Targeted mutagenesis in mice by electroporation of Cpf1 ribonucleoproteins. Forkhead box N1, transcript variant 1. crrna B

Transcription

1 CORRESPONDENCE Targeted mutagenesis in mice by electroporation of Cpf1 ribonucleoproteins To the Editor: Cpf1 represents a class 2/type V CRISPR RNA-guided endonuclease 1 that is distinct from the type II CRISPR-Cas9 nuclease, widely used for genome editing 2 5. It recognizes thymidine-rich protospaceradjacent motif (PAM) sequences, expanding the range of RNA-guided genome editing beyond guanosine-rich PAM sequences recognized by Streptococcus pyogenes Cas9 (SpCas9). Yet, the potential of Cpf1 for targeted mutagenesis in whole organisms has not been demonstrated. Here, we report generation of mutant mice using preassembled recombinant CRISPR-Cpf1 ribonucleoproteins (RNPs). First, we expressed Acidaminococcus sp. BV3L6 Cpf1 (AsCpf1) in Escherichia coli and purified the resulting recombinant Cpf1 protein (Supplementary Table 1 and Supplementary Methods). We tested the activity of the purified Cpf1 protein in vitro (Supplementary Fig. 1a) and in mouse NIH3T3 cells. Preassembled Cpf1 RNPs cleaved target DNA efficiently in vitro and induced small insertions and deletions (indels) in NIH3T3 cells, with frequencies of up to 45% (Supplementary Fig. 1b), at the target sites in Foxn1 (Fig. 1a), which encodes Forkhead box protein N1, a transcription factor. Having confirmed that Cpf1 RNPs were highly active in vitro and in cultured cells, we carried out Cpf1 RNP-mediated genome editing in mouse embryos. We microinjected the AsCpf1 RNPs into 36 one-cell-stage embryos, cultured them in vitro, and obtained 12 blastocysts (Supplementary Fig. 2a). T7 endonuclease 1 (T7E1) assay and targeted deep sequencing showed that 10 out of 12 (83%) blastocysts contained Cpf1-mediated mutations in Foxn1 (Supplementary Fig. 2b,c and Supplementary Table 2,3). SpCas9 RNPs targeted to the same region in the gene showed a comparable efficiency (90%) (Supplementary Fig. 3). No off-target mutations were detected at homologous sites with up to 4-nucleotide mismatches using a c d WT Forkhead box N1, transcript variant 1 TTTTGGAAGGATTGAGGGCCCACAGACAGCCCTTTCGAGAGGAACTTCCGGATTTATTC the T7E1 assay and targeted deep sequencing (Supplementary Table 4 and Supplementary Fig. 4), suggesting that Cpf1 RNPs were highly specific. Next, we investigated whether both Cas9 RNPs and Cpf1 RNPs could be delivered AA T TT Exon 7 CTTGTCGATTTTGGAAGGATTGAGGGCCCACAGACAGCCCTTTCGAGAGGAACTTCCGGATTTATTCTCCACCTTCTCAAAGCACT crrna A GAAGGATTGAGGGCCCACAGACA Target gene No. of examined embryos crrna B No. of 2-cell stage embryos (%) GAGAGGAACTTCCGGATTTATTC T No. of blastocysts (%) AGAGGAACTTCG No. of transferred embryos b RNP No. of offspring (%) Cpf1 Indel (bp) Frequency (%) , , , , , into animal embryos by electroporation rather than microinjection. Although microinjection is a widely adopted method for making transgenic or gene knockout animals, microinjecting single-cell embryos individually is technically difficult, requiring + crrna Electroporation 50 embryos in a chamber Mutant ratio (%) (no. of mutant/total blastocysts or offsprings) Foxn (79) 25 (51) NA NA 64 (16/25) NA, not applicable (79) NA 30 7 (23) 43 (3/7) Figure 1 Cpf1 RNP-mediated genome editing in mouse embryos by electroporation. (a) Two CRISPR RNAs (crrnas) that target sequences in Foxn1 exon 7. (b) Schematic of Cpf1 RNP delivery to a mouse embryo by electroporation. (c) Targeted deep sequencing assay to analyze mutations at the target site. The target sequence and PAM are indicated by red and green, respectively. Predicted Cpf1 cleavage sites are marked by red arrowheads. (d) Summary of the numbers of embryos used and mutants generated in Cpf1 RNP electroporation with crrnas targeting Foxn1 sites. NATURE BIOTECHNOLOGY ADVANCE ONLINE PUBLICATION 1

