Single- cell RNA sequencing methodologies and ESCG pla:orm. Karolina Wallenborg October 2, 2017
|
|
- Thomasina McGee
- 6 years ago
- Views:
Transcription
1 Single- cell RNA sequencing methodologies and ESCG pla:orm Karolina Wallenborg October 2, 2017
2 From Wikipedia
3 Short history of scrna- seq 10XGenomics BioRad/Illumina BD Resolve Adapted from: Kolodziejczyk A et al, Molecular Cell, 2015
4 ApplicaTons for scrna- sequencing Heterogeneity analysis Cell type identficaton Lineage tracing, cellular states in differentaton and development Monoallelic gene expression, splicing pazerns Zeisel A, et al, Science 2015
5 Single- cell isolaton or capture MulT- Sample Nano- Dispenser Micro- well chip Cytoplasmic aspiraton Adapted from: Kolodziejczyk A et al, Molecular Cell, 2015
6 Reverse transcripton and amplificaton Adapted from: Kolodziejczyk A et al, Molecular Cell, 2015 Poly(T) primer Single cell contain ~10 pg total RNA 1-5% is mrna 10-20% of the transcripts get reverse transcribed
7 Current scrna- sequencing protocols Adapted from Poulin JF et al, Nature Neuroscience, 2016
8 Single- cell RNA- sequencing protocols - Which method suits you? Full- length Whole transcript informaton Gene expression quantficaton Isoform, SNP and mutatons Tag- based methods (5 or 3 ) EsTmate of transcript abundance Early multplexing Combined with molecular countng Retain DNA strand informaton
9 ESCG pla:orm Started in 2015 Sten Linnarsson (STRT- seq, STRT/C1), Rickard Sandberg (Smart- seq2) High throughput single- cell RNA- sequencing 280,000 single cells sequenced 77 projects Number of projects per cell type Oligodendrocytes Breast Cancer Cells Brain cells Ependymal cells Cardiomyocytes Neurons KeraTnocytes GBM cells Neural Crest Cells Innate Lymphoid Cells Blastema Cells ES Cells Immune Cells CAFs Endothelial Cells Pericytes SpermaTds Fibroblasts Pancreas cells Mesenchymal Cells Smooth muscle Cells CLL tumor Cells Epithelial Cells Bone marrow Cells Kidney Cells Microglia Thymic Cells Macrophages Liver Astrocytes Endothelial Cells Leukemia Cells IPS Cells Cancer Cell line Tongue Cells
10 How do you get started? User meetng Project discussion Feasibility Tissue, cells Project size Time line Choice of method Data output Number of cells to be analyzed LocaTon, cell delivery BioinformaTcs Early contact How many cells must I analyze? NaTonal BioinformaTcs Infrastructure Sweden (NBIS) Data delivery User fees And how deep must I sequence?
11 Single cell submission guidelines OpTmize your cell isolaton protocol Limit Tme of isolaton Be gentle Single cell suspension criteria High viability (>80%) No cell clumps or debris Cell strain and wash FACS facility Cell viability stain Visit us Single cell suspension quality control
12 Smart- seq2 at ESCG 384 well plates IsolaTon: FACS Input: cells/nuclei Full- length Sequencing: 50bp single- read ERCC spike- ins Two different dilutons Flexible delivery
13 STRT- seq- 2i: dual- index 5 single- cell RNA- sequencing Adapted from: Hochgerner H, et al, BioRxiv, 2017 IsolaTon: FACS/dispensing Input: Cells/nuclei Scale: 9600 cells (~2500 cells) Sequencing: 5 - tag (50 bp single read) Up to 8 samples in parallel No size limitaton UMI:s
