Single- cell RNA sequencing methodologies and ESCG pla:orm. Karolina Wallenborg October 2, 2017

Size: px
Start display at page:

Download "Single- cell RNA sequencing methodologies and ESCG pla:orm. Karolina Wallenborg October 2, 2017"

Transcription

1 Single- cell RNA sequencing methodologies and ESCG pla:orm Karolina Wallenborg October 2, 2017

2 From Wikipedia

3 Short history of scrna- seq 10XGenomics BioRad/Illumina BD Resolve Adapted from: Kolodziejczyk A et al, Molecular Cell, 2015

4 ApplicaTons for scrna- sequencing Heterogeneity analysis Cell type identficaton Lineage tracing, cellular states in differentaton and development Monoallelic gene expression, splicing pazerns Zeisel A, et al, Science 2015

5 Single- cell isolaton or capture MulT- Sample Nano- Dispenser Micro- well chip Cytoplasmic aspiraton Adapted from: Kolodziejczyk A et al, Molecular Cell, 2015

6 Reverse transcripton and amplificaton Adapted from: Kolodziejczyk A et al, Molecular Cell, 2015 Poly(T) primer Single cell contain ~10 pg total RNA 1-5% is mrna 10-20% of the transcripts get reverse transcribed

7 Current scrna- sequencing protocols Adapted from Poulin JF et al, Nature Neuroscience, 2016

8 Single- cell RNA- sequencing protocols - Which method suits you? Full- length Whole transcript informaton Gene expression quantficaton Isoform, SNP and mutatons Tag- based methods (5 or 3 ) EsTmate of transcript abundance Early multplexing Combined with molecular countng Retain DNA strand informaton

9 ESCG pla:orm Started in 2015 Sten Linnarsson (STRT- seq, STRT/C1), Rickard Sandberg (Smart- seq2) High throughput single- cell RNA- sequencing 280,000 single cells sequenced 77 projects Number of projects per cell type Oligodendrocytes Breast Cancer Cells Brain cells Ependymal cells Cardiomyocytes Neurons KeraTnocytes GBM cells Neural Crest Cells Innate Lymphoid Cells Blastema Cells ES Cells Immune Cells CAFs Endothelial Cells Pericytes SpermaTds Fibroblasts Pancreas cells Mesenchymal Cells Smooth muscle Cells CLL tumor Cells Epithelial Cells Bone marrow Cells Kidney Cells Microglia Thymic Cells Macrophages Liver Astrocytes Endothelial Cells Leukemia Cells IPS Cells Cancer Cell line Tongue Cells

10 How do you get started? User meetng Project discussion Feasibility Tissue, cells Project size Time line Choice of method Data output Number of cells to be analyzed LocaTon, cell delivery BioinformaTcs Early contact How many cells must I analyze? NaTonal BioinformaTcs Infrastructure Sweden (NBIS) Data delivery User fees And how deep must I sequence?

11 Single cell submission guidelines OpTmize your cell isolaton protocol Limit Tme of isolaton Be gentle Single cell suspension criteria High viability (>80%) No cell clumps or debris Cell strain and wash FACS facility Cell viability stain Visit us Single cell suspension quality control

12 Smart- seq2 at ESCG 384 well plates IsolaTon: FACS Input: cells/nuclei Full- length Sequencing: 50bp single- read ERCC spike- ins Two different dilutons Flexible delivery

13 STRT- seq- 2i: dual- index 5 single- cell RNA- sequencing Adapted from: Hochgerner H, et al, BioRxiv, 2017 IsolaTon: FACS/dispensing Input: Cells/nuclei Scale: 9600 cells (~2500 cells) Sequencing: 5 - tag (50 bp single read) Up to 8 samples in parallel No size limitaton UMI:s

14 10X Genomics - Drop- seq technology IsolaTon: Droplets Input: Cells/nuclei Scale: ,000 x 8 Sequencing: 3 - tag (HiSeq2500/NovaSeq) Up to 8 samples in parallel Validated up to 30μm (channels 50μm) UMI, cell barcode, sample barcode CellRanger, Loupe, R- package

15 Comparing our services Full- length Quan?ta?ve Smart- seq2 STRT- Wafergen 10xGenomics Format Eppendorf Twin- tek Microwell chip Chromium microfluidics chip Cell number 384 9,600 (~2,500) 8 x ,000 Input FACS- sorted cells Suspension Suspension Transcript coverage Features Flexible delivery Isoforms, SNPs, mutatons Nuclei ERCC spike- ins Full- length 5 3 LimiTng diluton/ FACS Cell selecton Unbiased 8 samples parallel Nuclei High throughput 8 samples parallel Nuclei Sample pooling