2 CORRESPONDENCE extensive training, and is also labor-intensive. A skilled researcher can handle hundreds of embryos per day at best. Using the electroporation method, we simultaneously delivered RNP to multiple embryos, up to 50 at once, within 5 minutes. We electroporated SpCas9 RNPs targeting the Vegfa or Foxn1 locus in the mouse genome into 50 embryos for each locus in a chamber electrode 6, which were then cultured to blastocysts. 12 of 15 (80%) or 11 of 11 (100%) blastocysts obtained had mutations at the Vegfa or Foxn1 target site, respectively (Supplementary Fig. 5), suggesting that electroporation is an efficient method for delivering Cas9 RNPs into animal embryos. We then electroporated AsCpf1 RNPs, targeting two sites in the Foxn1 exon 7, into mouse embryos (Fig. 1b). Analysis of the 25 blastocysts revealed that 16 (64%) contained mutations at the target sites (Fig. 1c and Supplementary Table 2). No off-target mutations were observed at 14 homologous sites that differed from the two Foxn1 ontarget sites by four mismatches. We also electroporated an AsCpf1 RNP targeting Tyr, the gene encoding tyrosinase, into mouse embryos and observed mutations in 4 out of 12 blastocysts (33%) (Supplementary Fig. 6). Taken together, these results show that Cas9 and Cpf1 RNPs can be delivered efficiently by electroporation into animal embryos, resulting in high mutation frequencies. We next transplanted mouse embryos after Cpf1 microinjection or electroporation into surrogate mothers and obtained mice with targeted mutations in Foxn1 (Fig. 1d and Supplementary Fig. 7a) or Tyr (Supplementary Table 2 and Supplementary Fig. 8a). Three out of seven mice carried mutations at the Cpf1 cleavage site in the Foxn1 gene. One Tyr mutant mouse showed a partial coat color change, consistent with its mosaic genotype (Supplementary Fig. 8b). To investigate whether Cpf1 had offtarget effects, we performed whole genome sequencing using genomic DNA isolated from one Foxn1 mutant mouse and its wildtype sibling (Supplementary Note). The sequence analysis showed that no off-target mutations were introduced at homologous sites with up to 7-nucleotide mismatches. Notably, the mutant allele in a female Foxn1 mutant mouse was transmitted to embryos (Supplementary Fig. 7b,c). In summary, our results show that electroporation of AsCpf1 RNPs resulted in efficient and specific genome editing in mouse embryos. RNPs 7 are as effective as mrna 8 or plasmids 9, but are degraded rapidly by endogenous proteases and RNases in cells, and have been previously shown to reduce off-target effects 9 and mosaicism 10. Unlike microinjection, electroporation is easy to carry out, fast, and scalable. Up to 50 embryos can be electroporated simultaneously. We propose that electroporation of Cpf1 RNPs is a potentially useful new method for genome editing in animals. Editor s note: This article has been peer reviewed. Note: Any Supplementary Information and Source Data files are available in the online version of the paper (doi: /nbt.3596). ACKNOWLEDGMENTS We thank Ji-hyun Ju for the help with the nextgeneration sequencing, and the members of the Genome Engineering Lab for helpful discussions and comments. This work was supported by the Institute for Basic Science (IBS-R021-D1 to J.-S.K.). AUTHOR CONTRIBUTIONS J.K.H., K.M.K., Y.S.L., and J.-S.K. designed the research, and J.K.H., K.M.K., K.W.B., G.Y.B., S.H.Y., J.W.H., and S.M.R. performed the experiments. J.-S.K. supervised the research. All authors discussed the results and commented on the manuscript. COMPETING FINANCIAL INTERESTS The authors declare competing financial interests: details are available in the online version of the paper (doi: /nbt.3596). Junho K Hur 1,6, Kyoungmi Kim 1,6, Kyung Wook Been 1,2, Gayoung Baek 1, Sunghyeok Ye 1,3, Junseok W Hur 1,4, Seuk-Min Ryu 1,2, Youn Su Lee 1,5 & Jin-Soo Kim 1,2 1 Center for Genome Engineering, Institute for Basic Science, Seoul, Republic of Korea. 2 Department of Chemistry, Seoul National University, Seoul, Republic of Korea. 3 Basic Science, IBS School, Korea University of Science and Technology, Seoul, Republic of Korea. 4 Department of Neurosurgery, Korea University College of Medicine, Seoul, Republic of Korea. 5 ToolGen, Seoul, Republic of Korea. 6 These authors contributed equally to this work. (jskim01@snu.ac.kr) Published online 6 June 2016; doi: /nbt Zetsche, B. et al. Cell 163, (2015). 2. Cho, S.W., Kim, S., Kim, J.M. & Kim, J.S. Nat. Biotechnol. 31, (2013). 3. Cong, L. et al. Science 339, (2013). 4. Mali, P. et al. Science 339, (2013). 5. Jinek, M. et al. Science 337, (2012). 6. Kaneko, T. & Mashimo, T. PLoS One 10, e (2015). 7. Cho, S.W., Lee, J., Carroll, D., Kim, J.S. & Lee, J. Genetics 195, (2013). 8. Ménoret, S. et al. Sci. Rep. 5, (2015). 9. Kim, S., Kim, D., Cho, S.W., Kim, J. & Kim, J.S. Genome Res. 24, (2014). 10. Woo, J.W. et al. Nat. Biotechnol. 33, (2015). 2 ADVANCE ONLINE PUBLICATION NATURE BIOTECHNOLOGY

