Orange Fruit Color in Capsicum due to Deletion of Capsanthin-capsorubin Synthesis Gene

Transcription

1 Breeding Science 54 : (2004) Orange Fruit Color in Capsicum due to Deletion of Capsanthin-capsorubin Synthesis Gene Ya-Qin Lang 1), Satoshi Yanagawa 2), Tsuneo Sasanuma 1) and Tetsuo Sasakuma* 1) 1) Graduate School of Integrated Science & Kihara Institute for Biological Research, Yokohama City University, Maioka, Totsuka, Yokohama, Kanagawa , Japan 2) Tokita Seed Co., Nakagawa, Saitama , Japan Fruit color of pungent pepper (Capsicum annuum L.) is a trait of economic importance in pepper breeding. To develop a system of molecular marker-assisted selection (MAS) for breeding pepper varieties with various fruit colors, we conducted molecular genetic analyses on six genes involved in the carotenoid biosynthesis pathway. Capsanthin-capsorubin synthase (CCS) gene showed a polymorphism in the PCR pattern in the segregation population derived from a cross between a pepper accession (cv. msgty-1) with orange fruits and a pepper accession (cv. 277long) with red fruits. A deletion was found in the upstream region of the CCS gene in the plants with orange fruits. Southern hybridization analysis and sequencing analysis indicated that 211-bp of the downstream region of the gene was conserved in the plants with orange fruits, while no transcript of the CCS gene was detected by RT-PCR in the mature orange fruits. Carotenoid composition analysis using the Thin layer chromatography (TLC) method showed that one of the major pepper carotenoids, capsanthin, was present in the red fruits, but not in the orange fruits. The PCR polymorphism of the CCS gene and TLC pattern of carotenoid composition were completely cosegregated with the fruit color in the F 2 population, suggesting that the CCS gene determines the fruit color by changing the carotenoid composition. Key Words: Capsicum annuum, capsanthin-capsorubin synthase (CCS), carotenoids, pepper plant with orange fruits. Introduction Capsicum annuum L. is one of the most commonly used spice crops worldwide. Besides pungency, fruit color is also one of the commercially important characters of pepper. The color of mature pepper fruit is determined by the composition of carotenoids, a group of C 40 isoprenoids. In higher plants, carotenoids assemble in chromoplasts as accessory Communicated by M. Omura Received July 10, Accepted October 10, *Corresponding author ( sasakuma@yokohama-cu.ac.jp) light-harvesting pigments and function in protecting the photosynthetic apparatus from photooxidative damage (Buchanan et al. 2000). Some carotenoids, particularly β- carotene, act as dietary precursors of vitamin A. In the industry, carotenoids from peppers are used as natural colorants. For pepper breeding, the demand for fruits with various colors, besides red, such as yellow and orange, has increased. To satisfy this demand, it is necessary to select lines of pepper objectively and efficiently. Hurtado-Hernandez and Smith (1985) reported eight phenotypes in color ranging from white to red in segregation populations of a cross between pepper plants with white and red fruits. They considered that the color of the mature fruit of pepper is controlled by three independent pairs of genes, namely, c1, c2 and y loci. According to physiological studies on pepper fruit color (Hugueney et al. 1992, 1995, 1996, Romer et al. 1993, Bouvier et al. 1994, 1998, Kuntz et al. 1995, Hirschberg et al. 1997), the metabolic pathway of carotenoid biosynthesis could be identified as shown in Fig. 1. As for the relationship between the carotenoid biosynthesis enzymes and the loci responsible for the pepper fruit color, recent molecular analyses have revealed that the capsanthin-capsorubin synthase (CCS) gene that controlled the segregation between pepper plants with red and yellow fruits corresponds to the y locus (Lefebvre et al. 1998, Popovsky and Paran 2000), and that the phytoene synthase (PSY) gene that determined the segregation between the pepper plants with red and orange fruits corresponds to the c2 locus (Thorup et al. 2000, Huh et al. 2001). However, the gene corresponding to the c1 locus has not yet been identified. In the present study, we investigated the fruit color, carotenoid composition in mature fruits and molecular polymorphism for the genes related to carotenoid biosynthesis in a F 2 population from a cross between pepper plants with orange and red fruits. Based on the results, we determined the association between the carotenoid-related genes and orange color of pepper fruits. Materials and Methods Plant materials Two pepper accessions, Capsicum annuum L. cv. msgty-1 (orange fruit; P 1 ) and 277long (red fruit; P 2 ) developed at the Research Station of Tokita Seed Co. were employed as parents. A total of 65 F 2 plants from P 1 P 2 were