16 Data delivery Sequencing at NGI, HiSeq2500, NovaSeq Analysis pipelines for mouse and human In- house: STRT, smart- seq2 Cell ranger: 10xGenomics UPPMAX, BioinformaTcs compute and storage Users apply individually for projects Annotated gene expression data, QC- files, Fastq BioinformaTcs Done by user Support from BILS and WABI CollaboraTons

17 User fees Smart- seq2 384 well plate ValidaTon Smart- seq2 library Sequencing (50 bp, single- read STRT- Wafergen 9600 wells chip (~2,500 cells) ValidaTon STRT library (dual index) Sequencing (50 bp single- read) 10XGenomics 1 sample (~3,000 cells) ValidaTon Illumina library Sequencing (paired- end, dual index) ~40,000 SEK ~50,000 SEK ~42,000 SEK Costs include: Reagents, consumables, instrument depreciaton, instrument service, personnel. Overhead is not included.

18 ESCG StaTsTcs Pig, 1 Monkey, 2 Hydra, 1 Zebrafish, 1 Newt, 2 10X Genomics, Smart- seq2, Human, 33 Mouse, 37 STRT- C1 (Fluidigm), 6729 STRT- seq- 2i (Wafergen), LICR SU Lund InternaTonal UU KI, Huddinge KI, Solna

19

20 What lays ahead? Emerging techniques Single nuclei RNA- sequencing Single cell ATAC- seq Transcriptome + Epigenome Transcriptome + Proteome CRISPR- Cas9 + Transcriptome split- pooling scrna- seq ValidaTon Small molecule FISH Human Cell Atlas

21 The STRT/C1 method AAAAAAAA mrna C1-P1-T31 TTTTTTTTT PvuI site biotin RT & template switching C1-P1-TSO UMI rgrgrg AAAAAAAA C C C TTTTTTTTT cdna amplification C1-P1-PCR GGG AAAAAAAA CCC TTTTTTTTT C1-P1-PCR Tagmentation GGG CCC AAAAAAAA TTTTTTTTT Illumina P2 GGG CCC Cell barcode AAAAAAAA TTTTTTTTT Streptavidin bead separation - pooling - PvuI restriction GGG CCC AAAAAAAA TTTTTTTTT Sequencing GGG CCC Read 2 Modified from: Picelli (2016), RNA Biology, July 21: 1-14 Read 1

22 The Smart-seq2 method AAAAAAAA mrna NVTTTTTTTTT SMARTdT30VN +G --> LNA-modified G RT & template switching TSO-LNA rgrg+g AAAAAAAA C C C NVTTTTTTTTT cdna amplification ISPCR GGG CCC AAAAAAAA NVTTTTTTTTT ISPCR Tagmentation & library preparation GGG CCC AAAAAAAA NVTTTTTTTTT i5 index Illumina P5 Illumina P7 i7 index Sequencing Read 1 Modified from: Picelli (2016), RNA Biology, July 21: 1-14 Read 2

SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA

SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA The most sensitive cdna synthesis technology, combined with next-generation

More information

Illumina Bio-Rad Single Cell Sequencing For Research Use Only. Not for use in diagnostic procedures.

Illumina Bio-Rad Single Cell Sequencing For Research Use Only. Not for use in diagnostic procedures. Illumina Bio-Rad Single Cell Sequencing 2016 Illumina, Inc. All rights reserved. Illumina, 24sure, BaseSpace, BeadArray, BlueFish, BlueFuse, BlueGnome, cbot, CSPro, CytoChip, DesignStudio, Epicentre, ForenSeq,

More information

Full-length single-cell RNA-seq applied to a viral human. cancer: Applications to HPV expression and splicing analysis. Supplementary Information

Full-length single-cell RNA-seq applied to a viral human. cancer: Applications to HPV expression and splicing analysis. Supplementary Information Full-length single-cell RNA-seq applied to a viral human cancer: Applications to HPV expression and splicing analysis in HeLa S3 cells Liang Wu 1, Xiaolong Zhang 1,2, Zhikun Zhao 1,3,4, Ling Wang 5, Bo