3

4

5

6

7

8

9

10

11 Supplementary Note: Off-target analysis of genome wide sequencing data of Foxn1 mutant mouse a) T7E1 assay to test for the presence of targeted mutations in a FoxN1 mutant mouse made by Cpf1 RNP. Its wild-type sibling was also analyzed for control. Only DNA from the mutant mouse was cleaved, indicating sequence changes. b) Alignment of sequences from the wild-type and mutant mice. The crrna target sequences and PAM are shown in red and green, respectively. A 6-bp deletion was detected at the anticipated cleavage site in FoxN1 exon 7 in the mutant mouse. c) Analysis of WGS results from the FoxN1 mutant mouse and its wild-type sibling.we used ISACC, a variant calling program, to identify a total of 107,216 and 116,141 sites in the mutant and wild-type genome, respectively, that differed from respective sites in the reference genome 1. After filtering out annotated variants in the SNP database (dbsnp), we obtained 56,124 and 63,274 indel sites in the mutant and wild-type genomes, respectively. After excluding 18,685 indel sites commonly identified in both the mutant and wild-type genomes, 37,439 sites were uniquely assigned to the mutant genome. We then compared the DNA sequences at these sites with the on-target sequence. Other than the single on-target site, no sites were homologous to the on-target site. Thus, these sites differed from the on-target site by at least 7 mismatches, suggesting that these variants were not caused by Cpf1 (Fig 2d). Furthermore, none of 12,862 sites, identified using Cas-OFFinder in the reference genome, that differed from the on-target site by up to 7 mismatches harbored indels in the mutant genome, suggesting that the Cpf1 nuclease was highly specific. These results are in line with those obtained using Cas9-induced mutant cell lines 2-5 and animals 6, 7.

12 1. Raczy, C. et al. Isaac: ultra-fast whole-genome secondary analysis on Illumina sequencing platforms. Bioinformatics 29, (2013). 2. Kim, D. et al. Digenome-seq: genome-wide profiling of CRISPR-Cas9 offtarget effects in human cells. Nature methods 12, (2015). 3. Smith, C. et al. Whole-Genome Sequencing Analysis Reveals High Specificity of CRISPR/Cas9 and TALEN-Based Genome Editing in Human ipscs. Cell stem cell 15, (2014). 4. Veres, A. et al. Low Incidence of Off-Target Mutations in Individual CRISPR-Cas9 and TALEN Targeted Human Stem Cell Clones Detected by Whole-Genome Sequencing (vol 15, pg 27, 2014). Cell stem cell 15, (2014). 5. Cho, S.W. et al. Analysis of off-target effects of CRISPR/Cas-derived RNAguided endonucleases and nickases. Genome research 24, (2014). 6. Shen, B. et al. Efficient genome modification by CRISPR-Cas9 nickase with minimal off-target effects. Nature methods 11, (2014). 7. Sung, Y.H. et al. Highly efficient gene knockout in mice and zebrafish with RNA-guided endonucleases. Genome research 24, (2014).

13 Supplementary Methods Cas9 and Cpf1 ribonucleoproteins Recombinant Cas9 protein was purchased from ToolGen (South Korea). Recombinant Cpf1 proteins were expressed in and purified from E. coli. Cpf1- encoding sequences were codon-optimized for E. coli protein expression and subcloned into a 6xHis-MBP expression vector (pdest-hismbp) 1. Rosetta expression cells (EMD Milipore) were transformed with the expression plasmid, and cultured in 2 liters of Luria broth (LB) containing 50 ug/ul carbenicilin. When the OD600 of the culture reached 0.6, the culture was cooled to 16 C and protein expression was induced with 0.5 mm IPTG for hours. The cells were then harvested by centrifugation and frozen at -80 C. For protein purification, the cell pellet was lysed by sonication in 50 ml of lysis buffer (50 mm, HEPES ph 7, 200 mm NaCl, 5 mm MgCl2, 1 mm DTT, 10 mm imidazole) supplemented with lysozyme (Sigma) and protease inhibitor (Roche complete, EDTA-free). Next, the cell lysate was cleared by centrifugation at 16,000 g for 30 mins followed by passage through a syringe filter (0.22 micron). The lysate was incubated with a nickel column (Ni-NTA agarose, Qiagen), which was then washed with 2M NaCl, and the bound protein was eluted with 250 mm imidazole. The solution containing the purified protein was then buffer exchanged and concentrated with lysis buffer lacking magnesium and imidazole. The sizes of the purified Cpf1 proteins were confirmed by SDS-PAGE. SpCas9 sgrnas and Cpf1 crrnas were prepared by in vitro transcription by T7 RNA polymerase as described in a previous study 2. Cpf1 ribonucleoprotein in vitro cleavage assay Purified Cpf1 proteins (1 ug / 10 ul) were incubated with T7 transcribed or chemically synthesized crrna (300 ng / 10 ul) in reaction buffer (100 mm NaCl, 50 mm Tris-

14 HCl, ph 7.9, 10 mm MgCl2, 1mM DTT) as described 3. Target DNA (PCR product, 300 ng / 10 ul) was then added and the mixture was incubated at 37 C for 1 hour. The reaction was terminated by the addition of stop solution (5x, 30% glycerol, 1.2% SDS, 250 mm EDTA). Cleavage products were analyzed by agarose gel electrophoresis and visualized by EtBr staining. Cell culture and transfection NIH3T3 (ATCC) cells were cultured in DMEM medium containing 10% FBS and 1% antibiotics. The cells were not tested for mycoplasma contamination. For AsCpf1 RNP delivery, cells were seeded into 24-well plates at 70-80% confluency and then 2 x 10 5 cells were electroporated with Cpf1 protein (20 ug) and crrna (20 ug) using a Nucleofector (amaxa P3 primary cell 4D-Nucleofector X kit (cat. No. V4XP-3032), Lonza). Program EN-158 was used.the transfected cells were cultured for 48 hours, after which genomic DNA was isolated with a DNeasy Blood & Tissue Kit (Qiagen) for subsequent analyses. Animals All study protocols involving mice were approved by the Institutional Animal Care and Use Committee of Seoul National University. Mice were maintained in a specific pathogen free (SPF) facility under a 12 h dark-light cycle. C57BL/6N and ICR mouse strains were used as embryo donors and foster mothers, respectively. Microinjection and electroporation of one-cell stage embryos C57BL/6N female mice at 4 weeks of age were superovulated by intraperitoneal injection of PMSG (5 IU, Sigma-Aldrich) and hcg hormone (5 IU, Sigma-Aldrich) at a 48-h interval. These mice were mated with C57BL/6N male mice at 11 to 16 weeks of age, and fertilized one-cell embryos were collected from the oviduct. Cumulus cells were removed from embryos by exposure to 0.1% hyaluronidase (Sigma-

15 Aldrich) in PBS buffer. For microinjection, solutions containing complexes of recombinant Cas9 (200 ng/µl, ToolGen, Inc.) or Cpf1 (200 ng/µl) protein with guiderna (for Cas9, 18 µg/µl; for Cpf1, 9 ug/ul) were diluted with DEPC-treated injection buffer (0.25 mm EDTA, 10 mm Tris, ph 7.4) 3 and injected into pronuclei using a Nikon ECLIPSE Ti micromanipulator and a FemtoJet 4i microinjector (Eppendorf). For electroporation of one-cell stage embryos, the glass chamber of a NEPA 21 electroporator (NEPA GENE Co. Ltd.) was filled with 100 µl opti-mem (Thermo Fisher Scientific) containing complexes of recombinant Cas9 (10 µg/100 µl) or Cpf1 (10 µg/100 µl) protein with guiderna (for Cas9, 50 µg/100 µl; for Cpf1, 25 ug/100 ul). Pronuclear stage embryos were placed in the glass chamber and electroporated with the following conditions: poring pulse (voltage, 225 V; length, 1.5 ms; pulse interval, 50 ms; number of pulses, 4; d. rate, 10%; polarity, +) and transfer pulse (voltage, 20 V; length, 50 ms; pulse interval, 50 ms; number of pulses, 5; d. rate, 40%; polarity, +/-). Embryos were cultured in microdrops of KSOM+AA containing D-glucose and phenol red (Millipore) under mineral oil at 37 C for 3.5 days in a humidified atmosphere consisting of 5% CO 2 in air. Two-cell stage embryos were transferred on the following day into the oviducts of 0.5-dpc pseudopregnant foster mothers. Genotyping. DNA was extracted from blastocyst stage embryos or toe clips from 1- week old pups for PCR genotyping. Whole genome sequencing Genomic DNA extracted from mouse ears was subjected to WGS, which was performed at a sequencing depth of 30X to 40X using an Illumina HiSeq X Ten Sequencer (Macrogen, South Korea). The WGS data were mapped to a reference genome (GRCm38/mm10) by Isaac aligner and variants were identified by Isaac

16 Variant Caller (IVC). The identified variants were annotated by SnpEff and the the variants present in dbsnp142 were filtered out SnpEff. The remaining variants were analyzed to determine whether they were candidates for potential mutations at ontarget and potential off-target sites. The putative off-target sites were identified by Cas-Offinder 4. The coordinates were compared and variants that contained mutations encompassing the predicted Cpf1 cleavage sites were selected. Data reporting. No statistical methods were used to predetermine sample size for in vitro and in vivo experiments. The investigators were blinded to allocation during in vitro and in vivo experiments, respectively. Data access. The sequencing data are available at the NCBI Sequence Read Archive (SRA, under accession number SRP

17 Supplementary References 1. Nallamsetty, S., Austin, B.P., Penrose, K.J. & Waugh, D.S. Gateway vectors for the production of combinatorially- tagged His6- MBP fusion proteins in the cytoplasm and periplasm of Escherichia coli. Protein science : a publication of the Protein Society 14, (2005). 2. Kim, S., Kim, D., Cho, S.W., Kim, J. & Kim, J.S. Highly efficient RNA- guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome research 24, (2014). 3. Sung, Y.H. et al. Highly efficient gene knockout in mice and zebrafish with RNA- guided endonucleases. Genome research 24, (2014). 4. Bae, S., Park, J. & Kim, J.S. Cas- OFFinder: a fast and versatile algorithm that searches for potential off- target sites of Cas9 RNA- guided endonucleases. Bioinformatics 30, (2014).

18 Supplementary Table 1. Plasmid and insert sequences of E.coli codon optimized Cpf1. Plasmid information pdest-hismbp : E.coli codon optimized AsCpf1 coding sequences AsCpf1> ATGACACAGTTTGAAGGCTTCACCAATCTCTACCAGGTCAGCAAGACGCTACGTTTTGAGCTTATCCCGCAGGGAAAAACC CTGAAACACATTCAGGAACAGGGGTTCATAGAGGAAGATAAGGCGCGTAACGACCATTATAAAGAACTGAAGCCTATAATC GACCGTATTTATAAAACGTACGCGGATCAGTGCCTGCAGCTGGTTCAGCTGGATTGGGAGAATCTGTCCGCGGCTATTGAT AGCTATCGCAAAGAGAAGACCGAGGAAACCCGTAACGCACTGATTGAAGAGCAGGCGACCTATCGGAATGCGATCCATGA TTACTTCATCGGCCGCACCGACAACCTGACCGATGCAATTAACAAACGTCACGCAGAGATTTACAAAGGTCTGTTTAAAGC AGAGTTATTCAATGGCAAGGTTCTGAAACAGCTGGGTACGGTCACCACCACCGAACACGAAAACGCACTGCTGAGGAGCT TTGATAAATTTACCACATATTTCAGCGGTTTCTATGAAAATCGTAAGAATGTATTTAGCGCCGAAGATATTTCCACCGCAATT CCTCATCGTATTGTGCAGGATAATTTTCCGAAGTTTAAAGAAAATTGTCATATTTTTACCCGTCTGATCACCGCGGTACCGA GCCTGCGAGAGCATTTTGAAAACGTTAAGAAAGCCATTGGAATTTTTGTCAGTACCAGCATTGAAGAAGTGTTTTCGTTCCC GTTCTATAACCAACTGCTGACCCAGACCCAGATTGATCTGTACAATCAGCTGCTGGGGGGCATAAGCCGCGAGGCAGGTA CCGAAAAGATAAAGGGACTCAATGAGGTGCTGAATCTGGCAATTCAGAAGAATGATGAAACGGCTCATATCATTGCTAGCC TGCCGCATCGTTTCATTCCCCTGTTTAAGCAAATCCTGAGCGATCGCAATACACTGAGCTTTATCCTCGAAGAGTTTAAATC GGACGAAGAAGTTATCCAGAGCTTTTGCAAATACAAAACCCTGCTGCGGAACGAAAATGTGCTGGAGACCGCTGAAGCAC TGTTTAATGAACTGAACTCGATCGACCTCACCCATATTTTTATATCCCACAAAAAACTGGAAACCATAAGCAGCGCTCTGTG TGACCATTGGGATACCCTGCGCAACGCCCTGTATGAACGGCGTATCAGCGAGCTGACCGGGAAAATCACCAAATCCGCAA AGGAAAAAGTTCAGCGTAGTCTGAAACACGAGGACATCAACCTGCAAGAAATTATTAGCGCAGCAGGTAAAGAGCTGAGC GAAGCATTCAAACAGAAAACCAGCGAAATCCTGAGCCATGCCCATGCTGCACTGGATCAGCCGCTGCCGACCACCCTGAA AAAACAGGAGGAAAAGGAGATTCTGAAAAGCCAACTGGACAGCCTGCTGGGCCTGTATCACCTGCTGGACTGGTTTGCAG TCGATGAGAGCAACGAGGTTGATCCTGAGTTCTCCGCTCGTCTGACCGGAATCAAGCTGGAGATGGAACCGAGTCTGTCG TTTTACAATAAAGCGCGTAATTACGCGACCAAGAAACCGTATAGCGTGGAAAAATTCAAACTGAACTTTCAGATGCCGACCC TTGCAAGCGGATGGGACGTTAACAAAGAAAAAAACAATGGGGCAATTCTGTTTGTGAAAAATGGCCTCTATTATCTGGGTAT CATGCCGAAACAGAAAGGGCGCTACAAAGCCCTGTCATTTGAGCCGACCGAGAAAACCTCAGAGGGTTTCGACAAGATGT ACTACGATTATTTCCCGGATGCGGCAAAAATGATACCCAAATGTAGCACCCAACTGAAGGCAGTTACAGCCCACTTTCAGA CCCATACCACCCCGATCCTGCTGTCGAACAATTTTATAGAGCCGCTGGAAATTACCAAAGAGATTTATGATCTGAATAATCC GGAAAAGGAGCCCAAGAAATTTCAGACGGCGTATGCAAAAAAGACCGGGGATCAGAAAGGTTATCGTGAAGCGCTGTGCA AATGGATTGACTTTACCCGTGACTTTCTGTCAAAATATACCAAAACGACGAGCATTGATCTGAGCAGCCTACGTCCGAGCA GCCAATATAAGGATCTGGGCGAATATTACGCCGAACTGAATCCGCTGCTCTACCATATTTCCTTCCAACGAATCGCTGAAA AAGAAATAATGGACGCCGTTGAAACCGGCAAACTGTATCTGTTTCAAATCTACAACAAAGATTTCGCCAAAGGCCATCACG GTAAGCCGAACCTGCATACCCTGTATTGGACCGGTCTGTTTAGCCCGGAGAATCTGGCCAAAACCAGCATCAAGCTGAAC GGACAGGCAGAACTGTTTTACCGCCCCAAAAGCCGTATGAAAAGGATGGCACACCGCCTGGGCGAAAAAATGCTGAATAA GAAACTCAAAGATCAGAAAACGCCGATACCGGATACCCTTTATCAGGAGCTGTATGATTATGTTAACCACCGGCTGAGCCA TGACCTGAGCGACGAAGCGCGTGCACTGCTGCCGAACGTGATTACCAAGGAAGTCTCGCATGAAATTATTAAAGATCGGC GCTTCACCAGTGATAAATTTTTCTTCCATGTACCGATCACCCTGAATTATCAAGCCGCAAATAGCCCTTCCAAATTTAATCAA CGCGTGAATGCGTACCTGAAAGAGCATCCGGAGACCCCAATTATTGGCATAGACCGAGGAGAACGCAATCTCATTTATATC ACCGTCATTGATAGCACCGGTAAGATCCTGGAACAGCGTAGCCTGAATACCATTCAGCAGTTTGACTACCAGAAAAAGCTG GACAACAGAGAAAAGGAACGTGTAGCCGCCCGGCAGGCTTGGAGTGTGGTGGGTACTATCAAGGATCTGAAGCAGGGGT ATCTCTCCCAAGTTATCCATGAAATTGTCGATCTAATGATTCACTATCAAGCAGTAGTGGTACTGGAAAATCTGAATTTCGGT TTCAAAAGCAAACGTACAGGGATCGCTGAAAAAGCCGTTTATCAGCAGTTCGAGAAAATGCTGATAGACAAGCTGAATTGC CTGGTTCTGAAAGATTATCCGGCAGAGAAGGTGGGCGGTGTGCTGAACCCGTACCAGCTGACTGATCAATTTACGAGCTT TGCAAAAATGGGAACGCAGAGCGGTTTCCTGTTCTATGTTCCGGCGCCATATACCAGCAAGATAGACCCGCTGACAGGTTT CGTAGATCCGTTTGTCTGGAAAACCATTAAAAATCATGAAAGTCGCAAACATTTTCTGGAGGGCTTTGATTTTCTGCACTAT GACGTGAAAACCGGCGACTTCATTCTGCATTTTAAAATGAACCGTAATCTGTCCTTTCAGCGCGGCCTGCCTGGCTTTATG CCGGCGTGGGACATTGTTTTTGAAAAGAATGAGACACAGTTTGATGCCAAAGGTACCCCCTTTATTGCGGGGAAACGCATT GTGCCCGTTATAGAAAATCACCGCTTCACCGGACGGTATAGGGACTTGTACCCGGCAAATGAATTGATAGCGCTGCTGGA GGAGAAAGGTATTGTCTTTCGGGATGGATCAAACATCCTGCCGAAGCTGCTGGAGAACGATGACAGCCACGCAATAGACA CCATGGTAGCGCTGATCCGAAGCGTGCTGCAGATGCGTAACAGTAATGCGGCTACGGGGGAAGACTACATTAATAGCCCG GTCCGTGATCTGAACGGCGTTTGTTTCGATAGCAGATTTCAAAATCCGGAGTGGCCGATGGATGCCGATGCCAATGGAGC TTACCATATCGCTCTCAAAGGTCAGCTCCTACTGAACCATTTGAAAGAATCAAAAGATCTGAAACTGCAGAACGGCATCTCG AATCAGGACTGGCTGGCCTACATTCAAGAACTGAGAAAC

