5 µl/ min. The total volume of biotinylated probe ued in the immobilization wa 20 µl. Hybridiation with ynthetic oligoncleotide The ynthetic oligonucleotide (Target P35b, Target Tnob, Target TSQb, and Target LECb) fully complementary to the immobilied probe were ued for the characterization of the bioenor. The hybridization with the target oligonucleotide wa performed at 25 o C injecting the oligonucleotide olution in hybridization buffer in the SPR flow cell; the flow rate wa et at 5 µl/min. The oligonucleotide were diluted in the HBS-EP in the preence of 0.5 M NaCl. NaCl top electrotatic repulion of the oligonucleotide. The reaction wa monitored for few min and the enor chip wa then wahed with the hybridization buffer to remove the unbound oligonucleotide. The analytical ignal, reported a reonance unit (), i the difference between the
4 480 Yoke-Kqueen, C. and Son, R. value after the hybridization value and the value recorded before the hybridization (baeline). Both value are taken when the enor chip i in contact with the ame buffer olution (hybridization buffer) o that the hift i related only to compound fixed on the enor chip during the reaction. In all the experiment, the ingle tranded probe wa regenerated by a 1 min treatment with regeneration buffer. After each regeneration cycle a ucceive hybridization reaction can to be monitor. Such treatment could be performed up to time without affecting the hybridization efficiency of the immobilized probe (Mariotti et al., 2002). Reult and Dicuion In urface conditioning tet, all of the flow cell were uccefully well conditioned and the urface performance tet indicated that the regeneration olution i not affecting the baeline or ligand (peronal communication with Rick Filonzi, BIACORE, Autralia). The ample bind reproducibly over a erie of injection indicate reproducibility of the ytem. The urface performance tet wa uccefully performed eparately on each of the immobilized flow cell with the injection of repective ingle tranded ynthetic oligonucleotide (Target P35b, Target Tnob, Target TSQb and Target LECb) at the flow rate of 5 µl/min for 2min. Beide that, the repone level indicate that the value obtained i between 10% difference and therefore can be tolerate for every urface performance tet (peronal communication with Henry, GE Healthcare, U.S.A). In the SPR meaurement of the immobilized biotinylated probe, the reonance unit after injection of the Tnob, P35b, LECb and TSQb were , , and repectively. Thee quantitie of immobilized biotinylated probe were enough to detected minute amount of GMO material (verbal communication with Rick Filonzi, BIACORE, Autralia). Reult hown in Table 2 indicated that the SPR ytem with the immobilized biotinylated probe onto the SA enor chip capable detecting complementary tandard fragment a low a 1 nm. On the other hand, Wolcott (1992) concluded that the SPR ytem i enitive enough to detect 320 fg (3.2 X g) of a 97-bp molecule or 24 fg of a 7,200-bp DNA molecule (compared with 100 fg of DNA on a Southern blot). The reult of the SPR analyi hown in Table 3 indicate that ample labeled a POP gave the lowet average repone value among all the ample teted with Tno, P35S, LEC and TSQ gene fragment detection with the reonance unit of 10.70, 21.58, and repectively. However, the highet average repone value recorded from the SPR analyi of Tno, P35S, LEC and TSQ gene fragment detection derived from the 5% GMO tandard, with the reonance unit of 18.78, 26.54, and repectively. Senorgram generated from the SPR analyi a hown in Figure 1, Figure 2, Figure 3 and Figure 4 that correpond with the reonance unit lited in Table 3 uggeted that mer oligonucleotide were appropriate probe for the detection of genetically modified Roundup Ready oybean in food ample. On the other hand, reult obtained from the tudie conducted by Feriotto et al. (2002) indicated that 15- mer oligonucleotide were uitable probe for the detection of genetically modified Roundup Ready oybean in food under tandard BIA experimental condition. By contrat, when 11-mer DNA probe were employed, no efficient hybridization wa obtained becaue of the low tability of the hybridization complexe generated (Feriotto et al., 2002). According to Malmqvit (1993), the table binding of the pecific ligand on the enor chip allow regeneration of the enor urface and analytical cycle can be performed on one and the ame urface. Furthermore, the SPR i an eay to ue programming environment for automating analytical procedure allow the ytem to run overnight and at weekend, leaving the daytime free for developing new analye and evaluation of reult (Malmqvit, 1993). Beide that, the ytem can alo be ued for tandardized concentration analyi. Concluion In thi tudy, the Tnob, P35Sb, LECb and TSQb biotinylated probe were uccefully immobilized onto the SA enor chip with the reonance unit of , , and repectively. Reult analyi indicated that the SPR ytem with the enor chip immobilized with the Tnob, P35Sb, LECb and TSQb biotinylated probe potentially detected complementary tandard fragment a low a 1 nm. Thi tudy trongly ugget that biopecific interaction analyi (BIA), utilizing urface plamon reonance (SPR) i appropriate for GMO detection. In conequence with the tudy conducted by Mannelli et al. (2003), the bioenor clearly demontrated the applicability to GMO detection both in environmental and food analyi. Moreover, the advantage of the ytem veru the electrophorectical pot PCR detection i the label free DNA hybridiation reaction