More information

Single Cell Genomics

Single Cell Genomics Single Cell Genomics Application Cost Platform/Protoc ol Note Single cell 3 mrna-seq cell lysis/rt/library prep $2460/Sample 10X Genomics Chromium 500-10,000 cells/sample Single cell 5 V(D)J mrna-seq cell

More information

TECH NOTE SMARTer T-cell receptor profiling in single cells

TECH NOTE SMARTer T-cell receptor profiling in single cells TECH NOTE SMARTer T-cell receptor profiling in single cells Flexible workflow: Illumina-ready libraries from FACS or manually sorted single cells Ease of use: Optimized indexing allows for pooling 96 cells

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd

QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s

More information

Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017

Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Agenda What is Functional Genomics? RNA Transcription/Gene Expression Measuring Gene

More information

Base Composition of Sequencing Reads of Chromium Single Cell 3 v2 Libraries

Base Composition of Sequencing Reads of Chromium Single Cell 3 v2 Libraries TECHNICAL NOTE Base Composition of Sequencing Reads of Chromium Single Cell 3 v2 Libraries INTRODUCTION The Chromium Single Cell 3 v2 Protocol (CG00052) produces Single Cell 3 libraries, ready for Illumina

More information

Introduction to Microarray Analysis

Introduction to Microarray Analysis Introduction to Microarray Analysis Methods Course: Gene Expression Data Analysis -Day One Rainer Spang Microarrays Highly parallel measurement devices for gene expression levels 1. How does the microarray

More information

Welcome to the NGS webinar series

Welcome to the NGS webinar series Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic

More information

Comparative Analysis of Single-Cell RNA Sequencing Methods

Comparative Analysis of Single-Cell RNA Sequencing Methods Article Comparative Analysis of Single-Cell RNA Sequencing Methods Graphical Abstract Authors Christoph Ziegenhain, Beate Vieth, Swati Parekh,..., Holger Heyn, Ines Hellmann, Wolfgang Enard Correspondence

More information

Nature Methods: doi: /nmeth Supplementary Figure 1

Nature Methods: doi: /nmeth Supplementary Figure 1 Supplementary Figure 1 Workflow for multimodal analysis using sc-gem on a programmable microfluidic device (Fluidigm). 1) Cells are captured and lysed, 2) RNA from lysed single cell is reverse-transcribed

More information

Globin Block Modules for QuantSeq Instruction Manual

Globin Block Modules for QuantSeq Instruction Manual Globin Block Modules for QuantSeq Instruction Manual Catalog Numbers: 070 (RS-Globin Block, Homo sapiens, 96 rxn) 071 (RS-Globin Block, Sus scrofa, 96 rxn) 015 (QuantSeq 3 mrna-seq Library Prep Kit for

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

Technical note: Molecular Index counting adjustment methods

Technical note: Molecular Index counting adjustment methods Technical note: Molecular Index counting adjustment methods By Jue Fan, Jennifer Tsai, Eleen Shum Introduction. Overview of BD Precise assays BD Precise assays are fast, high-throughput, next-generation

More information

Quantitative single-cell RNA-seq with unique molecular identifiers

Quantitative single-cell RNA-seq with unique molecular identifiers brief communications 2013 Nature America, Inc. All rights reserved. Quantitative single-cell RNA-seq with unique molecular identifiers Saiful Islam 1, Amit Zeisel 1, Simon Joost 2, Gioele La Manno 1, Pawel

More information

RIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP)

RIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP) Application Note: RIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP) Introduction: Innovations in DNA sequencing during the 21st century have revolutionized our ability to obtain nucleotide information

More information

Targeted Sequencing Using Droplet-Based Microfluidics. Keith Brown Director, Sales

Targeted Sequencing Using Droplet-Based Microfluidics. Keith Brown Director, Sales Targeted Sequencing Using Droplet-Based Microfluidics Keith Brown Director, Sales brownk@raindancetech.com Who we are: is a Provider of Microdroplet-based Solutions The Company s RainStorm TM Technology

More information

Quartz-Seq2: a high-throughput single-cell RNA-sequencing method that effectively uses limited sequence reads

Quartz-Seq2: a high-throughput single-cell RNA-sequencing method that effectively uses limited sequence reads Sasagawa et al. Genome Biology (218) 19:29 https://doi.org/1.1186/s1359-18-147-3 METHOD Quartz-Seq2: a high-throughput single-cell RNA-sequencing method that effectively uses limited sequence reads Yohei