2 34 Lang, Yanagawa, Sasanuma and Sasakuma PCR and CAPS analysis Total DNA was isolated from fresh leaves of the parents and F 2 individuals using DNeasy Plant Mini Kit (QIAGEN). Based on the published sequences, several pairs of oligonucleotide primers were designed to isolate the genes encoding the following enzymes related to the biosynthesis of carotenoids; Geranylgeranyl pyrophosphate synthase (GGPS), Phytoene synthase (PSY), Phytoene desaturase (PDS), Lycopene β-cyclase (Crtl-b), β-carotene hydroxylase (Crtz) and Capsanthin-capsorubin synthase (CCS). Oligonucleotide sequences used to amplify and expected fragment size are shown in Table 1. PCR reactions were performed using total DNA as template under the following conditions; after one cycle of 5 min at 95 C, 30 cycles, each comprising 1 min at 95 C, 2 min at 60 C, and 2 min at 72 C. The PCR products were electrophoresed in 1 % agarose gel and detected by ethidium bromide staining. The PCR products of the genes for GGPS, PSY, PDS, Crtl-b and Crtz amplified from two parents were digested with 16 restriction enzymes, HindIII, BglI, DraI, MspI, HaeIII, SspI, XbaI, SacI, NdeI, EcoRI, HhaI, BlnI, Eco52I, NsiI, BfaI and HpaI. The digested products were electrophoresed to detect restriction site polymorphism between the two parents. Fig. 1. Scheme for the carotenoid biosynthesis pathway in plants. Genes analyzed in this study are shown in boxes. used for segregation analysis. TLC of carotenoids in fruits Pepper fruits were harvested at the ripening stage (40 45 days after flowering). Extraction of carotenoids was carried out according to the methods of Hayashi (1980) and Oliver and Palou (2000). Dried fruit tissues (0.5 g) were ground into a fine powder and incubated for 8 h at 50 C with 15 ml of an ethanol : chloroform solution (V : V = 3 : 1) in a rotatory shaker at 120 rpm. The extract was partitioned into the diethylether phase after addition of water. The extract was subsequently saponified with 1/10 volume of 30 % KOH solution at room temperature. After saponification, the samples were washed two times with distilled water. Thin layer chromatography (TLC) was performed according to the method of Suzuki et al. (1990) using a silica gel plate (60 F 254, 0.5 mm, cm) (Merck Japan) as the carrier and an ether : acetone solution (V : V = 80 : 20) as the developer. Each component of the carotenoids was separated based on the speed difference of the movement on the plate. Standard compounds of beta-carotene and capsanthin were used as reference. Southern hybridization analysis Total DNA was extracted from 200 mg of fresh leaves of both parents and F 1 plants using the CTAB method. A total of 10 µg of DNA was digested with three restriction enzymes (EcoRI, XbaI and HindIII). Digested DNA was electrophoresed in 1 % agarose gel, then transferred onto Hybond N+ membranes (Amersham). PCR products of the CCS gene were labeled with BcaBest labeling Kit (TaKaRa) and 32 P dctp for use as probes. Hybridization was performed overnight at 68 C in the hybridization buffer solution (6 SSC, 5 Denhardt s, 0.5 % SDS). Membrane was washed with 2.0 and 0.5 SSC at 68 C. The radioactive isotope signals were detected using BASS2000II (Fuji film). DNA sequencing The PCR products were cloned into pgem-t Easy vector (Promega). The insert was labeled using sequitherm EXCEL II Long-Read DNA sequencing Kits-LC (Epicentre technologies), and its nucleotide sequence was determined by using DNA sequencer model 4000 L (Aloka). RT-PCR Total RNA was extracted from 100 mg of frozen mature fruit tissue (40 days after flowering) using RNeasy Protect Starter Kit (QIAGEN) and treated with DNase I. The cdna was synthesized with random primers using C. therm. Polymerase One-Step RT-PCR System Kit (Boehringer Mannheim). The synthesized cdna was used as template for the PCR reaction. The PCR conditions were the same as those for the genomic PCR described above. Results Segregation of fruit color The color of the mature fruit of the F 1 plants generated from the cross between the pepper accession (cv. msgty-1) with orange fruits and the pepper accession (cv. 277long)