5 SPR bioenor of GMO detection 481 Table 2. Reonance unit of SPR after injection of tandard into the repective flow cell containing immobilized biotinylated probe on a enor chip SA Cycle Flow Cell ** RelRep1 RelRep2 Average Concentration mm Tno 1, , , , , , S 1, , , , , LEC 1, , , , , , TSQ 1, , , , , , * RelRep Real Repone Reonance Unit ** FC1: Tnob, FC2: P35Sb, FC3: LECb, FC4: TSQb Table 3. Reonance unit of SPR after injection of ample into the repective flow cell containing immobilized biotinylated probe on a enor chip SA Sample Flow RelRep 1 Cell ** RelRep 2 Average Tno 5% (tandard) SBH (oy bean hull pellet) POP (chicken feed) AFM (animal feed) S 5% (Standard) SBH (Soy bean hull pellet) POP (chicken feed) AFM (animal feed) LEC 5% (Standard) SBH (Soy bean hull pellet) POP (chicken feed) AFM (animal feed) TSQ 5% (Standard) SBH (Soy bean hull pellet) POP (chicken feed) AFM (animal feed) * RelRep Real Repone Reonance Unit ** FC1: Tnob, FC2: P35Sb, FC3: LECb, FC4: TSQb LEC conc aay with un Fc=3-1 LEC conc aay with un Fc=3-2 LEC conc aay with un Fc=3-3 LEC conc aay with un Fc=3-4 LEC conc aay with un Fc=3-5 LEC conc aay with un Fc=3-6 LEC conc aay with un Fc=3-7 LEC conc aay with un Fc=3-8 LEC conc aay with un Fc=3-9 LEC conc aay with u Fc=3-10 LEC conc aay with u Fc=3-11 LEC conc aay with u Fc=3-12 LEC conc aay with u Fc=3-21 LEC conc aay with u Fc=3-22 LEC conc aay with u Fc=3-23 LEC conc aay with u Fc=3-24 LEC conc aay with u Fc=3-25 LEC conc aay with u Fc=3-26 LEC conc aay with u Fc=3-27 LEC conc aay with u Fc= Figure 1. Senorgram obtained after injection of LEC tandard and aymmetry PCR product into the flow cell containing immobilized biotinylated probe (LECb) on a SA enor
6 482 Yoke-Kqueen, C. and Son, R. 35S unknown aay Fc=2-5 35S unknown aay Fc=2-6 35S unknown aay Fc=2-7 35S unknown aay Fc=2-8 35S unknown aay Fc=2-9 35S unknown aay Fc= S unknown aay Fc= S unknown aay Fc= S conc aay Fc=2-1 35S conc aay Fc=2-2 35S conc aay Fc=2-3 35S conc aay Fc=2-4 35S conc aay Fc=2-5 35S conc aay Fc=2-6 35S conc aay Fc=2-7 35S conc aay Fc=2-8 35S conc aay Fc=2-9 35S conc aay Fc= Figure 2. Senorgram obtained after injection of P35S tandard and aymmetry PCR product into the flow cell containing immobilized biotinylated probe (P35Sb) on a SA enor TNo conc aay with u Fc=1-1 TNo conc aay with u Fc=1-2 TNo conc aay with u Fc=1-3 TNo conc aay with u Fc=1-4 TNo conc aay with u Fc=1-5 TNo conc aay with u Fc=1-6 TNo conc aay with u Fc=1-7 TNo conc aay with u Fc=1-8 TNo conc aay with u Fc=1-9 TNo conc aay with Fc=1-10 TNo conc aay with Fc=1-11 TNo conc aay with Fc=1-12 TNo conc aay with Fc=1-13 TNo conc aay with Fc=1-14 TNo conc aay with Fc=1-15 TNo conc aay with Fc=1-16 TNo conc aay with Fc=1-17 TNo conc aay with Fc=1-18 TNo conc aay with Fc=1-19 TNo conc aay with Fc=1-20 TNo conc aay with Fc=1-21 TNo conc aay with Fc=1-22 TNo conc aay with Fc=1-23 TNo conc aay with Fc= Figure 3. Senorgram obtained after injection of Tno tandard and aymmetry PCR product into the flow cell containing immobilized biotinylated probe (Tnob) on a SA enor TSQ conc aay with un Fc=4-1 TSQ conc aay with un Fc=4-2 TSQ conc aay with un Fc=4-3 TSQ conc aay with un Fc=4-4 TSQ conc aay with un Fc=4-5 TSQ conc aay with un Fc=4-6 TSQ conc aay with un Fc=4-7 TSQ conc aay with un Fc=4-8 TSQ conc aay with un Fc=4-9 TSQ conc aay with u Fc=4-10 TSQ conc aay with u Fc=4-11 TSQ conc aay with u Fc=4-12 TSQ conc aay with u Fc=4-13 TSQ conc aay with u Fc=4-14 TSQ conc aay with u Fc=4-15 TSQ conc aay with u Fc=4-16 TSQ conc aay with u Fc=4-17 TSQ conc aay with u Fc=4-18 TSQ conc aay with u Fc=4-19 TSQ conc aay with u Fc= Figure 4. Senorgram obtained after injection of TSQ tandard and aymmetry PCR product into the flow cell containing immobilized biotinylated probe (TSQb) on a SA enor