More information

DNA Microarray Technology

DNA Microarray Technology CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic

More information

SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit

SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit Agenda SOLiD Total RNAseq Kit Overview Kit Configurations Barcoding Kit Introduction New Small RNA and WT Workflow Small RNA Workflow Step-by-step Workflow

More information

Considerations for Illumina library preparation. Henriette O Geen June 20, 2014 UCD Genome Center

Considerations for Illumina library preparation. Henriette O Geen June 20, 2014 UCD Genome Center Considerations for Illumina library preparation Henriette O Geen June 20, 2014 UCD Genome Center Diversity of applications De novo genome Sequencing ranscriptome Expression Splice Isoform bundance Genotyping

More information

A Genomics (R)evolution: Harnessing the Power of Single Cells

A Genomics (R)evolution: Harnessing the Power of Single Cells A Genomics (R)evolution: Harnessing the Power of Single Cells Fundamental Question #1 If Transcriptional Heterogeneity ( Noise ) is so great in single cells What s the Point? Single Cells = True Biology

More information

RNA-Sequencing analysis

RNA-Sequencing analysis RNA-Sequencing analysis Markus Kreuz 25. 04. 2012 Institut für Medizinische Informatik, Statistik und Epidemiologie Content: Biological background Overview transcriptomics RNA-Seq RNA-Seq technology Challenges

More information

Data and Metadata Models Recommendations Version 1.2 Developed by the IHEC Metadata Standards Workgroup

Data and Metadata Models Recommendations Version 1.2 Developed by the IHEC Metadata Standards Workgroup Data and Metadata Models Recommendations Version 1.2 Developed by the IHEC Metadata Standards Workgroup 1. Introduction The data produced by IHEC is illustrated in Figure 1. Figure 1. The space of epigenomic

More information

2/5/16. Honeypot Ants. DNA sequencing, Transcriptomics and Genomics. Gene sequence changes? And/or gene expression changes?

2/5/16. Honeypot Ants. DNA sequencing, Transcriptomics and Genomics. Gene sequence changes? And/or gene expression changes? 2/5/16 DNA sequencing, Transcriptomics and Genomics Honeypot Ants "nequacatl" BY2208, Mani Lecture 3 Gene sequence changes? And/or gene expression changes? gene expression differences DNA sequencing, Transcriptomics

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

Next-Generation Sequencing. Technologies

Next-Generation Sequencing. Technologies Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062

More information

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how

More information

RNA-Seq Workshop AChemS Sunil K Sukumaran Monell Chemical Senses Center Philadelphia

RNA-Seq Workshop AChemS Sunil K Sukumaran Monell Chemical Senses Center Philadelphia RNA-Seq Workshop AChemS 2017 Sunil K Sukumaran Monell Chemical Senses Center Philadelphia Benefits & downsides of RNA-Seq Benefits: High resolution, sensitivity and large dynamic range Independent of prior

More information

Gene Expression on the Fluidigm BioMark HD

Gene Expression on the Fluidigm BioMark HD Gene Expression on the Fluidigm BioMark HD Overview Introduction to Fluidigm James Miller Advantages of the technology Running a Fluidigm gene expression project Paul Lacaze Assay design, chemistry, experimental

More information

3.1.4 DNA Microarray Technology

3.1.4 DNA Microarray Technology 3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns

More information

Microarrays: since we use probes we obviously must know the sequences we are looking at!

Microarrays: since we use probes we obviously must know the sequences we are looking at! These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression

More information

Introduction Bioo Scientific

Introduction Bioo Scientific Next Generation Sequencing Catalog 2014-2015 Introduction Bioo Scientific Bioo Scientific is a global life science company headquartered in Austin, TX, committed to providing innovative products and superior

More information

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen

More information

Single Cell 3 Reagent Kits v2 Quick Reference Cards

Single Cell 3 Reagent Kits v2 Quick Reference Cards Chromium Single Cell 3 Reagent Kits v2 Quick Reference Cards FOR USE WITH Chromium Single Cell 3' Library & Gel Bead Kit v2 PN-120237 Chromium Single Cell 3 Chip Kit v2 PN-120236 Chromium i7 Multiplex

More information

Whole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist

Whole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist Whole Transcriptome Analysis of Illumina RNA- Seq Data Ryan Peters Field Application Specialist Partek GS in your NGS Pipeline Your Start-to-Finish Solution for Analysis of Next Generation Sequencing Data