19 Supplementary Table 2. Numbers and ratios of mouse embryos, blastocysts, and newborn mice in Cas9 or Cpf1-mediated genome editing experiments Target gene Nuclease Method No. of examined embryos No. of 2-cell stage embryos (%) No. of blastocysts (%) No. of transferred embryos No. of offsprings (%) Mutant ratio (%) (No. of mutant/total blastocysts or offsprings) FoxN1 Cas9 Microinjection (78%) 21 (54%) NA NA 90% (19/21) Cpf1 Microinjection (81%) 12 (41%) NA NA 83% (10/12) Cpf1 Microinjection (84%) NA 33 6 (18%) 17% (1/6) FoxN1 Cas9 Electroporation (35%) 11 (42%) NA NA 100% (11/11) Cpf1 Electroporation (79%) 25 (51%) NA NA 64% (16/25) Cpf1 Electroporation (79%) NA 30 7 (23%) 43% (3/7) Tyr Cpf1 Electroporation (64%) 12 (41%) NA NA 33% (4/12) * NA: not applicable Cpf1 Electroporation (65%) NA 46 7 (15%) 14% (1/7)

20 Supplementary Table 3. Sequences of oligos used for sgrna and crrna transcription and targeted deep sequencing.

21 Supplementary Table 4. Potential off-target sites of crrnas targeting Foxn1 exon 7 Foxn1 potential off- target sites (up to 4 mismatches) chr coodinate sequence (mismatch in lower character) crrna- A TTTTGAAaGATgGAGGGCtCACAGgCA TTTAGAAGtAaTGAGGGCCCAaAGcCA TTTTGAAGGATTGAGaGtCCACAGttA crrna- B TTTTctGAGGAACTTCCaGATTTATTt TTTTctGAGGAACTTCCaGATTTATTt TTTTctGAGGAACcTCCaGATTTATTC TTTTcAGAGGAACTaCCGtATTTATTt TTTGGtGAGGAACTgCCaGATTTATTt TTTTctGAGGAACTTCCaGATTTATTt TTTTGtGAGGAACcTCCGGATTgATTt TTTTctGAGGAACTTCCaGATTTATTt X TTTCcAGAGGAACcTCCaGATTTATTt X TTTTctGAGGAACTTCCaGATTgATTC X TTTTctGAGGAACTgCCaGATTTATTC