7 SPR bioenor of GMO detection 483 and no toxic compound are required, i.e. ethidium bromide, and the reuability of the enor urface for more than 20 meaurement cycle. Since light doe not penetrate the ample, interaction can be followed in colored, turbid or opaque ample. No label are required and detection i intantaneou. According to Malmqvit (1993), biopecific interaction analyi (BIA), employing urface plamon reonance (SPR) and bioenor technologie are an eay, rapid and automatable technique and thi tudy revealed the application of thi approach to detect GMO. Therefore, all the SPR-baed format introduced in thi tudy were found to be ueful for the detection of Roundup Ready, lectin, 35S promoter and NOS terminator gene equence. Acknowledgement The author thank Dr. Henry K.L. Tan, Mr. T.M. Chang (G.E. Healthcare, Biocience, Malayia) and Mr. Rick Filonzi (BIACORE, Autralia) for the valuable technical advice, and Intitute of Biocience, Univeriti Putra Malayia for the facilitie. Thi work wa upported by Reearch Univerity Funding (04/01/07/0062). Reference Davi, T. and Wilon, W. D Determination of the refractive index increment of mall molecule for correction of urface plamon reonance data. Analytical Biochemitry 284: Feriotto, G., Borgatti, M., Michiati, C., Bianchi, N. and Gambari, R Bioenor Technology and Surface Plamon Reonance for Real- Detection of Genetically Modified Roundup Ready Soybean Gene Sequence. Journal of Agricultural and Food Chemitry 50: organim detection. Analytica Chimica Acta 453: Myzka, D.G Survey of the 1998 optical bioenor literature. Journal of Molecular Recognition 12: Myzka, D.G Kinetic, equilibrium and thermodynamic analyi of macromolecular interaction with BIACORE. Method Enzymology 323: Nilon, P., Peron, B., Uhlen, M. and Nygren, P. A Real-time monitoring of DNA manipulation uing bioenor technology. Analytical Biochemitry 224: Tung Nguyen, C. T., Son, R., Raha, A. R., Lai, O. M. and Clemente Michael Wong, V. L Comparion of DNA extraction efficiencie uing variou method for thedetection of genetically modified organim (GMO). International Food Reearch Journal 16: Tung Nguyen, C. T., Son, R., Raha, A. R., Lai, O. M. and Clemente Michael Wong, V. L Detection of Genetically Modified Organim (GMO) Uing Molecular Technique in Food and Feed Sample from Malayia and Vietnam. International Food Reearch Journal 15: Wolcott, M. J Advance in Nucleic Acid-Baed Detection Method. Clinical Microbiology Review 5: Wood, S. J DNA-DNA hybridization in real time uing BIAcore. Microchemical Journal 47: Jabeer, K., Son, R., Farinazleen, M. G. and Cheah, Y. K Real-time PCR evaluation of even DNA extraction method for the purpoe of GMO analyi. International Food Reearch Journal 16: Malmqvit, M Biopecific interaction analyi uing bioenor technology. Nature. 361: Mannelli, I., Minunni, M., Tombelli, S. and Macini, M Quartz crytal microbalance (QCM) affinity bioenor for genetically modified organim (GMO) detection. Bioenor and Bioelectronic 18: Mariotti, E., Minunni, M. and Macini, M Surface plamon reonance bioenor for genetically modified
GMACE Pilot #4: Adjusting the National Reliability Input Data
INTERBULL BULLETIN NO. 48. Berlin, Germany, May 20 21, 2014 GMACE Pilot #4: Adjuting the National Reliability Input Data P. G. Sullivan 1 and J. H. Jakoben 2 1 Canadian Dairy Network, Guelph, ON, Canada
More informationKeywords: ILSS, Flexural Strength, Hybrid Polymer Composite, Curing, Epoxy Resin 5052, Vacuum Bagging.
American International Journal Reearch in Science, Technology, Engineering & Mathematic Available online at http://www.iair.net ISSN (Print): 2328-3491, ISSN (Online): 2328-3580, ISSN (CD-ROM): 2328-3629
More informationManagement Science Letters
Management Science Letter 2 (202) 247 252 Content lit available at GrowingScience Management Science Letter homepage: www.growingscience.com/ml An empirical tudy to meaure the impact of loan aignment for
More informationExergy Analysis of Organic Rankine Cycle with Internal Heat Exchanger
International Journal of Material, Mechanic and Manufacturing, Vol. 1, No. 1, February 21 Exergy Analyi of Organic Rankine Cycle with Internal Heat Exchanger Kyoung Hoon Kim, Hyung Jong Ko, and Se Woong
More informationModeling Reveals Bistability and Low-Pass Filtering in the Network Module Determining Blood Stem Cell Fate
Modeling Reveal Bitability and Low-Pa Filtering in the Network Module Determining Blood Stem Cell Fate Jatin Narula, Aileen M. Smith 2, Berthold Gottgen 2, Oleg A. Igohin * Department of Bioengineering,
More informationApplication of the standard porosimetry method for nanomaterials. Y.M. Volfkovich and A.V. Sakars*
292 Int. J. Nanotechnology, Vol. 2, No. 3, 2005 Application of the tandard poroimetry method for nanomaterial Y.M. Volfkovich and A.V. Sakar* Porotech Ltd., 100 Cater Avenue, Vaughan, L4L 5Y9 Ontario,
More informationLabel-free interaction analysis in realtime using surface plasmon resonance
GE Healthcare Technology Note 23 Biacore systems Label-free interaction analysis in realtime using surface plasmon resonance Providing quantitative data on: report point Specificity sensorgram To what
More informationEnhanced Biofilter Treatment of Urban Stormwater by Optimizing the Hydraulic Residence Time in the Media
Enhanced Biofilter Treatment of Urban Stormwater by Optimizing the Hydraulic Reidence Time in the Media Redahegn Silehi 1, Robert Pitt 2 and Shirley Clark 3 1 Graduate tudent, Dept. of Civil, Contruction,
More information6/6/2012. HR Training and Development. Content. Training: concept. Training: concept. Training: concept. Training and Development: Concept
HR Training and Development UNIT 5 Content Concept and need of HR training and development Training need aement HR training: objective and method (on-the-job and off-the-job). Evaluation of training program
More information3.4 BUTT FUSION WELDING
3.4 BUTT FUSION 3.4.1 INTRODUCTION The butt welding proce conit of the joining of two component (pipe and/or fitting) of equal diameter and thickne in which the urface to be welded are heated until melting
More informationThe Use of Swimmer Bars as Shear Reinforcement in Reinforced Concrete Beam
American Journal of Engineering and Applied Science, 6 (1): 87-94, 2013 ISSN: 1941-7020 2014 M. Al-Nara et al., Thi open acce article i ditributed under a Creative Common Attribution (CC-BY) 3.0 licene
More informationAbstract. 1 Introduction
Automatic conflict detection and reolution in metrorail ytem: evaluation approach for MARCO EU project G.F. D'Addio, M. Mazzucchelli, S. Savio Dipartimento di Ingegneria Elettrica, Univerita di Genova,
More informationEquilibrium Sediment Transport and Evolution Trend Simulation of the Lower Yellow River
Senor & Tranducer, Vol. 21, Special Iue, May 213, pp. 135-141 Senor & Tranducer 213 by IFSA http://www.enorportal.com Equilibrium Sediment Tranport and Evolution Trend Simulation of the Lower Yellow River
More informationTHE POTENTIAL AND COST OF CARBON SEQUESTRATION IN AGRICULTURAL SOIL; EMPIRICAL STUDY OF DYNAMIC MODEL IN THE MIDWESTERN U.S.
THE POTENTIAL AND COST OF CARBON SEQUESTRATION IN AGRICULTURAL SOIL; EMPIRICAL STUDY OF DYNAMIC MODEL IN THE MIDWESTERN U.S. DISSERTATION Preented in Partial Fulfillment of the Requirement for the Degree
More informationModeling Liquid Phase Sintering of Hard metal powder compacts
ing Liquid Phae Sintering of Hard metal powder compact Shama Shamaundar *, Maheha Siddegowda*, Pavanachand Chigurupati**, Rengarajan Raghavan***, Rameh Rao. S. *** * ProSIM AFTC # 326, 8th Main, III Stage,
More informationEffect of Cobalt Doping on Physical Properties of ZnO Nanoparticles
CPUH-Reearch Journal: 06, (), 47-5 ISSN (nline): 455-6076 http://www.cpuh.in/academic/academic_journal.php Effect of Cobalt oping on Phyical Propertie of Zn Nanoparticle Neha Sharma, Shaveta Thakur, Ruchita
More informationAntibody light chain variable domains and their biophysically improved versions for human immunotherapy
Paper Type mab 6:1, 219 235; January/February 2014; 2014 Lande Biocience Report Antibody light chain variable domain and their biophyically improved verion for human immunotherapy Dae Young Kim 1, Rebecca
More informationBELIEF PROPAGATION REVEALS ALLOSTERIC MECHANISMS IN PROTEINS
BELIEF PROPAGATION REVEALS ALLOSTERIC MECHANISMS IN PROTEINS Hetunandan Kamietty Computer Science Department, Carnegie Mellon Univerity, Pittburgh, PA 15213, USA Email: hetu@c.cmu.edu Arvind Ramanathan
More informationOPTIMIZATION OF ALUMINIUM BLANK SAND CASTING PROCESS BY USING TAGUCHI S ROBUST DESIGN METHOD
International Journal for Quality reearch UDK 669.76 Original Scientific Paper (.0) OPTIMIZATION OF ALUMINIUM BLANK SAND CASTING PROCESS BY USING TAGUCHI S ROBUST DESIGN METHOD Mekonnen Liben Nekere )
More informationSIMULATION OF THE GAIN CHARACTERISTICS OF EDFA
SIMUTIO OF THE GI CHRCTERISTICS OF EDF guyen Hong Suong and Pham Quoc Ho Deartment of Telecommunication, Pot and Telecommunication Intitute of Technology (PTIT), Ho Chi Mh City, Vietnam BSTRCT In thi tudy,
More informationModel of Integrated Production and Delivery Batch Scheduling Under JIT Environment to Minimize Inventory Cost
Proceeding of the 2014 International Conference on Indutrial Engineering and Operation Management Bali, Indoneia, January 7 9, 2014 Model of Integrated Production and Delivery Batch Scheduling Under JIT
More informationChallenges of Developing ISO Sampling Standards
Challenge of Developing ISO Sampling Standard Ralph Holme CSIRO Mineral Down Under Flaghip Chair ISO/TC 10/SC 1 Sampling Iron Ore Chair ISO/TC 7/SC 4 Sampling Coal and Coke Convenor ISO/TC 183/WG 9 Sampling
More informationSimulation of Continuous Bio-Reactor
Proceeding of he 5 th nnual International Conference Syiah Kuala Univerity (IC Unyiah) 205 In conjunction with he 8 th International Conference of Chemical Engineering on Science and pplication (ChES)
More informationPollution prevention with chemical process simulators: the generalized waste reduction (WAR) algorithm full version
Computer and Chemical Engineering 23 (1999) 623 634 Pollution prevention with chemical proce imulator: the generalized wate reduction (WAR) algorithm full verion Heriberto Cabeza *, Jane C. Bare, Subir
More informationBachelor End Project: Characterization of the constitutive behavior of polymer foams
Bachelor End Project: Characterization of the contitutive behavior of polymer foam R. van Eijden MT 05.27 Coach: Dr. ir. J.A.W. van Dommelen Eindhoven, April 21t 2005 Content Content Abtract Lit of ymbol
More informationGE Biacore T Check that the waste bottle is empty.
GE Biacore T200 General Care and Maintenance The instrument should be left ON at all times, and in Standby Mode. Report problems immediately in the booking system: https://ppms.us/hms-cmi. Refer to the
More informationA Morphing Extrusion Die for Manufacturing of Thermoplastic Hoses THESIS
A Morphing Extruion Die for Manufacturing of Thermoplatic Hoe THESIS Preented in Partial Fulfillment of the Requirement for the Degree Mater of Science in the raduate School of The Ohio State Univerity
More informationMaintaining ISO Compliance in Automated Procedures
Maintaining ISO 1705 Compliance in Automated Procedure Preenter & Author: Jorge Martin Fluke Corporation PO 9090 M/S 6-30 Everett, WA, USA 9806 Phone: (45) 446 6477; Fax: (45) 446 6390 Email: jmartin@flukecom
More informationManagement Science Letters
Management Science Letter 2 (2012) 3049 3054 Content lit available at GrowingScience Management Science Letter homepage: www.growingscience.com/ml Identification and prioritization of hazardou material
More informationAddress for Correspondence
Reearch Paper ENERGY CONSERVATION IN MUD HOUSE AS COMPARED TO BRICK WALL BUILDING IN INDIA Subhah Mihra 1, Dr. J A Umani 2 Addre for Correpondence 1 Ph.d Scholar, 2 Profeor, Department of Mechanical Engineering,
More informationGas Processing Expander
Expander Operated Ga Proceing April, 2015 Ga Proceing Expander Colder Proce Temperature and Maximized Compreor Uptime with Helidyne Expander Skid. Specification: Flowrate 1-10 mmcfd Max. Preure 1,440 pi
More informationM A S O N R Y. Revised Spring Engineering Notes For Design With Concrete Block Masonry
A S O N R Y Revied Spring 007 Engineering Note For Deign With Concrete Block aonry C H R O N I C L E S To rectify the ituation, the Spring 007 article i being reiued. We apologize for any inconvenience
More informationDNA Hybridization and Detection
Chapter 6 DNA Hybridization and Detection Fluorescence Polarization Detection of DNA Hybridization........................................................ 6-2 Introduction.............................................................................................................
More informationResearch Article. Hydration process study on the alkali-activated slag cementing materials
Available online wwwjocprcom Journal of Chemical and Pharmaceutical Reearch,, ():88 Reearch Article ISSN : 975738 CODEN(USA) : JCPRC5 Hydration proce tudy on the alkaliactivated lag cementing material
More informationTypical Albedo ALBEDO 1/14/13. Albedo. Disposition of Solar Radiation at Earth s Surface
Introduction to Climatology GEOGAPHY 300 Dipoition of Solar adiation at Earth Surface Tom Giambelluca Univerity of Hawai i at Mānoa eflection: Albedo i a key property of urface controlling the urface energy
More informationScaling of supersaturation by a simple test
Permafrot, Phillip, pringman & Arenon (ed) 2003 et & Zeitlinger, Lie, IBN 90 5809 582 7 caling of uperaturation by a imple tet M. Dyli oil Mechanic Laboratory of the i Federal Intitute of Technology, Lauanne,
More informationStudy on Variable Action Value Standard for Harbor Infrastructures
4 th International Conference on the Durability of Concrete Structure 24 26 July 2014 Purdue Univerity, Wet Lafayette, IN, USA Study on Variable Action Value Standard for Harbor Infratructure Xiaoping
More informationDirect genotyping of C3435T single nucleotide polymorphism in unamplified human MDR1 gene using a surface plasmon resonance imaging DNA sensor
Analytical and Bioanalytical Chemistry Electronic Supplementary Material Direct genotyping of C3435T single nucleotide polymorphism in unamplified human MDR1 gene using a surface plasmon resonance imaging
More informationCerámica y Vidrio A R T I C U L O
B O L E T I N D E L A S O C I E D A D E S P A Ñ O L A D E Cerámica y Vidrio A R T I C U L O A view on organic binder effect on technical propertie of ceramic Rachig ring Y. BEYGI KHOSROWSHAHI, A. SALEM
More informationSURFACE PLASMON RESONANCE-BASED SYSTEMS
SURFACE PLASMON RESONANCE-BASED SYSTEMS ADVANCED METHODS IN BIOENGINEERING LABORATORY 3/1/2011 1 Schedule Week 1: Introduction Reagents preparation Ligand immobilization of Protocol 1 Week 2: Kinetics
More informationTom-Reiel Heggedal and Karl Jacobsen
Dicuion Paper No. 536, April 2008 Statitic Norway, Reearch Department Tom-Reiel eggedal and Karl Jacoben Timing of innovation policie when carbon emiion are retricted: an applied general equilibrium analyi
More informationProduct Specifications & Manual
Product Specifications & Manual Custom Oligo Synthesis, antisense oligos, RNA oligos, chimeric oligos, Fluorescent dye labeled oligos, Molecular Beacons, sirna, phosphonates Affinity Ligands, 2-5 linked
More informationSupporting Information
Supporting Information Wiley-VCH 2006 69451 Weinheim, Germany Rolling-circle Amplification of a DNA Nanojunction Chenxiang Lin, Mingyi Xie, Julian J.L. Chen, Yan Liu and Hao Yan A. RCA replication of the
More informationSolubility of Carbohydrates in Subcritical Water
Solubility of Carbohydrate in Subcritical Water Fernando Montañé 1, Tiziana Fornari 2, Elena Ibáñez 1, Keerthi Sriniva 3 Dongfang Zhang 3 and Jerry W. King *3 1 Intituto de Fermentacione Indutriale (CSIC).
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationModeling and Simulation of Biological Anaerobic Treatment of Sludge Resulted from Wastewater Treatment
Modeling and imulation of Biological Anaerobic Treatment of ludge Reulted from Watewater Treatment AUREL PREURĂ, LĂCRĂMIOARA DIANA ROBECU 2, ILEANA IRINA PANAITECU 3.C. RAJA Contanța.A. 22-24 Călărași
More informationGenetics and Genomics in Medicine Chapter 3. Questions & Answers
Genetics and Genomics in Medicine Chapter 3 Multiple Choice Questions Questions & Answers Question 3.1 Which of the following statements, if any, is false? a) Amplifying DNA means making many identical
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More information2x PCR LongNova-RED PCR Master Mix
2x PCR LongNova-RED Components RP85L 100 reactions (50 μl) RP85L-10 1000 reactions (50 μl) 2x PCR LongNova-RED 2 x 1.25 ml 20 x 1.25 ml PCR grade water 2 x 1.5 ml 20 x 1.5 ml Storage & Shiing Storage conditions
More informationA-Site Deficient (Pr0.6Sr0.4)(1-s)Fe0.8Co0.2O3-delta Perovskites as Solid Oxide Fuel Cell Cathodes
Downloaded from orbit.dtu.dk on: Apr 21, 218 A-Site Deficient (Pr.6Sr.4)(1-)Fe.8Co.2O3-delta Perovkite a Solid Oxide Fuel Cell Cathode Kammer Hanen, Kent Publihed in: Journal of the Electrochemical Society
More informationWHICH CAME FIRST, LAWS OR LOBBYISTS? AN EMPIRICAL INVESTIGATION OF ENVIRONMENTAL REGULATION AND INTEREST GROUP FORMATION. Bryan James Leonard
WHICH CAME FIRST, LAWS OR LOBBYISTS? AN EMPIRICAL INVESTIGATION OF ENVIRONMENTAL REGULATION AND INTEREST GROUP FORMATION. by Bryan Jame Leonard A thei ubmitted in partial fulfillment of the requirement
More informationBiacore The high performance research system. Work with high sensitivity
Biacore 3000 The high performance research system Work with high sensitivity direct detection of small molecules at < 1 nm concentration increased resolution for kinetic analysis measurement of weak affinities
More informationBIA Experimental Designs
s What are the Basics? Immobilization Binding Interactions Regenerations Controls 1 BIA Terminologies Ligand : Bound component Analyte: Flow-through component BIA Terminologies Resonance Units: Units used
More informationDesign a Sustainable Supply Chain under Uncertainty using Life Cycle Optimisation and Stochastic Programming
151 A publication of CHEMICAL ENGINEERING TRANSACTIONS VOL. 61, 2017 Guet Editor: Petar S Varbanov, Rongxin Su, Hon Loong Lam, Xia Liu, Jiří J Klemeš Copyright 2017, AIDIC Servizi S.r.l. ISBN 978-88-95608-51-8;
More informationAs companies outsource more product design and manufacturing activities to other members of the supply
MANAGEMEN SCIENCE Vol. 55, No. 7, July 2009, pp. 1122 1138 in 0025-1909 ein 1526-5501 09 5507 1122 inform doi 10.1287/mnc.1090.1008 2009 INFORMS Quality Improvement Incentive and Product Recall Cot Sharing
More informationY. T. Puyate* and Z. R. Yelebe**
Y. T. Puyate, Z. R. Yelebe / International Journal of Engineering Reearch and Application (IJERA) ISSN: 48-96 www.ijera.com Vol., Iue 6, November- December 1, pp.93-911 Etimation Of Monod Kinetic Parameter
More informationPCR based Testing of Living Modified Organisms (LMOs)
PCR based Testing of Living Modified Organisms (LMOs) Gurinder Jit Randhawa Senior Scientist NRC on DNA Fingerprinting NBPGR New Delhi The first commercially available transgenic crop was the FLAVR-SAVR
More informationMightyAmp DNA Polymerase Ver.3
Cat. # R076A For Research Use MightyAmp DNA Polymerase Ver.3 Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. General PCR Reaction Mix... 3 V. Primer Design...
More informationLabel Confusion: The Groucho Effect of Uncertain Standards. Rick Harbaugh, John W. Maxwell, and Beatrice Roussillon.
Label Confuion: The Groucho Effect of Uncertain Standard Rick Harbaugh, John W. Maxwell, and Beatrice Rouillon November 15, 21 Abtract Label certify that a product meet ome tandard for quality, but often
More informationPowerPlex. Y System Validation
PowerPlex Y System Validation By Patricia M. Fulmer, Dawn Rabbach, Kimberly Huston, Curtis Knox and Cynthia Sprecher, Promega Corporation Abstract We have improved the manufacturing process for the PowerPlex
More informationParticipation, Growth and Social Poverty: Social Capital in a Homogeneous
The Open Economic Journal, 2008,, -3 Open Acce Participation, Growth and Social Poverty: Social Capital in a Homogeneou Society Angelo Antoci *,, Pier Luigi Sacco 2 and Paolo Vanin 3 DEIR, Univerity of
More informationTruSeq ChIP Sample Preparation
FOR RESEARCH USE ONLY Date: Illumina Kit Description: NOTE Unless familiar with the protocol in the latest version of the TruSeq ChIP Sample Preparation Guide (part # 15023092), new or less experienced
More informationApplication of Biacore Technology
Principles and typical results Application of Biacore Technology Common types of Biacore analyses Specificity analysis Is my molecule of interest specific for its target? Multiple binding analysis In which
More informationprofessional quest 360 Feedback Reports
Survey Deign, Ditribution & Analyi Software profeional quet 360 Feedback Report Package Content Thi reporting package contain a jut a few of the many report that could be ued to analye a 360 degree feedback
More informationThe Role of Skills Development in Competitiveness in Asia
The Role of Skill Development in Competitivene in Aia Profeor Michael J. Enright Univerity of Hong Kong Hong Kong Intitute for Economic and Buine Strategy Enright, Scott & Aociate ADB Copyright Michael
More informationConcentration profiles of gold inside activated carbon during adsorption
Concentration profile of gold inide activated carbon during adorption by N.M. Vegter*, R.F. Sandenbergh*, and A.J. Botha Synopi The gold concentration profile which develop inide the activated carbon particle
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More informationHigh Pure PCR Template Preparation Kit for preparation of 100 nucleic acid samples Cat. No
for preparation of 100 nucleic acid samples Cat. No. 1 796 88 Principle Cells are lysed during a short incubation with Proteinase K in the presence of a chaotropic salt (guanidine HCl), which immediately
More informationPigments Special Applications SAnODAL, SANODURe. For the dyeing of anodized aluminum
Pigment pecial Application AnODAL, ANODURe AND ANODYE DYE For the dyeing of anodized aluminum PRODUCT NAME Dark hade Light hade ANODYE Yellow 3GL ANODYE Yellow D ANODAL GOLD 4N ANODURE Fat Gold L ANODURE
More informationPolycaprolactone Foam for Scaffold Development
STR/4/6/FT Polycaprolactone Foam for Scaffold Development B. Y. Tay, M. H. Myint and F. L. Ng Abtract The tudy invetigate the proceing of biodegradable porou caffold of polycaprolactone (PCL). A commercially
More informationProduct Name : Simple mirna Detection Kit
Product Name : Simple mirna Detection Kit Code No. : DS700 This product is for research use only Kit Contents This kit provides sufficient reagents to perform 20 reactions for detecting microrna. Components
More information4 Farmer Perceptions of the Biophysical
4 Farmer Perception of the Biophyical Contraint to Rice Production in Sub-Saharan Africa, and Potential Impact of Reearch Aliou Diagne,* Didier Y. Alia, Eyram Amovin-Aagba, Marco C.S. Woperei, Kazuki Saito
More informationConcept of Heat Recovery from Exhaust Gases
IOP Conference Serie: Material Science and Engineering PAPER OPEN ACCESS Concept of Heat Recovery from Exhaut Gae To cite thi article: Maria Bukowka et al 2017 IOP Conf. Ser.: Mater. Sci. Eng. 245 052057
More informationFMF NIRCA PROTOCOL STEP 1.
FMF NIRCA PROTOCOL STEP 1. After you have isolated patient s DNA and DNA from a healthy donor (wild type), you perform a nested PCR. The primers used to amplify exon 2 and exon 10 of the mefv gene are
More informationThe preparation of native chromatin from cultured human cells.
Native chromatin immunoprecipitation protocol The preparation of native chromatin from cultured human cells. All solutions need to be ice cold. Sucrose containing solutions must be made up fresh on the
More informationInstructions for Use Life Science Kits & Assays
Instructions for Use Life Science Kits & Assays Content Content 1 Product and order number... I 2 Storage conditions... I 3 Description... II 3.1 Quality data... II 3.2 Unit definition... II 4 Delivered
More informationDynamic compressive and splitting tensile tests on mortar using split Hopkinson pressure bar technique
730 Dynamic compreive and plitting tenile tet on mortar uing plit Hopkinon preure bar technique Abtract Dynamic compreive and tenile propertie of mortar under impact loading were invetigated experimentally
More informationPolymerase Chain Reaction (PCR)
Laboratory for Environmental Pathogens Research Department of Environmental Sciences University of Toledo Polymerase Chain Reaction (PCR) Background information The polymerase chain reaction (PCR) is an
More informationMolekulargenetische Reagenzien. Raumtemperaturstabile PCR und qpcr Reagenzien
Molekulargenetische Reagenzien Raumtemperaturstabile PCR und qpcr Reagenzien Polypeptide Stabilization Technology: Stability TAG Ice-free reaction set-up Our temperature stable enzymes allow you to change
More informationAmplicon Sequencing Template Preparation
Amplicon Sequencing Template Preparation The DNA sample preparation procedure for Amplicon Sequencing consists of a simple PCR amplification reaction, but uses special Fusion Primers (Figure 1-1). The
More informationTaKaRa PCR Amplification Kit
Cat. # R011 For Research Use TaKaRa PCR Amplification Kit Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 4 IV. Materials Required but not Provided... 4 V. Principle...
More informationThe World Leader in SPR Technology. Jimmy Page, PhD, Biacore, Inc.