More information

Echo-Enhanced SMART-Seq v4 for RNA Sequencing

Echo-Enhanced SMART-Seq v4 for RNA Sequencing Echo-Enhanced SMART-Seq v4 for RNA Sequencing Jefferson Lai, Anna Lehto, John Lesnick and Carl Jarman Labcyte Inc. INTRODUCTION As the cost of sequencing has continued to decline by orders of magnitude

More information

Incorporating Molecular ID Technology. Accel-NGS 2S MID Indexing Kits

Incorporating Molecular ID Technology. Accel-NGS 2S MID Indexing Kits Incorporating Molecular ID Technology Accel-NGS 2S MID Indexing Kits Molecular Identifiers (MIDs) MIDs are indices used to label unique library molecules MIDs can assess duplicate molecules in sequencing

More information

How much sequencing do I need? Emily Crisovan Genomics Core

How much sequencing do I need? Emily Crisovan Genomics Core How much sequencing do I need? Emily Crisovan Genomics Core How much sequencing? Three questions: 1. How much sequence is required for good experimental design? 2. What type of sequencing run is best?

More information

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing

More information

Product selection guide Ion GeneStudio S5 Series

Product selection guide Ion GeneStudio S5 Series Cancer genomics research Molecular profiling Ion AmpliSeq Comprehensive Cancer Panel Cat. No. 4477685 Ion AmpliSeq Made-to-Order Panels (Customize your own or browse redesigned community panels at ampliseq.com)

More information

Product selection guide Ion S5 and Ion S5 XL Systems

Product selection guide Ion S5 and Ion S5 XL Systems Product selection guide Ion S5 and s Cancer genomics research Molecular profiling Ion AmpliSeq Ready-to-Use Panels Ion AmpliSeq Comprehensive Cancer Panel Cat. No. 4477685 Ion AmpliSeq Made-to-Order Panels

More information

Gene Regulation Solutions. Microarrays and Next-Generation Sequencing

Gene Regulation Solutions. Microarrays and Next-Generation Sequencing Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

Next Gen Sequencing. Expansion of sequencing technology. Contents

Next Gen Sequencing. Expansion of sequencing technology. Contents Next Gen Sequencing Contents 1 Expansion of sequencing technology 2 The Next Generation of Sequencing: High-Throughput Technologies 3 High Throughput Sequencing Applied to Genome Sequencing (TEDed CC BY-NC-ND

More information

Stem Cell Services. Driving Innovation for Stem Cell Researchers

Stem Cell Services. Driving Innovation for Stem Cell Researchers Driving Innovation for Stem Cell Researchers Stem Cell Services Partner with us and have access to the most advanced and comprehensive stem cell services available today. 675 W. Kendall St. Cambridge,

More information

LATE-PCR. Linear-After-The-Exponential

LATE-PCR. Linear-After-The-Exponential LATE-PCR Linear-After-The-Exponential A Patented Invention of the Laboratory of Human Genetics and Reproductive Biology Lab. Director: Lawrence J. Wangh, Ph.D. Department of Biology, Brandeis University,

More information

Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami

Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami hanialhadrami@kau.edu.sa www.hanialhadrami.kau.edu.sa Overview Several techniques are available to detect and analyse RNA. Examples of these techniques

More information

Impact of gdna Integrity on the Outcome of DNA Methylation Studies

Impact of gdna Integrity on the Outcome of DNA Methylation Studies Impact of gdna Integrity on the Outcome of DNA Methylation Studies Application Note Nucleic Acid Analysis Authors Emily Putnam, Keith Booher, and Xueguang Sun Zymo Research Corporation, Irvine, CA, USA

More information

Lecture #1. Introduction to microarray technology

Lecture #1. Introduction to microarray technology Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing

More information

CM581A2: NEXT GENERATION SEQUENCING PLATFORMS AND LIBRARY GENERATION

CM581A2: NEXT GENERATION SEQUENCING PLATFORMS AND LIBRARY GENERATION CM581A2: NEXT GENERATION SEQUENCING PLATFORMS AND LIBRARY GENERATION Fall 2015 Instructors: Coordinator: Carol Wilusz, Associate Professor MIP, CMB Instructor: Dan Sloan, Assistant Professor, Biology,