3 Table 1. Primer sequences used for amplification of carotenoid genes from pepper Gene Primer sequences (5 3 ) Orange fruit color in Capsicum 35 5 start position of primer in sequence 1) Size of PCR product in cdna GenBank accession Reference GGPS GGPS-u ctttctccaagtgaaattgcaccac bp X8026 Kuntz et al GGPS-d tcgatcaccttcatttccatttgg 1182 PSY PSY-u atgtctgttgccggtgtatgggttg bp X6817 Romer et al PSY-d cctggatttcatgttcggtgagaaggc 1267 PDS PDS-u atgttggaattggtctttgcgcctg bp X6858 Hugueney et al PDS-d cacaatagctccactaggctaaac 1767 Crtl-b Crtl-b-u caccttgttgggaaaatatggatacg bp X86221 Hugueney et al Crtl-b-d gatcccagataagtcgaattcattc 1781 Crtz Crtz-u ttcattctcgtccacctc bp Y09722 Bouvier et al Crtz-d agagttggaaaaggaagt 916 CCS CCS-u ccttttccatctcctttactttccatt bp X77289 Bouvier et al CCS-d aaggctctctattgctagattgcccag 1494 CCS-24 acatggaaagtggtgaagg 177 CCS-534 acatggaaagtagtaaagg 334 CCS-1484 ggaaggtactactaggagattgtt ) Number indicates the nucleotide position starting from the first nucleotide of exon 1 for each gene. with red fruits was red (Fig. 2), indicating that the red color is dominant over the orange color. Among the 65 F 2 plants, 45 had red fruits and 20 had orange fruits. This segregation fitted to a 3 : 1 ratio with χ 2 = (P > 0.25). Carotenoid composition analysis Carotenoid composition in the mature fruits was analyzed by TLC. More than 12 TLC spots were detected in the red fruits, while only five in the orange fruits (Fig. 3). The segregation of the TLC pattern in 65 F 2 plants was completely consistent with the phenotypes of fruit color, orange or red. According to the spots of standard β-carotene and capsanthin, β-carotene (Rf = 0.92) was present in both orange and red fruits of pepper, whereas capsanthin (Rf = 0.14) was present only in the red fruits. Although other spots that appeared on the plate could not be identified, it is considered that the red pigments detected only in red pepper fruits might be derivations of capsanthin or capsorubin. PCR polymorphism and CAPS analysis PCR amplification was performed using the total DNA of two parents with primers for the GGPS, PSY, PDS, Crtlb, Crtz and CCS genes. Except for CCS, no polymorphism of PCR products was detected between the two parents. A 1477-bp fragment of the CCS gene was obtained from the pepper plants with red fruits, but not from those with orange fruits. The presence or absence of the amplified fragment completely cosegregated with the red or orange fruit color, respectively, in the F 2 population (Fig. 4). This result suggested that in the pepper plants with orange fruits, nucleotide changes occurred in the CCS gene, such as deletion or nucleotide substitution at primer sites. When cleaved amplified polymorphic sequence (CAPS) analysis was performed, polymorphic restriction sites between the two parents were detected in the GGPS, PSY and PDS genes, digested with Eco52I, BlnI and HindIII, respectively (data not shown). These polymorphisms did not fit to the segregation with fruit color in the F 2 population. This result indicates that the nucleotide polymorphisms of the GGPS, PSY and PDS genes were not the main factors determining the red and orange color in mature pepper fruits in this segregation population. PCR analysis of CCS gene In order to determine the position of the nucleotide change in the CCS gene of the pepper plants with orange fruits, we designed primers, CCS-24 and CCS-1484, which allowed the amplification of the part of the promoter region and downstream region of the CCS gene (Fig. 5). When using the primers CCS-24 and CCS-d, a 1670-bp amplified product was detected only in the plants with red fruits, but not in those with orange fruits (Fig. 6A). On the other hand, a 211-bp amplified fragment was found in the plants with both orange and red fruits, when using the primers CCS and CCS-d (Fig. 6B). Consequently, it is concluded that the two upstream primers (CCS-u and CCS-24) did not function in the pepper plants with orange fruits, indicating that the CCS gene in these plants underwent a drastic nucleotide change in the upstream region. Based on these results, we concluded that a deletion should probably be the cause of the PCR polymorphism in the CCS gene. Sequence analysis Nucleotide sequence analysis revealed that the 211-bp