The World Leader in SPR Technology Jimmy Page, PhD, Biacore, Inc. Objectives of Biacore Experiments Yes/No Data» Is there binding?» Ligand Fishing Concentration Analysis: How MUCH? Active Concentration
More informationHiPer Real-Time PCR Teaching Kit
HiPer Real-Time PCR Teaching Kit Product Code: HTBM032 Number of experiments that can be performed: 10 Duration of Experiment Protocol: 1.5 hours Storage Instructions: The kit is stable for 12 months from
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationAalborg Universitet. Published in: I E E E Transactions on Industrial Electronics. DOI (link to publication from Publisher): /TIE.2016.
Aalborg Univeritet Droop Control with Improved Diturbance Adaption for PV Sytem with Two Power Converion Stage Liu, Hongpeng; Loh, Poh Chiang; Wang, Xiongfei; Yang, Yongheng; Wang, Wei; Xu, Dianguo Publihed
More informationSupporting Information
Supporting Information Wiley-VCH 2006 69451 Weinheim, Germany RNA ligands that distinguish metabolite-induced conformations in the TPP riboswitch Günter Mayer, Marie-Sophie L. Raddatz, Julia D. Grunwald,
More informationBiacore X100. GE Healthcare Life Sciences. Biacore X100 Plus Package. Biacore X100 delivers:
GE Healthcare Life Sciences Data file 28-9592-29 AB Biacore label-free interaction analysis Biacore X100 Biacore X100 (Fig 1) is an automated and versatile system for comprehensive, label-free analysis
More informationThe Biotechnology Education Company. Single Antibody ELISA Diagnostics. Storage: See Page 3 for specific storage instructions EXPERIMENT OBJECTIVE:
The Biotechnology Education Company ingle Antibody ELIA Diagnostics torage: ee Page 3 for specific storage instructions EXPERIMENT OBJECTIVE: This experiment introduces a rapid and sensitive one antibody
More informationMARINE HEALTH, SAFETY, QUALITY, AND ENVIRONMENTAL MANAGEMENT
Guide for Marine Health, Safety, Quality and Environmental Management GUIDE FOR MARINE HEALTH, SAFETY, QUALITY, AND ENVIRONMENTAL MANAGEMENT AUGUST 2009 (Updated November 2010 ee next page) American Bureau
More informationDNA 5 End-Labeling System INSTRUCTIONS FOR USE OF PRODUCT U2010.
Technical Bulletin DNA 5 End-Labeling System INSTRUCTIONS FOR USE OF PRODUCT U2010. PRINTED IN USA. Revised 12/12 DNA 5 End-Labeling System All technical literature is available on the Internet at: www.promega.com/protocols/
More informationBiacore. Sensor Surface Handbook
Biacore Sensor Surface Handbook Contents 1 Introduction 1.1 Principles of Biacore systems... 7 1.2 Biacore terminology... 7 1.3 Components of Biacore systems... 9 1.3.1 The SPR detection system... 9 1.3.2
More informationTime to Market for Green
Time to Market for Green product Dr. Ing. Gordon Biezeveld 1 UL EUROPE & LATIN AMERICA What we hall review 1. Reaon behind RoHS 2. Undertanding the key variable of the Legilation 3. Way to demontrate RoHS
More informationPerformance characteristics of the High Sensitivity DNA kit for the Agilent 2100 Bioanalyzer
Performance characteristics of the High Sensitivity DNA kit for the Agilent 2100 Bioanalyzer Technical Note 10 Measured conc. [ng/µl] 1 Y intercept = 0.09 r 2 = 0.993 0.1 0.1 1 10 Reference concentration
More informationEvaluation of Tests To Assess Stripping Potential of Asphalt Concrete Mixtures
18 TRASPORTATIO RESEARCH RECORD 1171 Evaluation of Tet To Ae Stripping Potential of Aphalt Concrete Mixture FRAZIER PARKER JR., AD FouAD A. GHARAYBEH Stre pedetal, boll, and Indirect tenile tet were evaluated
More informationProperties of nanofabricated biosensors based on DNA aptamers
Properties of nanofabricated biosensors based on DNA aptamers Tibor Hianik Faculty of Mathematics, Physics and Computer Sci., Comenius University, Bratislava, Slovakia Content of presentation Introduction
More informationEstablishment and evaluation of operation function model for cascade hydropower station
Water Science and Engineering, 2010, 3(4):443-453 doi:10.3882/j.in.1674-2370.2010.04.007 http://www.waterjournal.cn e-mail: we2008@vip.163.com Etablihment and evaluation o operation unction model or cacade
More informationQuiz Submissions Quiz 4
Quiz Submissions Quiz 4 Attempt 1 Written: Nov 1, 2015 17:35 Nov 1, 2015 22:19 Submission View Released: Nov 4, 2015 20:24 Question 1 0 / 1 point Three RNA polymerases synthesize most of the RNA present
More informationSINCE the 1960s, conceptual models are in use to facilitate
IEEE TRNSTIONS ON SYSTEMS, MN, ND YBERNETIS PRT Study into the Factor that Influence the Undertandability of Buine Proce Model Hajo. Reijer and Jan Mendling btract Buine proce model are key artifact in
More informationLow cost and non-toxic genomic DNA extraction for use in molecular marker studies.
Low cost and non-toxic genomic DNA extraction for use in molecular marker studies. Version 1.4, February 28 th, 2013. Prepared by Bernhard Hofinger, Owen Huynh and Brad Till. 1. OBJECTIVE To develop and
More information