More information

Thermo Scientific DharmaFECT Transfection Reagents sirna Transfection Protocol

Thermo Scientific DharmaFECT Transfection Reagents sirna Transfection Protocol Protocol Thermo Scientific Transfection Reagents sirna Transfection Protocol The following is a general protocol for use of Thermo Scientific transfection reagents to deliver sirna into cultured mammalian

More information

Single Cell 3 Reagent Kits v2 Quick Reference Cards

Single Cell 3 Reagent Kits v2 Quick Reference Cards Chromium Single Cell 3 Reagent Kits v2 Quick Reference Cards FOR USE WITH Chromium Single Cell 3' Library & Gel Bead Kit v2, 16 rxns PN-120237 Chromium Single Cell 3' Library & Gel Bead Kit, 4 rxns PN-120267

More information

Please purchase PDFcamp Printer on to remove this watermark. DNA microarray

Please purchase PDFcamp Printer on  to remove this watermark. DNA microarray DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of

More information

Single Cell Genomics (SCG): Market Size, Segmentation, Growth, Competition and Trends ( )

Single Cell Genomics (SCG): Market Size, Segmentation, Growth, Competition and Trends ( ) Single Cell Genomics (SCG): Market Size, Segmentation, Growth, Competition and Trends (2013-2021) May, 2017 3 rd Edition Information contained in this market report is believed to be reliable at the time

More information

HLA-Typing Strategies

HLA-Typing Strategies HLA-Typing Strategies Cologne, 13.5.2017 Joannis Mytilineos MD, PhD Department of Transplantation Immunology Institute for Clinical Transfusion Medicine and Immunogenetics German Red Cross Blood Transfusion

More information

Next Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms

Next Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms Next Generation Sequencing Lecture Saarbrücken, 19. March 2012 Sequencing Platforms Contents Introduction Sequencing Workflow Platforms Roche 454 ABI SOLiD Illumina Genome Anlayzer / HiSeq Problems Quality

More information

Student Learning Outcomes (SLOS)

Student Learning Outcomes (SLOS) Student Learning Outcomes (SLOS) KNOWLEDGE AND LEARNING SKILLS USE OF KNOWLEDGE AND LEARNING SKILLS - how to use Annhyb to save and manage sequences - how to use BLAST to compare sequences - how to get

More information

Outline and learning objectives. From Proteomics to Systems Biology. Integration of omics - information

Outline and learning objectives. From Proteomics to Systems Biology. Integration of omics - information From to Systems Biology Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - What can we learn Limitations Integration of omics - In-class

More information

DNA. bioinformatics. epigenetics methylation structural variation. custom. assembly. gene. tumor-normal. mendelian. BS-seq. prediction.

DNA. bioinformatics. epigenetics methylation structural variation. custom. assembly. gene. tumor-normal. mendelian. BS-seq. prediction. Epigenomics T TM activation SNP target ncrna validation metagenomics genetics private RRBS-seq de novo trio RIP-seq exome mendelian comparative genomics DNA NGS ChIP-seq bioinformatics assembly tumor-normal

More information

Implementation of Automated Sample Quality Control in Whole Exome Sequencing

Implementation of Automated Sample Quality Control in Whole Exome Sequencing Journal of Life Sciences 11 (2017) 261-268 doi: 10.17265/1934-7391/2017.06.001 D DAVID PUBLISHING Implementation of Automated Sample Quality Control in Whole Exome Sequencing Elisa Viering 1, Jana Molitor

More information

High Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Monday September 15, 2014

High Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Monday September 15, 2014 High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Monday September 15, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion

More information

scgem Workflow Experimental Design Single cell DNA methylation primer design

scgem Workflow Experimental Design Single cell DNA methylation primer design scgem Workflow Experimental Design Single cell DNA methylation primer design The scgem DNA methylation assay uses qpcr to measure digestion of target loci by the methylation sensitive restriction endonuclease

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

Human genome sequence

Human genome sequence NGS: the basics Human genome sequence June 26th 2000: official announcement of the completion of the draft of the human genome sequence (truly finished in 2004) Francis Collins Craig Venter HGP: 3 billion

More information

If Dna Has The Instructions For Building Proteins Why Is Mrna Needed

If Dna Has The Instructions For Building Proteins Why Is Mrna Needed If Dna Has The Instructions For Building Proteins Why Is Mrna Needed if a strand of DNA has the sequence CGGTATATC, then the complementary each strand of DNA contains the info needed to produce the complementary

More information

less sensitive than RNA-seq but more robust analysis pipelines expensive but quantitiatve standard but typically not high throughput

less sensitive than RNA-seq but more robust analysis pipelines expensive but quantitiatve standard but typically not high throughput Chapter 11: Gene Expression The availability of an annotated genome sequence enables massively parallel analysis of gene expression. The expression of all genes in an organism can be measured in one experiment.