4 36 Lang, Yanagawa, Sasanuma and Sasakuma Fig. 2. Mature fruits of pepper used in this study. Fig. 3. TLC profile of carotenoids in mature pepper fruits. B and C indicate standard substances, β-carotene and capsanthin, respectively. Rf value of B and C is shown on the right side. Fig. 4. PCR polymorphism of CCS gene in F 2 segregation population. P 1 : msgty-1, P 2 : 277long, R and O: F 2 plants with red and orange fruits, respectively, M4: size marker φx174 digested with HaeIII. amplified products in the downstream region of the CCS gene did not show any difference between the pepper plants with orange and red fruits. In addition, they were identical with the sequence of the CCS gene of pepper published in GenBank. Thus, the downstream region of the CCS gene was conserved in the plants with orange fruits, despite the drastic change in the upstream region. Southern hybridization analysis Southern hybridization was performed to confirm the deletion of the CCS gene in the pepper plants with orange fruits. Two PCR products using primers CCS-24 and CCS- 534 for the upstream region, and CCS-1484 and CCS-d for the downstream region were used as probes (Fig. 7). Hybridization patterns of the CCS gene revealed a single band in several restriction enzymes. Fig. 7A shows that the upstream region of the CCS gene was absent in the pepper plants with orange fruits. On the other hand, as shown in Fig. 7B, the 211-bp of the downstream region of the CCS gene was present in the pepper plants with both red and orange fruits. These results strongly demonstrate that the upstream region of the CCS gene was deleted in the pepper plants with orange fruits, whereas a part of the downstream region of the gene was still conserved.

5 Orange fruit color in Capsicum 37 patterns of genomic PCR and RT-PCR indicated that RNA for RT-PCR was not contaminated by genomic DNA, and that the predicted introns were precisely cleaved during the processing. These results provide further evidence that the orange color of the pepper fruits was caused by the lack of function of the CCS gene probably due to a deletion. Fig. 5. Structure of CCS gene and position of PCR primers. The thick line denotes the coding region of the CCS gene. Arrows with a horizontal single line represent the expected PCR products. Arrows with a double line indicate the position and orientation of the primers. Vertical arrows indicate the restriction sites of the EcoRI, XbaI and HindIII enzymes. Fig. 6. PCR analysis of the 3 and 5 ends of the CCS gene. Primers, CCS-24+ CCS-d and CCS CCS-d were used in (A) and (B), respectively. P 1 : msgty-1, P 2 : 277long, R and O: F 2 plants with red and orange fruits, respectively. M1: size marker λ DNA digested with HindIII, M4: size marker φx174 digested with HaeIII. Discussion In the present study, genetic segregation of three traits was examined, namely, fruit color (red vs. orange), carotenoid composition in mature fruits (12 spots vs. 5 spots by TLC) and PCR products in the CCS gene (presence vs. absence). These three factors completely cosegregated in the F 2 population with a segregation ratio of 3 : 1 (χ 2 = ), suggesting that the CCS gene is a candidate for the gene determining the orange and red color of pepper fruit. The Southern hybridization and PCR analysis with multiple primer combinations indicated that the CCS gene in the pepper plants with orange fruits showed a deletion in its upstream region. In the pepper plants with orange fruits, the part of the genomic sequence of the downstream region in the CCS gene was conserved, but no transcript of the CCS gene was detected by RT-PCR in the mature fruits. An important carotenoid compound in the red pepper fruits was absent in the orange pepper fruits based on the TLC pattern. Profiles of Southern hybridization in our present study and in several previous studies (Lefebvre et al. 1998, Popovsky and Paran 2000) suggested that CCS is encoded by a single copy gene in C. annuum. Linkage analysis performed by Thorup et al. (2000), Kang et al. (2001) and the present study indicated that no other genes related to carotenoid biosynthesis were closely linked to the CCS gene. These facts indicate that the CCS gene controls the orange and red fruit color of pepper by changing the carotenoid composition in our segregation population, suggesting that the orange color RT-PCR To investigate the expression of the CCS gene, reverse transcription PCR (RT-PCR) analysis was carried out with RNA extracted from mature fruits (DAF40). When the primers CCS-1484 and CCS-d were used, amplified products were obtained from the red fruits, but not from the orange fruits (Fig. 8A). The transcription of the GGPS, PSY, PDS, Crtl-b and Crtz genes was also investigated for RT-PCR analysis, indicating that all the genes were expressed in both P 1 and P 2 lines (Fig. 8A). To confirm the remove of genomic DNA from the sample, genomic PCR was also performed using the same primers as those for RT-PCR for each gene (Fig. 8B). The differences between the amplified fragment Fig. 7. Southern hybridization analysis of the CCS gene. Total DNA of P 1 (msgty-1), P 2 (277long) and F 1 was digested with XbaI. The probes are PCR products with primers (A) CCS-24 and CCS-534, and (B) CCS-1484 and CCS-d.