14 10X Genomics - Drop- seq technology IsolaTon: Droplets Input: Cells/nuclei Scale: ,000 x 8 Sequencing: 3 - tag (HiSeq2500/NovaSeq) Up to 8 samples in parallel Validated up to 30μm (channels 50μm) UMI, cell barcode, sample barcode CellRanger, Loupe, R- package
15 Comparing our services Full- length Quan?ta?ve Smart- seq2 STRT- Wafergen 10xGenomics Format Eppendorf Twin- tek Microwell chip Chromium microfluidics chip Cell number 384 9,600 (~2,500) 8 x ,000 Input FACS- sorted cells Suspension Suspension Transcript coverage Features Flexible delivery Isoforms, SNPs, mutatons Nuclei ERCC spike- ins Full- length 5 3 LimiTng diluton/ FACS Cell selecton Unbiased 8 samples parallel Nuclei High throughput 8 samples parallel Nuclei Sample pooling
16 Data delivery Sequencing at NGI, HiSeq2500, NovaSeq Analysis pipelines for mouse and human In- house: STRT, smart- seq2 Cell ranger: 10xGenomics UPPMAX, BioinformaTcs compute and storage Users apply individually for projects Annotated gene expression data, QC- files, Fastq BioinformaTcs Done by user Support from BILS and WABI CollaboraTons
17 User fees Smart- seq2 384 well plate ValidaTon Smart- seq2 library Sequencing (50 bp, single- read STRT- Wafergen 9600 wells chip (~2,500 cells) ValidaTon STRT library (dual index) Sequencing (50 bp single- read) 10XGenomics 1 sample (~3,000 cells) ValidaTon Illumina library Sequencing (paired- end, dual index) ~40,000 SEK ~50,000 SEK ~42,000 SEK Costs include: Reagents, consumables, instrument depreciaton, instrument service, personnel. Overhead is not included.
18 ESCG StaTsTcs Pig, 1 Monkey, 2 Hydra, 1 Zebrafish, 1 Newt, 2 10X Genomics, Smart- seq2, Human, 33 Mouse, 37 STRT- C1 (Fluidigm), 6729 STRT- seq- 2i (Wafergen), LICR SU Lund InternaTonal UU KI, Huddinge KI, Solna
19
20 What lays ahead? Emerging techniques Single nuclei RNA- sequencing Single cell ATAC- seq Transcriptome + Epigenome Transcriptome + Proteome CRISPR- Cas9 + Transcriptome split- pooling scrna- seq ValidaTon Small molecule FISH Human Cell Atlas
21 The STRT/C1 method AAAAAAAA mrna C1-P1-T31 TTTTTTTTT PvuI site biotin RT & template switching C1-P1-TSO UMI rgrgrg AAAAAAAA C C C TTTTTTTTT cdna amplification C1-P1-PCR GGG AAAAAAAA CCC TTTTTTTTT C1-P1-PCR Tagmentation GGG CCC AAAAAAAA TTTTTTTTT Illumina P2 GGG CCC Cell barcode AAAAAAAA TTTTTTTTT Streptavidin bead separation - pooling - PvuI restriction GGG CCC AAAAAAAA TTTTTTTTT Sequencing GGG CCC Read 2 Modified from: Picelli (2016), RNA Biology, July 21: 1-14 Read 1
22 The Smart-seq2 method AAAAAAAA mrna NVTTTTTTTTT SMARTdT30VN +G --> LNA-modified G RT & template switching TSO-LNA rgrg+g AAAAAAAA C C C NVTTTTTTTTT cdna amplification ISPCR GGG CCC AAAAAAAA NVTTTTTTTTT ISPCR Tagmentation & library preparation GGG CCC AAAAAAAA NVTTTTTTTTT i5 index Illumina P5 Illumina P7 i7 index Sequencing Read 1 Modified from: Picelli (2016), RNA Biology, July 21: 1-14 Read 2
SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA
SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA The most sensitive cdna synthesis technology, combined with next-generation
More informationIllumina Bio-Rad Single Cell Sequencing For Research Use Only. Not for use in diagnostic procedures.