More information

Introductory Next Gen Workshop

Introductory Next Gen Workshop Introductory Next Gen Workshop http://www.illumina.ucr.edu/ http://www.genomics.ucr.edu/ Workshop Objectives Workshop aimed at those who are new to Illumina sequencing and will provide: - a basic overview

More information

BIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR)

BIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) BIOLOGY 207 - Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) Required readings and problems: Reading: Open Genetics, Chapter 8.1 Problems: Chapter 8 Optional Griffiths (2008) 9

More information

DNA Arrays Affymetrix GeneChip System

DNA Arrays Affymetrix GeneChip System DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC

More information

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

High Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014

High Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014 High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion

More information

Year III Pharm.D Dr. V. Chitra

Year III Pharm.D Dr. V. Chitra Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves

More information

Nature Immunology: doi: /ni Supplementary Figure 1

Nature Immunology: doi: /ni Supplementary Figure 1 Supplementary Figure 1 PPAR-γ is dispensable for the development of tissue macrophages in the heart, kidneys, lamina propria and white adipose tissue. Plots show the expression of F4/80 and CD11b (a) or

More information

Towards detection of minimal residual disease in multiple myeloma through circulating tumour DNA sequence analysis

Towards detection of minimal residual disease in multiple myeloma through circulating tumour DNA sequence analysis Towards detection of minimal residual disease in multiple myeloma through circulating tumour DNA sequence analysis Trevor Pugh, PhD, FACMG Princess Margaret Cancer Centre, University Health Network Dept.

More information

Illumina TruSeq RNA Access Library Prep Kit Automated on the Biomek FX P Dual-Hybrid Liquid Handler

Illumina TruSeq RNA Access Library Prep Kit Automated on the Biomek FX P Dual-Hybrid Liquid Handler Illumina TruSeq RNA Access Library Prep Kit Automated on the Biomek FX P Dual-Hybrid Liquid Handler Introduction David Horvath, M.S., Senior Applications Scientist, Beckman Coulter, Inc.; Tim Hill, Scientist,

More information

Quant One Step RT-PCR Kit

Quant One Step RT-PCR Kit 1. Quant One Step RT-PCR Kit For fast and sensitive one-step RT-PCR www.tiangen.com/en RT121221 Quant One Step RT-PCR Kit Kit Contents Cat. no. KR113 Contents Hotmaster Taq Polymerase (2.5 U/μl) Quant

More information

Measuring transcriptomes with RNA-Seq

Measuring transcriptomes with RNA-Seq Measuring transcriptomes with RNA-Seq BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2017 Anthony Gitter gitter@biostat.wisc.edu These slides, excluding third-party material, are licensed under CC BY-NC

More information

Poly A + RNA polya 3' XXXXX. SMART CDS primer First-strand synthesis & tailing by SMARTScribe RT. SMARTer II A Oligonucleotide. Single step 5' XXXXX

Poly A + RNA polya 3' XXXXX. SMART CDS primer First-strand synthesis & tailing by SMARTScribe RT. SMARTer II A Oligonucleotide. Single step 5' XXXXX 5' 5' XXXXX SMARTer II A Oligonucleotide XXXXX 5' 5' XXXXX Poly A + RNA polya 3' SMART CDS primer First-strand synthesis & tailing y SMARTScrie RT polya Template switching and extension y SMARTScrie RT

More information

Long and short/small RNA-seq data analysis

Long and short/small RNA-seq data analysis Long and short/small RNA-seq data analysis GEF5, 4.9.2015 Sami Heikkinen, PhD, Dos. Topics 1. RNA-seq in a nutshell 2. Long vs short/small RNA-seq 3. Bioinformatic analysis work flows GEF5 / Heikkinen

More information

RNAseq Differential Gene Expression Analysis Report

RNAseq Differential Gene Expression Analysis Report RNAseq Differential Gene Expression Analysis Report Customer Name: Institute/Company: Project: NGS Data: Bioinformatics Service: IlluminaHiSeq2500 2x126bp PE Differential gene expression analysis Sample