6 38 Lang, Yanagawa, Sasanuma and Sasakuma Fig. 8. RT-PCR (A) and Genomic PCR (B) analyses for the genes involved in the carotenoid biosynthesis. The primers used in RT-PCR and genomic PCR were the same for each gene, as shown in Table 1. Primers CCS-1484 and CCS-d were used in CCS gene analysis (M1: size marker λ DNA digested with HindIII, M4: size marker φx174 digested with HaeIII). is caused by the lack of expression of the CCS gene, probably due to a deletion of the upstream region of the gene. In the present study, CAPS analysis revealed a polymorphism in the PSY gene, which was considered by Huh et al. (2001) to be a candidate gene determining the orange color of pepper fruits. This polymorphism, however, was not consistent with the segregation of the pepper fruit color in the F 2 population in our study. RT-PCR products of the PSY gene were detected in the pepper plants with both orange and red fruits. Thus, it was concluded that the PSY gene is not the main factor determining the red or orange color of pepper fruits in our segregation population. Regarding the relationship between the orange fruit color of pepper and y, c1 and c2 loci, in previous studies, it was considered that several genotypes, namely, yc1 + C2 +, yc1c2 + and Y + C1 + c2 (according to the traditional nomenclature in Capsicum, large letters with + have been used for dominant and wild alleles, and small letters for the recessive ones), possibly determined the orange fruit color of pepper (Kormos and Kormos 1960, Hurtado-Hernandez and Smith 1985, Thorup et al. 2000). The report of Huh et al. (2001) revealed that the c2 locus determined the segregation of the pepper plants with orange and red fruits. In their study, the polymorphism of the PSY gene, a candidate for the c2 locus, cosegregated with the orange and red fruit color. They showed that mutation in the PSY gene led to a drastic reduction in the quantity of capsanthin in pepper plants with orange fruits since the mutation reduced the substrates of CCS synthesized in the upper step of the biosynthesis pathway of carotenoids. The pepper plants with orange fruits, in their report, should have a genotype, Y + C1 + c2. In contrast, in our study, the genotype of the line with orange fruits (cv. msgty-1) is considered to be yc1 + C2 + or yc1c2 +, because the CCS gene, a candidate for the y locus, determined the orange and red fruit color in our segregation population. Thus, it is concluded that there are at least two different genetic sources, namely, yc2 + and Y + c2, in the germplasm of pepper plants with orange fruits. CCS is an enzyme that catalyzes the synthesis of capsanthin and capsorubin from antheraxanthin and violaxanthin, respectively. In previous studies (Lefebvre et al. 1998, Popovsky and Paran 2000), it was reported that the CCS gene controlled the segregation of yellow and red color of pepper fruits. In the present study, we demonstrated that the CCS gene determined the orange and red color of pepper fruits in our segregation population, and that the lack of expression of the CCS gene due to a deletion probably gave rise to the orange color of pepper fruit. We assume that differences in the genotype of the other two loci, c1 and c2, are present between these pepper plants with orange and yellow fruits. To elucidate the detailed genetic mechanism determining the yellow and orange coloring, further analysis of the other genes involved in the carotenoid biosynthesis pathway of pepper is necessary. From the results of previous reports and our present study, we conclude that the relationship of the CCS gene with the pepper fruit color is as follows; first, normal expression of CCS gene and substrates of CCS are necessary for producing the red color of pepper fruits; second, lack of expression of the CCS gene or deficiency in the substrates of CCS leads to a color different from the red one in pepper fruits. The results of this study indicated that the CCS gene catalyzing the