Illumina Bio-Rad Single Cell Sequencing 2016 Illumina, Inc. All rights reserved. Illumina, 24sure, BaseSpace, BeadArray, BlueFish, BlueFuse, BlueGnome, cbot, CSPro, CytoChip, DesignStudio, Epicentre, ForenSeq,
More informationFull-length single-cell RNA-seq applied to a viral human. cancer: Applications to HPV expression and splicing analysis. Supplementary Information
Full-length single-cell RNA-seq applied to a viral human cancer: Applications to HPV expression and splicing analysis in HeLa S3 cells Liang Wu 1, Xiaolong Zhang 1,2, Zhikun Zhao 1,3,4, Ling Wang 5, Bo
More informationSingle Cell Genomics
Single Cell Genomics Application Cost Platform/Protoc ol Note Single cell 3 mrna-seq cell lysis/rt/library prep $2460/Sample 10X Genomics Chromium 500-10,000 cells/sample Single cell 5 V(D)J mrna-seq cell
More informationTECH NOTE SMARTer T-cell receptor profiling in single cells
TECH NOTE SMARTer T-cell receptor profiling in single cells Flexible workflow: Illumina-ready libraries from FACS or manually sorted single cells Ease of use: Optimized indexing allows for pooling 96 cells
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationQIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd
QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s
More informationFunctional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017
Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Agenda What is Functional Genomics? RNA Transcription/Gene Expression Measuring Gene
More informationBase Composition of Sequencing Reads of Chromium Single Cell 3 v2 Libraries
TECHNICAL NOTE Base Composition of Sequencing Reads of Chromium Single Cell 3 v2 Libraries INTRODUCTION The Chromium Single Cell 3 v2 Protocol (CG00052) produces Single Cell 3 libraries, ready for Illumina
More informationIntroduction to Microarray Analysis
Introduction to Microarray Analysis Methods Course: Gene Expression Data Analysis -Day One Rainer Spang Microarrays Highly parallel measurement devices for gene expression levels 1. How does the microarray
More informationWelcome to the NGS webinar series
Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic
More informationComparative Analysis of Single-Cell RNA Sequencing Methods
Article Comparative Analysis of Single-Cell RNA Sequencing Methods Graphical Abstract Authors Christoph Ziegenhain, Beate Vieth, Swati Parekh,..., Holger Heyn, Ines Hellmann, Wolfgang Enard Correspondence
More informationNature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 Workflow for multimodal analysis using sc-gem on a programmable microfluidic device (Fluidigm). 1) Cells are captured and lysed, 2) RNA from lysed single cell is reverse-transcribed
More informationGlobin Block Modules for QuantSeq Instruction Manual
Globin Block Modules for QuantSeq Instruction Manual Catalog Numbers: 070 (RS-Globin Block, Homo sapiens, 96 rxn) 071 (RS-Globin Block, Sus scrofa, 96 rxn) 015 (QuantSeq 3 mrna-seq Library Prep Kit for
More informationMethods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
More informationTechnical note: Molecular Index counting adjustment methods
Technical note: Molecular Index counting adjustment methods By Jue Fan, Jennifer Tsai, Eleen Shum Introduction. Overview of BD Precise assays BD Precise assays are fast, high-throughput, next-generation
More informationQuantitative single-cell RNA-seq with unique molecular identifiers
brief communications 2013 Nature America, Inc. All rights reserved. Quantitative single-cell RNA-seq with unique molecular identifiers Saiful Islam 1, Amit Zeisel 1, Simon Joost 2, Gioele La Manno 1, Pawel
More informationRIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP)
Application Note: RIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP) Introduction: Innovations in DNA sequencing during the 21st century have revolutionized our ability to obtain nucleotide information
More informationTargeted Sequencing Using Droplet-Based Microfluidics. Keith Brown Director, Sales
Targeted Sequencing Using Droplet-Based Microfluidics Keith Brown Director, Sales brownk@raindancetech.com Who we are: is a Provider of Microdroplet-based Solutions The Company s RainStorm TM Technology
More informationQuartz-Seq2: a high-throughput single-cell RNA-sequencing method that effectively uses limited sequence reads
Sasagawa et al. Genome Biology (218) 19:29 https://doi.org/1.1186/s1359-18-147-3 METHOD Quartz-Seq2: a high-throughput single-cell RNA-sequencing method that effectively uses limited sequence reads Yohei
More informationDNA Microarray Technology
CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic
More informationSOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit
SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit Agenda SOLiD Total RNAseq Kit Overview Kit Configurations Barcoding Kit Introduction New Small RNA and WT Workflow Small RNA Workflow Step-by-step Workflow
More informationConsiderations for Illumina library preparation. Henriette O Geen June 20, 2014 UCD Genome Center
Considerations for Illumina library preparation Henriette O Geen June 20, 2014 UCD Genome Center Diversity of applications De novo genome Sequencing ranscriptome Expression Splice Isoform bundance Genotyping
More informationA Genomics (R)evolution: Harnessing the Power of Single Cells
A Genomics (R)evolution: Harnessing the Power of Single Cells Fundamental Question #1 If Transcriptional Heterogeneity ( Noise ) is so great in single cells What s the Point? Single Cells = True Biology
More informationRNA-Sequencing analysis
RNA-Sequencing analysis Markus Kreuz 25. 04. 2012 Institut für Medizinische Informatik, Statistik und Epidemiologie Content: Biological background Overview transcriptomics RNA-Seq RNA-Seq technology Challenges
More informationData and Metadata Models Recommendations Version 1.2 Developed by the IHEC Metadata Standards Workgroup
Data and Metadata Models Recommendations Version 1.2 Developed by the IHEC Metadata Standards Workgroup 1. Introduction The data produced by IHEC is illustrated in Figure 1. Figure 1. The space of epigenomic
More information2/5/16. Honeypot Ants. DNA sequencing, Transcriptomics and Genomics. Gene sequence changes? And/or gene expression changes?
2/5/16 DNA sequencing, Transcriptomics and Genomics Honeypot Ants "nequacatl" BY2208, Mani Lecture 3 Gene sequence changes? And/or gene expression changes? gene expression differences DNA sequencing, Transcriptomics
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationNext-Generation Sequencing. Technologies
Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062
More informationIntroduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute
Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how
More informationRNA-Seq Workshop AChemS Sunil K Sukumaran Monell Chemical Senses Center Philadelphia
RNA-Seq Workshop AChemS 2017 Sunil K Sukumaran Monell Chemical Senses Center Philadelphia Benefits & downsides of RNA-Seq Benefits: High resolution, sensitivity and large dynamic range Independent of prior
More informationGene Expression on the Fluidigm BioMark HD
Gene Expression on the Fluidigm BioMark HD Overview Introduction to Fluidigm James Miller Advantages of the technology Running a Fluidigm gene expression project Paul Lacaze Assay design, chemistry, experimental
More information3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
More informationMicroarrays: since we use probes we obviously must know the sequences we are looking at!
These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression
More informationIntroduction Bioo Scientific
Next Generation Sequencing Catalog 2014-2015 Introduction Bioo Scientific Bioo Scientific is a global life science company headquartered in Austin, TX, committed to providing innovative products and superior
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationSingle Cell 3 Reagent Kits v2 Quick Reference Cards
Chromium Single Cell 3 Reagent Kits v2 Quick Reference Cards FOR USE WITH Chromium Single Cell 3' Library & Gel Bead Kit v2 PN-120237 Chromium Single Cell 3 Chip Kit v2 PN-120236 Chromium i7 Multiplex
More informationWhole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist
Whole Transcriptome Analysis of Illumina RNA- Seq Data Ryan Peters Field Application Specialist Partek GS in your NGS Pipeline Your Start-to-Finish Solution for Analysis of Next Generation Sequencing Data
More informationEcho-Enhanced SMART-Seq v4 for RNA Sequencing
Echo-Enhanced SMART-Seq v4 for RNA Sequencing Jefferson Lai, Anna Lehto, John Lesnick and Carl Jarman Labcyte Inc. INTRODUCTION As the cost of sequencing has continued to decline by orders of magnitude
More informationIncorporating Molecular ID Technology. Accel-NGS 2S MID Indexing Kits
Incorporating Molecular ID Technology Accel-NGS 2S MID Indexing Kits Molecular Identifiers (MIDs) MIDs are indices used to label unique library molecules MIDs can assess duplicate molecules in sequencing
More informationHow much sequencing do I need? Emily Crisovan Genomics Core
How much sequencing do I need? Emily Crisovan Genomics Core How much sequencing? Three questions: 1. How much sequence is required for good experimental design? 2. What type of sequencing run is best?
More informationINTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
More informationProduct selection guide Ion GeneStudio S5 Series
Cancer genomics research Molecular profiling Ion AmpliSeq Comprehensive Cancer Panel Cat. No. 4477685 Ion AmpliSeq Made-to-Order Panels (Customize your own or browse redesigned community panels at ampliseq.com)
More informationProduct selection guide Ion S5 and Ion S5 XL Systems
Product selection guide Ion S5 and s Cancer genomics research Molecular profiling Ion AmpliSeq Ready-to-Use Panels Ion AmpliSeq Comprehensive Cancer Panel Cat. No. 4477685 Ion AmpliSeq Made-to-Order Panels
More informationGene Regulation Solutions. Microarrays and Next-Generation Sequencing
Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationNext Gen Sequencing. Expansion of sequencing technology. Contents
Next Gen Sequencing Contents 1 Expansion of sequencing technology 2 The Next Generation of Sequencing: High-Throughput Technologies 3 High Throughput Sequencing Applied to Genome Sequencing (TEDed CC BY-NC-ND
More informationStem Cell Services. Driving Innovation for Stem Cell Researchers
Driving Innovation for Stem Cell Researchers Stem Cell Services Partner with us and have access to the most advanced and comprehensive stem cell services available today. 675 W. Kendall St. Cambridge,
More informationLATE-PCR. Linear-After-The-Exponential
LATE-PCR Linear-After-The-Exponential A Patented Invention of the Laboratory of Human Genetics and Reproductive Biology Lab. Director: Lawrence J. Wangh, Ph.D. Department of Biology, Brandeis University,
More informationReverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami
Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami hanialhadrami@kau.edu.sa www.hanialhadrami.kau.edu.sa Overview Several techniques are available to detect and analyse RNA. Examples of these techniques
More informationImpact of gdna Integrity on the Outcome of DNA Methylation Studies
Impact of gdna Integrity on the Outcome of DNA Methylation Studies Application Note Nucleic Acid Analysis Authors Emily Putnam, Keith Booher, and Xueguang Sun Zymo Research Corporation, Irvine, CA, USA
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More informationCM581A2: NEXT GENERATION SEQUENCING PLATFORMS AND LIBRARY GENERATION
CM581A2: NEXT GENERATION SEQUENCING PLATFORMS AND LIBRARY GENERATION Fall 2015 Instructors: Coordinator: Carol Wilusz, Associate Professor MIP, CMB Instructor: Dan Sloan, Assistant Professor, Biology,
More informationThermo Scientific DharmaFECT Transfection Reagents sirna Transfection Protocol
Protocol Thermo Scientific Transfection Reagents sirna Transfection Protocol The following is a general protocol for use of Thermo Scientific transfection reagents to deliver sirna into cultured mammalian
More informationSingle Cell 3 Reagent Kits v2 Quick Reference Cards
Chromium Single Cell 3 Reagent Kits v2 Quick Reference Cards FOR USE WITH Chromium Single Cell 3' Library & Gel Bead Kit v2, 16 rxns PN-120237 Chromium Single Cell 3' Library & Gel Bead Kit, 4 rxns PN-120267
More informationPlease purchase PDFcamp Printer on to remove this watermark. DNA microarray
DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of
More informationSingle Cell Genomics (SCG): Market Size, Segmentation, Growth, Competition and Trends ( )
Single Cell Genomics (SCG): Market Size, Segmentation, Growth, Competition and Trends (2013-2021) May, 2017 3 rd Edition Information contained in this market report is believed to be reliable at the time
More informationHLA-Typing Strategies
HLA-Typing Strategies Cologne, 13.5.2017 Joannis Mytilineos MD, PhD Department of Transplantation Immunology Institute for Clinical Transfusion Medicine and Immunogenetics German Red Cross Blood Transfusion
More informationNext Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms
Next Generation Sequencing Lecture Saarbrücken, 19. March 2012 Sequencing Platforms Contents Introduction Sequencing Workflow Platforms Roche 454 ABI SOLiD Illumina Genome Anlayzer / HiSeq Problems Quality
More informationStudent Learning Outcomes (SLOS)
Student Learning Outcomes (SLOS) KNOWLEDGE AND LEARNING SKILLS USE OF KNOWLEDGE AND LEARNING SKILLS - how to use Annhyb to save and manage sequences - how to use BLAST to compare sequences - how to get
More informationOutline and learning objectives. From Proteomics to Systems Biology. Integration of omics - information
From to Systems Biology Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - What can we learn Limitations Integration of omics - In-class
More informationDNA. bioinformatics. epigenetics methylation structural variation. custom. assembly. gene. tumor-normal. mendelian. BS-seq. prediction.
Epigenomics T TM activation SNP target ncrna validation metagenomics genetics private RRBS-seq de novo trio RIP-seq exome mendelian comparative genomics DNA NGS ChIP-seq bioinformatics assembly tumor-normal
More informationImplementation of Automated Sample Quality Control in Whole Exome Sequencing
Journal of Life Sciences 11 (2017) 261-268 doi: 10.17265/1934-7391/2017.06.001 D DAVID PUBLISHING Implementation of Automated Sample Quality Control in Whole Exome Sequencing Elisa Viering 1, Jana Molitor
More informationHigh Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Monday September 15, 2014
High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Monday September 15, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion
More informationscgem Workflow Experimental Design Single cell DNA methylation primer design
scgem Workflow Experimental Design Single cell DNA methylation primer design The scgem DNA methylation assay uses qpcr to measure digestion of target loci by the methylation sensitive restriction endonuclease
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationHuman genome sequence
NGS: the basics Human genome sequence June 26th 2000: official announcement of the completion of the draft of the human genome sequence (truly finished in 2004) Francis Collins Craig Venter HGP: 3 billion
More informationIf Dna Has The Instructions For Building Proteins Why Is Mrna Needed
If Dna Has The Instructions For Building Proteins Why Is Mrna Needed if a strand of DNA has the sequence CGGTATATC, then the complementary each strand of DNA contains the info needed to produce the complementary
More informationless sensitive than RNA-seq but more robust analysis pipelines expensive but quantitiatve standard but typically not high throughput
Chapter 11: Gene Expression The availability of an annotated genome sequence enables massively parallel analysis of gene expression. The expression of all genes in an organism can be measured in one experiment.
More informationIntroductory Next Gen Workshop
Introductory Next Gen Workshop http://www.illumina.ucr.edu/ http://www.genomics.ucr.edu/ Workshop Objectives Workshop aimed at those who are new to Illumina sequencing and will provide: - a basic overview
More informationBIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR)
BIOLOGY 207 - Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) Required readings and problems: Reading: Open Genetics, Chapter 8.1 Problems: Chapter 8 Optional Griffiths (2008) 9
More informationDNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationHigh Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014
High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion
More informationYear III Pharm.D Dr. V. Chitra
Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves
More informationNature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 PPAR-γ is dispensable for the development of tissue macrophages in the heart, kidneys, lamina propria and white adipose tissue. Plots show the expression of F4/80 and CD11b (a) or
More informationTowards detection of minimal residual disease in multiple myeloma through circulating tumour DNA sequence analysis
Towards detection of minimal residual disease in multiple myeloma through circulating tumour DNA sequence analysis Trevor Pugh, PhD, FACMG Princess Margaret Cancer Centre, University Health Network Dept.
More informationIllumina TruSeq RNA Access Library Prep Kit Automated on the Biomek FX P Dual-Hybrid Liquid Handler
Illumina TruSeq RNA Access Library Prep Kit Automated on the Biomek FX P Dual-Hybrid Liquid Handler Introduction David Horvath, M.S., Senior Applications Scientist, Beckman Coulter, Inc.; Tim Hill, Scientist,
More informationQuant One Step RT-PCR Kit
1. Quant One Step RT-PCR Kit For fast and sensitive one-step RT-PCR www.tiangen.com/en RT121221 Quant One Step RT-PCR Kit Kit Contents Cat. no. KR113 Contents Hotmaster Taq Polymerase (2.5 U/μl) Quant
More informationMeasuring transcriptomes with RNA-Seq
Measuring transcriptomes with RNA-Seq BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2017 Anthony Gitter gitter@biostat.wisc.edu These slides, excluding third-party material, are licensed under CC BY-NC
More informationPoly A + RNA polya 3' XXXXX. SMART CDS primer First-strand synthesis & tailing by SMARTScribe RT. SMARTer II A Oligonucleotide. Single step 5' XXXXX
5' 5' XXXXX SMARTer II A Oligonucleotide XXXXX 5' 5' XXXXX Poly A + RNA polya 3' SMART CDS primer First-strand synthesis & tailing y SMARTScrie RT polya Template switching and extension y SMARTScrie RT
More informationLong and short/small RNA-seq data analysis
Long and short/small RNA-seq data analysis GEF5, 4.9.2015 Sami Heikkinen, PhD, Dos. Topics 1. RNA-seq in a nutshell 2. Long vs short/small RNA-seq 3. Bioinformatic analysis work flows GEF5 / Heikkinen
More informationRNAseq Differential Gene Expression Analysis Report
RNAseq Differential Gene Expression Analysis Report Customer Name: Institute/Company: Project: NGS Data: Bioinformatics Service: IlluminaHiSeq2500 2x126bp PE Differential gene expression analysis Sample
More informationIntroduction to Bioinformatics and Gene Expression Technologies
Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a
More informationMicroarray Gene Expression Analysis at CNIO
Microarray Gene Expression Analysis at CNIO Orlando Domínguez Genomics Unit Biotechnology Program, CNIO 8 May 2013 Workflow, from samples to Gene Expression data Experimental design user/gu/ubio Samples
More informationGoals of pharmacogenomics
Goals of pharmacogenomics Use drugs better and use better drugs! People inherit/exhibit differences in drug: Absorption Metabolism and degradation of the drug Transport of drug to the target molecule Excretion
More informationmeasuring gene expression December 5, 2017
measuring gene expression December 5, 2017 transcription a usually short-lived RNA copy of the DNA is created through transcription RNA is exported to the cytoplasm to encode proteins some types of RNA
More informationab Post-Bisulfite DNA Library Preparation Kit (For Illumina )
ab185906 Post-Bisulfite DNA Library Preparation Kit (For Illumina ) Instructions for Use For the preparation of a DNA library for various Illumina platform-based bisulfite sequencing (bisulfite-seq) assays.
More informationAn improved quantitative real-time PCR protocol for precisely measuring D-amino acid oxidase mrna in rat tissues
An improved quantitative real-time PCR protocol for precisely measuring D-amino acid oxidase mrna in rat tissues Yoshikazu Nishiguchi 1*, Koichi Kitamura 1, Naoko Watanabe 2, Anna Kozaki 3, Hayato Otani
More informationAssay Standards Working Group Nov 2012 Assay Standards Working Group Recommendations, November 2012
Assay Standards Working Group Recommendations, November 2012 Contents Assay Standards Working Group Recommendations, August 2012... 1 Contents... 1 Introduction... 2 1: Reference Epigenome Criteria...
More informationWELCOME. Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS)
WELCOME Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS) Director, UB Genomics and Bioinformatics Core (GBC) o o o o o o o o o o o o Grow
More informationNEBNext. Multiplex Oligos for Illumina (Dual Index Primers Set 2)
LIBRARY PREPARATION Multiplex Oligos for Illumina (Dual Index Primers Set 2) Instruction Manual NEB #E7780S 96 reactions Version 1.0 11/17 be INSPIRED drive DISCOVERY stay GENUINE This product is intended
More informationIndex. E Electrophoretic Mobility Shift Assay (EMSA), 262 ENCODE project, 223, 224 European Nucleotide Archive (ENA), 34
A Alternative splicing computational analysis, 114 data processing, 106 experimental design, 114 isoform quantification AltAnalyze, 109 CuffDiff, 110 DEXSeq, 108 DiffSplice, 109 exon/transcript isoform,
More informationHigh Throughput Sequencing Technologies. UCD Genome Center Bioinformatics Core Monday 15 June 2015
High Throughput Sequencing Technologies UCD Genome Center Bioinformatics Core Monday 15 June 2015 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion 2011 PacBio
More informationJenny Gu, PhD Strategic Business Development Manager, PacBio
IDT and PacBio joint presentation Characterizing Alzheimer s Disease candidate genes and transcripts with targeted, long-read, single-molecule sequencing Jenny Gu, PhD Strategic Business Development Manager,
More informationBioinformatics Advice on Experimental Design
Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics
More informationMMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit
MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit Cat. No. MM070150 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA265E MMLV Reverse Transcriptase 1st-Strand cdna Synthesis
More informationRecent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)
Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on
More informationChapter 15 Gene Technologies and Human Applications
Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect
More information