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a

More information

Microarray Gene Expression Analysis at CNIO

Microarray Gene Expression Analysis at CNIO Microarray Gene Expression Analysis at CNIO Orlando Domínguez Genomics Unit Biotechnology Program, CNIO 8 May 2013 Workflow, from samples to Gene Expression data Experimental design user/gu/ubio Samples

More information

Goals of pharmacogenomics

Goals of pharmacogenomics Goals of pharmacogenomics Use drugs better and use better drugs! People inherit/exhibit differences in drug: Absorption Metabolism and degradation of the drug Transport of drug to the target molecule Excretion

More information

measuring gene expression December 5, 2017

measuring gene expression December 5, 2017 measuring gene expression December 5, 2017 transcription a usually short-lived RNA copy of the DNA is created through transcription RNA is exported to the cytoplasm to encode proteins some types of RNA

More information

ab Post-Bisulfite DNA Library Preparation Kit (For Illumina )

ab Post-Bisulfite DNA Library Preparation Kit (For Illumina ) ab185906 Post-Bisulfite DNA Library Preparation Kit (For Illumina ) Instructions for Use For the preparation of a DNA library for various Illumina platform-based bisulfite sequencing (bisulfite-seq) assays.

More information

An improved quantitative real-time PCR protocol for precisely measuring D-amino acid oxidase mrna in rat tissues

An improved quantitative real-time PCR protocol for precisely measuring D-amino acid oxidase mrna in rat tissues An improved quantitative real-time PCR protocol for precisely measuring D-amino acid oxidase mrna in rat tissues Yoshikazu Nishiguchi 1*, Koichi Kitamura 1, Naoko Watanabe 2, Anna Kozaki 3, Hayato Otani

More information

Assay Standards Working Group Nov 2012 Assay Standards Working Group Recommendations, November 2012

Assay Standards Working Group Nov 2012 Assay Standards Working Group Recommendations, November 2012 Assay Standards Working Group Recommendations, November 2012 Contents Assay Standards Working Group Recommendations, August 2012... 1 Contents... 1 Introduction... 2 1: Reference Epigenome Criteria...

More information

WELCOME. Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS)

WELCOME. Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS) WELCOME Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS) Director, UB Genomics and Bioinformatics Core (GBC) o o o o o o o o o o o o Grow

More information

NEBNext. Multiplex Oligos for Illumina (Dual Index Primers Set 2)

NEBNext. Multiplex Oligos for Illumina (Dual Index Primers Set 2) LIBRARY PREPARATION Multiplex Oligos for Illumina (Dual Index Primers Set 2) Instruction Manual NEB #E7780S 96 reactions Version 1.0 11/17 be INSPIRED drive DISCOVERY stay GENUINE This product is intended

More information

Index. E Electrophoretic Mobility Shift Assay (EMSA), 262 ENCODE project, 223, 224 European Nucleotide Archive (ENA), 34

Index. E Electrophoretic Mobility Shift Assay (EMSA), 262 ENCODE project, 223, 224 European Nucleotide Archive (ENA), 34 A Alternative splicing computational analysis, 114 data processing, 106 experimental design, 114 isoform quantification AltAnalyze, 109 CuffDiff, 110 DEXSeq, 108 DiffSplice, 109 exon/transcript isoform,

More information

High Throughput Sequencing Technologies. UCD Genome Center Bioinformatics Core Monday 15 June 2015

High Throughput Sequencing Technologies. UCD Genome Center Bioinformatics Core Monday 15 June 2015 High Throughput Sequencing Technologies UCD Genome Center Bioinformatics Core Monday 15 June 2015 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion 2011 PacBio

More information

Jenny Gu, PhD Strategic Business Development Manager, PacBio

Jenny Gu, PhD Strategic Business Development Manager, PacBio IDT and PacBio joint presentation Characterizing Alzheimer s Disease candidate genes and transcripts with targeted, long-read, single-molecule sequencing Jenny Gu, PhD Strategic Business Development Manager,

More information

Bioinformatics Advice on Experimental Design

Bioinformatics Advice on Experimental Design Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics

More information

MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit

MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit Cat. No. MM070150 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA265E MMLV Reverse Transcriptase 1st-Strand cdna Synthesis

More information

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques) Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on

More information

Chapter 15 Gene Technologies and Human Applications

Chapter 15 Gene Technologies and Human Applications Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect

More information