capsanthin-capsorubin synthesis is responsible for the fruit color of pepper. The PCR marker of the CCS gene identified in the present study can be used for markerassisted selection of plants with orange fruits. Since the color of the mature fruit of pepper is determined by the interaction of several genes, combination of molecular markers of carotenoid biosynthesis genes could be utilized for selection breeding of pepper fruit color in various genetic backgrounds. Literature Cited Bouvier, F., P. Hugueney, A. d Harlingue, M. Kuntz and B. Camara (1994) Xanthophyll biosynthesis in chromoplasts; isolation and

7 Orange fruit color in Capsicum 39 molecular cloning of an enzyme catalyzing the conversion of 5,6-epoxycarotenoid into ketocarotenoid. Plant J. 6: Bouvier, F., Y. Keller, A. d Harlingue and B. Camara (1998) Xanthophyll biosynthesis; molecular and functional characterization of carotenoid hydroxylases from pepper fruits (Capsicum annuum L.). Biochim. Biophys. Acta 1391: Buchanan, B.B., W. Gruissem and R.L. Jones (2000) Biochemistry & Molecular Biology of Plants. American Society of Plant Physiologists, Maryland. 40 p. Hayashi, K. (1980) Plant pigments An introduction to research and experiments. Yokendo, Ltd. Tokyo. p Hirschberg, J., M. Cohen, M. Harker, T. Lotan, V. Mann and I. Pecker (1997) Molecular genetics of the carotenoid biosynthesis pathway in plants and algae. Pure & Appl. Chem. 69: Hugueney, P., S. Romer, M. Kuntz and B. Camara (1992) Characterization and molecular cloning of a flavoprotein catalyzing the synthesis of phytofluene and zeta-carotene in Capsicum chromoplasts. Eur. J. Biochem. 209: Hugueney, P., A. Badillo, H.C. Chen, A. Klein, J. Hirschberg, B. Camara and M. Kuntz (1995) Metabolism of cyclic carotenoids; a model for the alteration of this biosynthetic pathway in Capsicum annuum chromoplasts. Plant J. 8: Hugueney, P., F. Bouvier, A. Badillo, J. Quennemet, A. d Harlingue and B. Camara (1996) Developmental and stress regulation of gene expression for plastid and cytosolic isoprenoid pathways in pepper fruits. Plant Physiol. 111: Huh, J.H., B.C. Kang, S.H. Nahm, S. Kim, K.S. Ha, M.H. Lee and B.D. Kim (2001) A candidate gene approach identified phytoene synthase as the locus for mature fruit color in red pepper (Capsicum spp.). Theor. Appl. Genet. 102: Hurtado-Hernandez, H. and P.G. Smith (1985) Inheritance of mature fruit color in Capsicum annuum L. J. Hered. 76: Kang, B.C., S.H. Nahm, J.H. Huh, H.S. Yoo, J.W. Yu, M.H. Lee and B.D. Kim (2001) An interspecific (Capsicum annuum C. chinese) F 2 linkage map in pepper using RFLP and AFLP markers. Theor. Appl. Genet. 102: Kormos, J. and K. Kormos (1960) Die Genetischen Typen der Carotinoid-Systeme der Parpikafrucht. Acta Bot. (Acad. Sci. Hung.) 6: Kuntz, M., S. Romer, C. Suire, P. Hugueney, J.H. Weil and R. Schantz (1995) Identification of a cdna for the plastid-located geranylgeranyl pyrophosphate synthase from Capsicum annuum correlative increase in enzyme activity and transcript level during fruit ripening. Plant J. 2: Lefebvre, V., M. Kuntz, B. Camara and A. Palloix (1998) The capsanthin-capsorubin synthase gene; a candidate gene for the y locus controlling the red fruit colour in pepper. Plant Mol. Biol. 36: Oliver, J. and A. Palou (2000) Chromatographic determination of carotenoids in foods. J. Chromatogr. 881: Popovsky, S. and I. Paran (2000) Molecular genetics of the y locus in pepper; its relation to capsanthin-capsorubin synthase and to fruit color. Theor. Appl. Genet. 101: Romer, S., P. Hugueney, F. Bouvier, B. Camara and M. Kuntz (1993) Expression of the genes encoding the early carotenoid biosynthetic enzymes in Capsicum annuum. Biochem. Biophys. Res. Commun. 196: Suzuki, I., Y. Saito and M. Toyoda (1990) Hakusou Chromatography no Jissai. Hirokawa Co. Tokyo. p Thorup, T.A., B. Tanyolac, K.D. Livingstone, S. Popovsky, I. Paran and M. Jahn (2000) Candidate gene analysis of organ pigmentation loci in the Solanaceae. Proc. Natl. Acad. Sci. USA 97: