B.D. Singh. A.K. Singh. Marker-Assisted Plant. Breeding: Principles. and Practices. ^ Springer

Size: px
Start display at page:

Download "B.D. Singh. A.K. Singh. Marker-Assisted Plant. Breeding: Principles. and Practices. ^ Springer"

Transcription

1 BD Singh AK Singh Marker-Assisted Plant Breeding: Principles and Practices ^ Springer

2 Contents Part I General 1 Introduction to Marker-Assisted Crop Improvement 3 11 Introduction 3 12 Domestication: The Evolution of Crop Plants 3 13 Plant Breeding Major Developments in Plant Breeding The Genotype and Phenotype Genetic Variation: Qualitative and Quantitative Inheritance Contributions: Pure Line Varieties Contributions: Hybrid Varieties Contributions: Clones Limitations of Phenotype-Based Plant Breeding 8 14 The Growing Food Needs 9 15 The Transgenic Technology: Lukewarm Social Response Molecular Markers: Selection Made Easy and More Reliable Designer Crops Some Notable Achievements of Marker-Assisted Plant Breeding Future Prospects of Marker-Assisted Plant Breeding 14 Part II Genetic Markers 2 Hybridization-Based Markers Introduction Genetic Markers Visible/Morphological Markers Protein-Based Markers DNA Markers Concluding Remarks on Genetic Markers Random, Gene-Based, and Functional Markers Isolation and Purification of DNA from Plants 26 xv

3 xvi Contents 25 Restriction Fragment Length Polymorphism Restriction Enzymes Southern Hybridization Probes Polymorphisms Detected by RFLP Markers Genetic Aspects of RFLPs Advantages of RFLPs Limitations of RFLPs Conversion of RFLP Markers into PCR-Based Markers Diversity Array Technology Variable Number of Tandem Repeats Single Feature Polymorphisms Restriction-Site-Associated DNA Markers Appendices Appendix 21: Isolation and Purification of DNA from Plants 42 Appendix 22: Genomic and cdna Libraries 44 Appendix 23: Microarrays 45 3 Polymerase Chain Reaction-Based Markers Introduction Oligonucleotides 33 Polymerase Chain Reaction Generalized Procedure for PCR Separation of PCR Amplification Products Multiplex PCR Applications of PCR Advantages and Limitations of PCR PCR-Based Markers Randomly Amplified Polymorphic DNAs DNA Amplification Fingerprinting Arbitrary-Primed PCR Sequence-Characterized Amplified Regions Amplified Fragment Length Polymorphisms The Procedure of AFLP Features of AFLP Modifications of the AFLP Technique Conversion of AFLP Markers Sequence-Tagged Sites Microsatellites or Simple Sequence Repeats Simple Sequence Repeat Markers Discovery of SSR Markers Increasing the Throughput of SSR Markers Merits of SSR Markers Limitations of SSR Marker System Inter-Simple Sequence Repeats Modifications of ISSR Merits and Limitations of ISSR Markers 64

4 Contents xvii 314 Cleaved Amplified Polymorphic Sequences Single-Strand Conformation Profile/Polymorphism 316 Denaturing/Temperature Gradient Gel Electrophoresis Sequence-Related Amplification Polymorphism Target Region Amplification Polymorphism Transposable Element-Based Markers Conserved Orthologous Set of Markers Start Codon-Targeted Polymorphism CAAT Box-Derived Polymorphism Conserved DNA-Derived Polymorphism Conserved Region Amplification Polymorphism Intron-Targeting Polymorphism RNA-Based Molecular Markers 74 Appendices 74 Appendix 31: The Number of RAPD Bands Theoretically Expected from a DNA Sample 74 Appendix 32: Polymerase Chain Reaction and Randomly Amplified Polymorphic DNAs 75 4 Sequence-Based Markers Introduction DNA Sequencing First-Generation DNA Sequencing Methods Next-Generation DNA Sequencing Methods 423 The Third-Generation DNA Sequencing 79 Methods Comparison Between NGS and TGS Sequencers RNA Sequencing RNA-Seq Single-Molecule Direct RNA Sequencing Single-Nucleotide Polymorphisms Types of SNPs Methods for Discovery of SNPs Amplicon Sequencing SNP Mining Transcriptome Sequencing Whole-Genome Sequencing Reduced Representation Approaches Sequence Capture Validation of Discovered SNPs Methods for SNP Genotyping Allele-Specinc PCR '-Nuclease Assay (TaqMan Assay) Molecular Beacons Microarray-Based SNP Genotyping Bead-Based Techniques Primer Extension 108

5 xviii Contents 467 Pyrosequencing Oligonucleotide Ligation Assay Dynamic Allele-Specific Hybridization Ill 4610 Denaturing High-Performance Liquid Chromatography Ill 4611 InDels as Molecular Markers Epigenetic Markers Use of Genomics, Transcriptomics, Proteomics, and Metabolomics in Marker Development Polymorphic Information Content of Marker Loci Marker System Selection 118 Part III Linkage Maps 5 Mapping Populations Introduction Mapping Populations Selection of Parents for Developing a Mapping Population F2 Population F2-Derived F3 Population Backcross Population Doubled Haploids Recombinant Inbred Lines Immortalized F2 Population Near-Isogenic Lines Chromosomal Segment Substitution Lines Backcross Inbred Lines Advanced Intercross Lines Recurrent Selection Backcross Population Interconnected Mapping Populations Multiparent Advanced Generation Intercross Populations Nested Association Mapping Population Mapping Populations for Cross-Pollinated Species Linkage Mapping in Polyploid Species Chromosome-Specific Genetic Stocks Natural Populations and Germplasm/Breeding Lines Segregation Ratios in Mapping Populations Characterization of Mapping Populations Problems in Mapping Studies Size of Mapping Population Choice of Mapping Population Linkage Mapping of Molecular Markers and Oligogenes Introduction Genetic Maps Linkage Maps Cytogenetic Maps Physical Maps 152

6 63 Estimation of Recombination Rates Genetic Distance The Haldane Distance The Kosambi Distance Variation in Genetic Distance Relationship Between Genetic and Physical Distances General Procedure for Linkage Mapping of Molecular Markers and Oligogenes Mapping of the Loci Present in a Chromosome Strategies for Mapping of Oligogenes Use of Near-Isogenic Lines Bulked Segregant Analysis Mapping of Recessive Morphological Mutants by a Two-Step Procedure Bulked Segregant RNA-Seq The MutMap Technique LOD Score and LOD Score Threshold A Complete Linkage Map Integration or Merger of Linkage Maps Confirmation and Validation Comparative Mapping Fine Mapping (High-Resolution Mapping) Software for Mapping of Oligogenes/Molecular Markers MapMaker/Exp RI Plant Manager G-MENDEL MultiMap AntMap JoinMap MergeMap ActionMap TetraploidMap for Windows MultiPool Mutation Mapping Analysis Pipeline for Pooled RNA-Seq MapPop Next-Generation Mapping Selective Mapping and Selective Genotyping Pooled DNA Analysis Physical Mapping of Molecular Markers Sources of Errors in Linkage Mapping The Significance of Genetic Maps 182 Mapping of Quantitative Trait Loci Introduction Quantitative Trait Loci The General Procedure for QTL Mapping 186

7 xx Contents Marker and Quantitative Trait Data Structure Methods for QTL Detection and Mapping Single QTL Mapping Multiple QTL Mapping Some Remarks on QTL Mapping Bulked Segregant Analysis for QTL Mapping Multiple Trait QTL Mapping LOD Score and LOD Score Threshold QTL Confidence/Support Interval Confirmation and Validation of QTL Mapping Results QTL Fine Mapping Homozygous Lines Derived from Near-Isogenic Lines Intercross Recombinant Inbred Lines Recurrent Selection Backcross QTL Mapping Genetically Heterogeneous Stocks Multiparent Advanced Generation Intercross Population Reverse QTL Mapping Combination of QTL Mapping and Transcriptome Profiling QTL Meta-Analysis Inconsistent Estimates of QTL Effects Segregation of Different QTLs in Different Populations QTLx Genetic Background Interaction QTLx Environment Interaction The Beavis Effect QTL Detection Power and Precision of QTL Mapping 715 Factors Affecting Results from QTL Mapping Genetic Properties of QTLs Genetic Background Type and Size of Mapping Population Environmental Effects on QTL Expression Experimental Error Advantages of QTL Linkage Mapping Limitations of QTL Mapping Nature and Function of Polygenes Software for QTL Mapping MapMaker/QTL PLABQTL QTL Cartographer MapManager QT/QTX R/QTL R/QTLBIM QTL Express 214

8 Contents xxi 7198 FlexQTL INTERQTL MCQTL QGene Some Other Software Programs Association Mapping Introduction The General Procedure for Association Mapping Phenotyping Genome-Wide and Candidate Gene Approaches for Association Mapping Populations Used for Association Mapping in Plants Population-Based Association Panels Family-Based Association Panels: NAM Population Family-Based Association Panels: MAGIC Population Linkage Disequilibrium for Biallelic Loci Measures of Linkage Disequilibrium Two Biallelic Loci Two Loci with Multiple Alleles Multiple Locus Methods Graphic Representation of LD Useful LD The Extent of LD in Plant Species Uses of LD in Plant Molecular Biology Experimental Designs and Models for Association Mapping Case and Control Approach Family-Based Designs Structured Association Model Mixed Linear Models Joint Linkage-Association Mapping Multilocus Mixed Model Multitrait Mixed Model Significance Tests for Marker-Trait Associations Controlling "False Discovery" Rate Relevance of Marker Systems in LD Estimation Factors Affecting LD and Association Mapping Mating Pattern in the Population Selection Population Structure Admixture Genomic Region Kinship Genetic Drift and Bottleneck 248

9 xxii Contents 8168 Gene Conversion Ascertainment Bias Marker Mutation Rate Errors in Genotyping Conclusions About LD Patterns in Plant Species LD Maps Mapping of Expression Quantitative Trait Loci Power of Association Mapping Confirmation of Marker-Trait Associations Through Replication Studies The tagsnp Strategy of SNP Genotyping Software for LD Studies Conclusions from Association Mapping Studies Current Issues in Association Mapping Future Perspectives Merits of Association Mapping Limitations of Association Mapping 255 Part IV Applications 9 Marker-Assisted Selection Introduction Marker-Assisted Characterization of Germplasm and Genetic Purity Marker-Assisted Backcrossing Foreground Selection Background Selection Recombinant Selection A Four-Step Comprehensive Selection Strategy A Theory for Background Selection During MABC MABC for Transfer of Oligogenic Traits MABC for Transfer of Quantitative Trait Loci MABC for Gene Pyramiding Strategy for Gene Pyramiding Pyramiding of Oligogenes Pyramiding of QTLs with Oligogenes Governing the Same Trait Transgene Pyramiding Multitrait Introgression Combined Marker-Assisted Selection Marker-Assisted Recurrent Selection MARS in Cross-Pollinated Crops F2 Enrichment and MARS in Self-Pollinated Crops 279

10 911 Innovative Breeding Schemes for Effective Use of MAS Inbred Enhancement and QTL Mapping Advanced Backcross QTL Analysis Single Large-Scale MAS Pedigree MAS Single Backcross-Doubled Haploid Scheme Breeding by Design Mapping as You Go Marker-Evaluated Selection for Adaptation and Agronomic Performance Integration of MAS in Breeding Programs Advantages of MAS Limitations of MAS Present Constraints and Future Directions Achievements Genomic Selection Introduction Genome-Wide Selection A Generalized Procedure for Genomic Selection Training Population Genetic Composition Population Size Marker Density Computation of Genomic Estimated Breeding Values Stepwise Regression Ridge Regression Bayesian Approach Semi-parametric Regression Methods Machine Learning Methods Factors Affecting the Accuracy of GEBV Estimates 1061 The Method of Estimation of Marker Effects The Polygenic Effect Term Based on Kinship The Method of Phenotypic Evaluation of Training Population The Marker Type and Density Trait Heritability and the Number of QTLs Affecting the Trait The Breeding Population Effects of Genomic Selection on Genetic Diversity Integration of Genomic Selection in Breeding Programs 305

11 xxiv Contents 109 Effectiveness of Genomic Selection Advantages of Genomic Selection Limitations of Genomic Selection Future Directions Phylogenetic Relationships and Genetic Diversity Introduction Estimation of Genetic Distance/Similarity Estimation of Genetic Distance from Morphological Trait Data Estimation of Genetic Distance from Molecular Marker Data Estimation of Genetic Distance from Populations Choice of the Genetic Distance Measure 113 Genetic Diversity Analysis: Phylogenetic 315 Relationships Cluster Analysis Principal Component Analysis Principal Coordinate Analysis Multidimensional Scaling Determination of the Optimal Number of Clusters Choice of Clustering Method Use of Diverse Datasets Resampling Techniques Genetic Diversity Analysis: Conservation of Genetic Resources Germplasm Conservation Applications of Molecular Markers in Germplasm Conservation Conservation of Wild Species Genetic Diversity Analysis: Prediction of Heterotic Pools and Heterotic Combinations Genetic Basis of Heterosis Molecular Basis of Heterosis Identification/Prediction of Heterotic Pools and Heterotic Cross Combinations Molecular Markers in Resolution of the Genetic Basis of Heterosis Molecular Markers for Identification/Prediction of Heterotic Pools and Heterotic Cross Combinations Fingerprinting and Gene Cloning Introduction DNA Fingerprinting 341

12 Contents xxv 123 Characterization of Lines and Hybrids for Intellectual Property Rights Protection Plant Breeder's Rights Description of Plant Varieties Limitations of Molecular Markers Assessment of Genetic Purity of Lines and Hybrids In Silico Gene Prediction Chromosome Walking Chromosome Jumping Positional Gene Cloning The Three Steps of Positional Cloning Positional Cloning of Some Plant Genes Some Useful Tips for Positional Gene Cloning Problems in Positional Cloning Chromosome Landing Positional Cloning of Quantitative Trait Loci cdna Sequencing in Positional Cloning Achievements High-Throughput SNP Genotyping Introduction High-Throughput Genotyping of Known SNP Loci The Invader Technology Pyrosequencing KASP Genotyping Assay TaqMan OpenArray Genotyping System 1325 SNP Analysis by MALDI-TOF MS (The Homogeneous MassEXTEND Assay) Nanofluidic Dynamic Array-Based Assays 1327 The Array Tape Technology The Illumina GoldenGate SNP Genotyping Platform Molecular Inversion Probe Technology Whole-Genome-Based Microarray Platforms High-Throughput SNP Discovery and Genotyping Reduced Representation Sequencing Reduced Representation Libraries Complexity Reduction of Polymorphic Sequences Restriction Site-Associated DNA Sequencing Low-Coverage Genotyping Genotyping by Sequencing Multiplexed Shotgun Genotyping Applications of NGS-Based Marker Discovery and Genotyping Methods 396

13 xxvi Contents 138 A Comparison of NGS and Other SNP Genotyping Approaches Reduced Representation Versus Whole-Genome Sequencing SNP Discovery in Polyploids Bioinformatics Tools for Marker Discovery from NGS Sequence Data PoPoolation RADtools Stacks TASSEL SAMtools/BCFtools Future Directions Bioinformatics Tools and Databases for Genomics Research Introduction Representation of Nucleotide and Amino Acid Sequences Bioinformatics Tools AutoSNP SNP2CAPS TASSEL STRUCTURE Microarray Software A C Elegans Database (AceDB) MAPMAN GenScan ClustalW Bioinformatics Databases GenBank Phytozome European Molecular Biology Laboratory Nucleotide Sequence Database Swiss-Prot UniProt Knowledgebase (UniProtKB) Gramene GrainGenes MaizeGDB RiceGeneThresher Microarray Databases (ArrayExpress and Gene Expression Omnibus) HarvEST Sources of Multiple Databases and Tools National Center for Biotechnology Information Kyoto Encyclopedia of Genes and Genomes 416

14 1453 Molecular Biology Database Collection Architecture for Metabolomics (ArMet) Database Search and Analysis Tools Genamics SoftwareSeek Sequence Manipulation Suite PHYL1P 428 Phenomics Introduction Phenomics The Imaging Technology Advantages of Image-Based Phenotyping Reflectance Imaging Visual Imaging Near Infrared Imaging Infrared Imaging Fluorescence Imaging Chlorophyll Fluorescence Green Fluorescence Protein Magnetic Resonance Imaging Multi-sensor Monitoring Approaches Field-Based Phenomics Morphological and Growth Analyses Dynamic Measurement of Leaf Area Plant Biomass Estimation Basic Plant Growth Analysis Assessment of Structure/Development Measurement of Senescence/Necrosis Analysis of Root Systems Seed and Fruit Phenotyping Laser Scanning: 3-D Plant Morphology Analyses of Chemical and Physiological Parameters Estimation of Relative Chlorophyll Content Monitoring Photosynthesis Assessment of Water Use Estimation of Soil Water Content Analysis of Chemical Composition Biotic Stress Detection Monitoring Drought Stress Stomatal Conductance Leaf/Canopy Temperature Visible Imaging IR Thermography Chlorophyll Fluorescence Estimation of Tissue Water Content 454

15 xxviii Contents 1515 Molecular Biomarkers Image Analysis Image Analysis Software ImageJ HTPheno Rosette Tracker MartrackLeaf HPGA (High-throughput Plant Growth Analysis) Root System Analyzer SmartRoot RootReader2D RootReader3D Applications of Phenomics Achievements Future Directions 460 Glossary 463 References 485 Author Index 501 Subject Index 507

Marker types. Potato Association of America Frederiction August 9, Allen Van Deynze

Marker types. Potato Association of America Frederiction August 9, Allen Van Deynze Marker types Potato Association of America Frederiction August 9, 2009 Allen Van Deynze Use of DNA Markers in Breeding Germplasm Analysis Fingerprinting of germplasm Arrangement of diversity (clustering,

More information

SolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze

SolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze SolCAP Solanaceae Coordinated Agricultural Project Supported by the National Research Initiative Plant Genome Program of USDA CSREES for the Improvement of Potato and Tomato Executive Commitee : David

More information

Authors: Vivek Sharma and Ram Kunwar

Authors: Vivek Sharma and Ram Kunwar Molecular markers types and applications A genetic marker is a gene or known DNA sequence on a chromosome that can be used to identify individuals or species. Why we need Molecular Markers There will be

More information

I.1 The Principle: Identification and Application of Molecular Markers

I.1 The Principle: Identification and Application of Molecular Markers I.1 The Principle: Identification and Application of Molecular Markers P. Langridge and K. Chalmers 1 1 Introduction Plant breeding is based around the identification and utilisation of genetic variation.

More information

Mapping and Mapping Populations

Mapping and Mapping Populations Mapping and Mapping Populations Types of mapping populations F 2 o Two F 1 individuals are intermated Backcross o Cross of a recurrent parent to a F 1 Recombinant Inbred Lines (RILs; F 2 -derived lines)

More information

Module 1 Principles of plant breeding

Module 1 Principles of plant breeding Covered topics, Distance Learning course Plant Breeding M1-M5 V2.0 Dr. Jan-Kees Goud, Wageningen University & Research The five main modules consist of the following content: Module 1 Principles of plant

More information

Lecture 12. Genomics. Mapping. Definition Species sequencing ESTs. Why? Types of mapping Markers p & Types

Lecture 12. Genomics. Mapping. Definition Species sequencing ESTs. Why? Types of mapping Markers p & Types Lecture 12 Reading Lecture 12: p. 335-338, 346-353 Lecture 13: p. 358-371 Genomics Definition Species sequencing ESTs Mapping Why? Types of mapping Markers p.335-338 & 346-353 Types 222 omics Interpreting

More information

Using molecular marker technology in studies on plant genetic diversity Final considerations

Using molecular marker technology in studies on plant genetic diversity Final considerations Using molecular marker technology in studies on plant genetic diversity Final considerations Copyright: IPGRI and Cornell University, 2003 Final considerations 1 Contents! When choosing a technique...!

More information

Gene Tagging with Random Amplified Polymorphic DNA (RAPD) Markers for Molecular Breeding in Plants

Gene Tagging with Random Amplified Polymorphic DNA (RAPD) Markers for Molecular Breeding in Plants Critical Reviews in Plant Sciences, 20(3):251 275 (2001) Gene Tagging with Random Amplified Polymorphic DNA (RAPD) Markers for Molecular Breeding in Plants S. A. Ranade, * Nuzhat Farooqui, Esha Bhattacharya,

More information

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology. G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic

More information

GREG GIBSON SPENCER V. MUSE

GREG GIBSON SPENCER V. MUSE A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.

More information

Molecular markers in plant breeding

Molecular markers in plant breeding Molecular markers in plant breeding Jumbo MacDonald et al., MAIZE BREEDERS COURSE Palace Hotel Arusha, Tanzania 4 Sep to 16 Sep 2016 Molecular Markers QTL Mapping Association mapping GWAS Genomic Selection

More information

Genetics and Biotechnology. Section 1. Applied Genetics

Genetics and Biotechnology. Section 1. Applied Genetics Section 1 Applied Genetics Selective Breeding! The process by which desired traits of certain plants and animals are selected and passed on to their future generations is called selective breeding. Section

More information

PCB Fa Falll l2012

PCB Fa Falll l2012 PCB 5065 Fall 2012 Molecular Markers Bassi and Monet (2008) Morphological Markers Cai et al. (2010) JoVE Cytogenetic Markers Boskovic and Tobutt, 1998 Isozyme Markers What Makes a Good DNA Marker? High

More information

Biotechnology Chapter 20

Biotechnology Chapter 20 Biotechnology Chapter 20 DNA Cloning DNA Cloning AKA Plasmid-based transformation or molecular cloning First off-let s sum up what happens. A plasmid is taken from a bacteria A gene is inserted into the

More information

Genetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection

Genetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection Genetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection Awais Khan Adaptation and Abiotic Stress Genetics, Potato and sweetpotato International Potato

More information

Genomics assisted Genetic enhancement Applications and potential in tree improvement

Genomics assisted Genetic enhancement Applications and potential in tree improvement Genomics assisted Genetic enhancement Applications and potential in tree improvement Sheshshayee MS, Sumanthkumar K and Raju BR Dept. of Crop Physiology and Genetics and Plant breeding UAS, GKVK, Bangalore

More information

POPULATION GENETICS studies the genetic. It includes the study of forces that induce evolution (the

POPULATION GENETICS studies the genetic. It includes the study of forces that induce evolution (the POPULATION GENETICS POPULATION GENETICS studies the genetic composition of populations and how it changes with time. It includes the study of forces that induce evolution (the change of the genetic constitution)

More information

Identifying Genes Underlying QTLs

Identifying Genes Underlying QTLs Identifying Genes Underlying QTLs Reading: Frary, A. et al. 2000. fw2.2: A quantitative trait locus key to the evolution of tomato fruit size. Science 289:85-87. Paran, I. and D. Zamir. 2003. Quantitative

More information

GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.

GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS. !! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,

More information

Map-Based Cloning of Qualitative Plant Genes

Map-Based Cloning of Qualitative Plant Genes Map-Based Cloning of Qualitative Plant Genes Map-based cloning using the genetic relationship between a gene and a marker as the basis for beginning a search for a gene Chromosome walking moving toward

More information

Course Syllabus for FISH/CMBL 7660 Fall 2008

Course Syllabus for FISH/CMBL 7660 Fall 2008 Course Syllabus for FISH/CMBL 7660 Fall 2008 Course title: Molecular Genetics and Biotechnology Course number: FISH 7660/CMBL7660 Instructor: Dr. John Liu Room: 303 Swingle Hall Lecture: 8:00-9:15 a.m.

More information

INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS GENEVA

INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS GENEVA E BMT Guidelines (proj.4) ORIGINAL: English DATE: December 21, 2005 INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS GENEVA GUIDELINES FOR DNA-PROFILING: MOLECULAR MARKER SELECTION AND

More information

Comparative study of EST-SSR, SSR, RAPD, and ISSR and their transferability analysis in pea, chickpea and mungbean

Comparative study of EST-SSR, SSR, RAPD, and ISSR and their transferability analysis in pea, chickpea and mungbean EUROPEAN ACADEMIC RESEARCH Vol. IV, Issue 2/ May 2016 ISSN 2286-4822 www.euacademic.org Impact Factor: 3.4546 (UIF) DRJI Value: 5.9 (B+) Comparative study of EST-SSR, SSR, RAPD, and ISSR and their transferability

More information

Molecular and Applied Genetics

Molecular and Applied Genetics Molecular and Applied Genetics Ian King, Iain Donnison, Helen Ougham, Julie King and Sid Thomas Developing links between rice and the grasses 6 Gene isolation 7 Informatics 8 Statistics and multivariate

More information

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY. !! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which

More information

Lecture 8: Sequencing and SNP. Sept 15, 2006

Lecture 8: Sequencing and SNP. Sept 15, 2006 Lecture 8: Sequencing and SNP Sept 15, 2006 Announcements Random questioning during literature discussion sessions starts next week for real! Schedule changes Moved QTL lecture up Removed landscape genetics

More information

COURSE OUTLINE Biology 103 Molecular Biology and Genetics

COURSE OUTLINE Biology 103 Molecular Biology and Genetics Degree Applicable I. Catalog Statement COURSE OUTLINE Biology 103 Molecular Biology and Genetics Glendale Community College November 2014 Biology 103 is an extension of the study of molecular biology,

More information

Chapter 15 Gene Technologies and Human Applications

Chapter 15 Gene Technologies and Human Applications Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect

More information

Chapter 20 DNA Technology & Genomics. If we can, should we?

Chapter 20 DNA Technology & Genomics. If we can, should we? Chapter 20 DNA Technology & Genomics If we can, should we? Biotechnology Genetic manipulation of organisms or their components to make useful products Humans have been doing this for 1,000s of years plant

More information

Plant breeding QTL (Quantitative Trait Loci)

Plant breeding QTL (Quantitative Trait Loci) Plant breeding Methods and use of classical plant breeding. Molecular marker technology, Marker assisted selection in plant breeding. QTL (Quantitative Trait Loci), Genetic analysis and characterization

More information

Gene Mapping in Natural Plant Populations Guilt by Association

Gene Mapping in Natural Plant Populations Guilt by Association Gene Mapping in Natural Plant Populations Guilt by Association Leif Skøt What is linkage disequilibrium? 12 Natural populations as a tool for gene mapping 13 Conclusion 15 POPULATIONS GUILT BY ASSOCIATION

More information

International Training Course on Maize Molecular Breeding April 5 16, 2010, CIMMYT, El Batan, México. ccmaize

International Training Course on Maize Molecular Breeding April 5 16, 2010, CIMMYT, El Batan, México. ccmaize International Training Course on Maize Molecular Breeding April 5 16, 2010, CIMMYT, El Batan, México Choice of Marker Systems and Genotyping Platforms Yunbi Xu International Maize and Wheat Improvement

More information

Introduction to some aspects of molecular genetics

Introduction to some aspects of molecular genetics Introduction to some aspects of molecular genetics Julius van der Werf (partly based on notes from Margaret Katz) University of New England, Armidale, Australia Genetic and Physical maps of the genome...

More information

BENG 183 Trey Ideker. Genotyping. To be covered in one 1.5 hr lecture

BENG 183 Trey Ideker. Genotyping. To be covered in one 1.5 hr lecture BENG 183 Trey Ideker Genotyping To be covered in one 1.5 hr lecture Genetic variation: Some basic definitions Allele Alternative form of a genetic locus inherited separately from each parent Polymorphism

More information

Applicazioni biotecnologiche

Applicazioni biotecnologiche Applicazioni biotecnologiche Analisi forense Sintesi di proteine ricombinanti Restriction Fragment Length Polymorphism (RFLP) Polymorphism (more fully genetic polymorphism) refers to the simultaneous occurrence

More information

MICROSATELLITE MARKER AND ITS UTILITY

MICROSATELLITE MARKER AND ITS UTILITY Your full article ( between 500 to 5000 words) - - Do check for grammatical errors or spelling mistakes MICROSATELLITE MARKER AND ITS UTILITY 1 Prasenjit, D., 2 Anirudha, S. K. and 3 Mallar, N.K. 1,2 M.Sc.(Agri.),

More information

Human genetic variation

Human genetic variation Human genetic variation CHEW Fook Tim Human Genetic Variation Variants contribute to rare and common diseases Variants can be used to trace human origins Human Genetic Variation What types of variants

More information

Research techniques in genetics. Medical genetics, 2017.

Research techniques in genetics. Medical genetics, 2017. Research techniques in genetics Medical genetics, 2017. Techniques in Genetics Cloning (genetic recombination or engineering ) Genome editing tools: - Production of Knock-out and transgenic mice - CRISPR

More information

Enzyme that uses RNA as a template to synthesize a complementary DNA

Enzyme that uses RNA as a template to synthesize a complementary DNA Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have

More information

Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis 1 Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

By the end of this lecture you should be able to explain: Some of the principles underlying the statistical analysis of QTLs

By the end of this lecture you should be able to explain: Some of the principles underlying the statistical analysis of QTLs (3) QTL and GWAS methods By the end of this lecture you should be able to explain: Some of the principles underlying the statistical analysis of QTLs Under what conditions particular methods are suitable

More information

Biology 105: Introduction to Genetics PRACTICE FINAL EXAM Part I: Definitions. Homology: Reverse transcriptase. Allostery: cdna library

Biology 105: Introduction to Genetics PRACTICE FINAL EXAM Part I: Definitions. Homology: Reverse transcriptase. Allostery: cdna library Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Reverse transcriptase Allostery: cdna library Transformation Part II Short Answer 1. Describe the reasons for

More information

GENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size.

GENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. Student Name: All questions are worth 5 pts. each. GENETICS EXAM 3 FALL 2004 1. a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. b) Name one of the materials (of the two

More information

Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis 1 Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

A brief introduction to Marker-Assisted Breeding. a BASF Plant Science Company

A brief introduction to Marker-Assisted Breeding. a BASF Plant Science Company A brief introduction to Marker-Assisted Breeding a BASF Plant Science Company Gene Expression DNA is stored in chromosomes within the nucleus of each cell RNA Cell Chromosome Gene Isoleucin Proline Valine

More information

INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS

INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS ORIGINAL: English DATE: October 21, 2010 INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS GENEVA E GUIDELINES FOR DNA-PROFILING: MOLECULAR MARKER SELECTION AND DATABASE CONSTRUCTION (

More information

Bioinformatics (Lec 19) Picture Copyright: the National Museum of Health

Bioinformatics (Lec 19) Picture Copyright: the National Museum of Health 3/29/05 1 Picture Copyright: AccessExcellence @ the National Museum of Health PCR 3/29/05 2 Schematic outline of a typical PCR cycle Target DNA Primers dntps DNA polymerase 3/29/05 3 Gel Electrophoresis

More information

Using mutants to clone genes

Using mutants to clone genes Using mutants to clone genes Objectives: 1. What is positional cloning? 2. What is insertional tagging? 3. How can one confirm that the gene cloned is the same one that is mutated to give the phenotype

More information

Genomics-based approaches to improve drought tolerance of crops

Genomics-based approaches to improve drought tolerance of crops Review TRENDS in Plant Science Vol.11 No.8 Full text provided by www.sciencedirect.com Genomics-based approaches to improve drought tolerance of crops Roberto Tuberosa and Silvio Salvi Department of Agroenvironmental

More information

DEPARTMENT OF PLANT BREEDING AND GENETICS

DEPARTMENT OF PLANT BREEDING AND GENETICS DEPARTMENT OF PLANT BREEDING AND GENETICS Course No. PBG 511 (Principles of Genetics and Cell Biology ) Cr. Hr. 3(2+1) Teacher Dr. D.K.Gothwal 16 5.10.15 Extra chromosomal inheritance 17 6.10.15 Concepts

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

Genomic resources and gene/qtl discovery in cereals

Genomic resources and gene/qtl discovery in cereals Genomic resources and gene/qtl discovery in cereals Roberto Tuberosa Dept. of Agroenvironmental Sciences & Technology University of Bologna, Italy The ABDC Congress 1-4 March 2010 Gudalajara, Mexico Outline

More information

Contents. Acknowledgments 18 References 19. Part I Genetic Mapping 1. 1 Mapping Populations and Principles of Genetic Mapping 3 Katharina Schneider

Contents. Acknowledgments 18 References 19. Part I Genetic Mapping 1. 1 Mapping Populations and Principles of Genetic Mapping 3 Katharina Schneider Contents Part I Genetic Mapping 1 1 Mapping Populations and Principles of Genetic Mapping 3 Katharina Schneider Overview 3 Abstract 3 1.1 Introduction 4 1.2 Mapping Populations 6 1.2.1 Mapping Populations

More information

GDMS Templates Documentation GDMS Templates Release 1.0

GDMS Templates Documentation GDMS Templates Release 1.0 GDMS Templates Documentation GDMS Templates Release 1.0 1 Table of Contents 1. SSR Genotyping Template 03 2. DArT Genotyping Template... 05 3. SNP Genotyping Template.. 08 4. QTL Template.. 09 5. Map Template..

More information

Test Bank for Molecular Cell Biology 7th Edition by Lodish

Test Bank for Molecular Cell Biology 7th Edition by Lodish Test Bank for Molecular Cell Biology 7th Edition by Lodish Link download full: http://testbankair.com/download/test-bank-formolecular-cell-biology-7th-edition-by-lodish/ Chapter 5 Molecular Genetic Techniques

More information

HCS806 Summer 2010 Methods in Plant Biology: Breeding with Molecular Markers

HCS806 Summer 2010 Methods in Plant Biology: Breeding with Molecular Markers HCS806 Summer 2010 Methods in Plant Biology: Breeding with Molecular Markers Lecture 7. Populations The foundation of any crop improvement program is built on populations. This session will explore population

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter

More information

Department of Biotechnology. Molecular Markers. In plant breeding. Nitin Swamy

Department of Biotechnology. Molecular Markers. In plant breeding. Nitin Swamy Department of Biotechnology Molecular Markers Nitin Swamy In plant breeding 17 1. Introduction Molecular breeding (MB) may be defined in a broad-sense as the use of genetic manipulation performed at DNA

More information

Population Genetics. If we closely examine the individuals of a population, there is almost always PHENOTYPIC

Population Genetics. If we closely examine the individuals of a population, there is almost always PHENOTYPIC 1 Population Genetics How Much Genetic Variation exists in Natural Populations? Phenotypic Variation If we closely examine the individuals of a population, there is almost always PHENOTYPIC VARIATION -

More information

Association mapping of Sclerotinia stalk rot resistance in domesticated sunflower plant introductions

Association mapping of Sclerotinia stalk rot resistance in domesticated sunflower plant introductions Association mapping of Sclerotinia stalk rot resistance in domesticated sunflower plant introductions Zahirul Talukder 1, Brent Hulke 2, Lili Qi 2, and Thomas Gulya 2 1 Department of Plant Sciences, NDSU

More information

Concepts: What are RFLPs and how do they act like genetic marker loci?

Concepts: What are RFLPs and how do they act like genetic marker loci? Restriction Fragment Length Polymorphisms (RFLPs) -1 Readings: Griffiths et al: 7th Edition: Ch. 12 pp. 384-386; Ch.13 pp404-407 8th Edition: pp. 364-366 Assigned Problems: 8th Ch. 11: 32, 34, 38-39 7th

More information

Midterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score

Midterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score Midterm 1 Results 10 Midterm 1 Akey/ Fields Median - 69 8 Number of Students 6 4 2 0 21 26 31 36 41 46 51 56 61 66 71 76 81 86 91 96 101 Exam Score Quick review of where we left off Parental type: the

More information

Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8

Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8 Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically

More information

Genetics Effective Use of New and Existing Methods

Genetics Effective Use of New and Existing Methods Genetics Effective Use of New and Existing Methods Making Genetic Improvement Phenotype = Genetics + Environment = + To make genetic improvement, we want to know the Genetic value or Breeding value for

More information

LATE-PCR. Linear-After-The-Exponential

LATE-PCR. Linear-After-The-Exponential LATE-PCR Linear-After-The-Exponential A Patented Invention of the Laboratory of Human Genetics and Reproductive Biology Lab. Director: Lawrence J. Wangh, Ph.D. Department of Biology, Brandeis University,

More information

A Primer of Ecological Genetics

A Primer of Ecological Genetics A Primer of Ecological Genetics Jeffrey K. Conner Michigan State University Daniel L. Hartl Harvard University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts U.S.A. Contents Preface xi Acronyms,

More information

DESIGNER GENES - BIOTECHNOLOGY

DESIGNER GENES - BIOTECHNOLOGY DESIGNER GENES - BIOTECHNOLOGY Technology to manipulate DNA techniques often called genetic engineering or Recombinant DNA Technology-Technology used to manipulate DNA Procedures often called genetic engineering

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

Park /12. Yudin /19. Li /26. Song /9

Park /12. Yudin /19. Li /26. Song /9 Each student is responsible for (1) preparing the slides and (2) leading the discussion (from problems) related to his/her assigned sections. For uniformity, we will use a single Powerpoint template throughout.

More information

West Africa Centre for Crop Improvement. New Four Year Ph D Programme In Plant Breeding f or West Africa Centre For Crop Improvement

West Africa Centre for Crop Improvement. New Four Year Ph D Programme In Plant Breeding f or West Africa Centre For Crop Improvement West Africa Centre for Crop Improvement New Four Year Ph D Programme In Plant Breeding f or West Africa Centre For Crop Improvement Introduction The West Africa Centre for Crop Improvement (WACCI), a partnership

More information

Introduction Genetics in Human Society The Universality of Genetic Principles Model Organisms Organizing the Study of Genetics The Concept of the

Introduction Genetics in Human Society The Universality of Genetic Principles Model Organisms Organizing the Study of Genetics The Concept of the Introduction Genetics in Human Society The Universality of Genetic Principles Model Organisms Organizing the Study of Genetics The Concept of the Gene Genetic Analysis Molecular Foundations of Genetics

More information

latestdevelopments relevant for the Ag sector André Eggen Agriculture Segment Manager, Europe

latestdevelopments relevant for the Ag sector André Eggen Agriculture Segment Manager, Europe Overviewof Illumina s latestdevelopments relevant for the Ag sector André Eggen Agriculture Segment Manager, Europe Seminar der Studienrichtung Tierwissenschaften, TÜM, July 1, 2009 Overviewof Illumina

More information

Introduction to Plant Genomics and Online Resources. Manish Raizada University of Guelph

Introduction to Plant Genomics and Online Resources. Manish Raizada University of Guelph Introduction to Plant Genomics and Online Resources Manish Raizada University of Guelph Genomics Glossary http://www.genomenewsnetwork.org/articles/06_00/sequence_primer.shtml Annotation Adding pertinent

More information

Trudy F C Mackay, Department of Genetics, North Carolina State University, Raleigh NC , USA.

Trudy F C Mackay, Department of Genetics, North Carolina State University, Raleigh NC , USA. Question & Answer Q&A: Genetic analysis of quantitative traits Trudy FC Mackay What are quantitative traits? Quantitative, or complex, traits are traits for which phenotypic variation is continuously distributed

More information

Genetics. Genetics- is the study of all manifestation of inheritance from the distributions of traits to the molecules of the gene itself

Genetics. Genetics- is the study of all manifestation of inheritance from the distributions of traits to the molecules of the gene itself What is Genetics? Genetics Mapping of genes Basis of life Inheritable traits Abnormalities Disease Development DNA RNA Proteins Central dogma - Watson & Crick Genes- segments of DNA that code for proteins

More information

STANDER, l.r., Betaseed, Inc. P.O. Box 859, Kimberly, ID The relationship between biotechnology and classical plant breeding.

STANDER, l.r., Betaseed, Inc. P.O. Box 859, Kimberly, ID The relationship between biotechnology and classical plant breeding. STANDER, l.r., Betaseed, Inc. P.O. Box 859, Kimberly, ID 83341. The relationship between biotechnology and classical plant breeding. Plant breeders have been relatively successful over the years. Duvick

More information

Before starting, write your name on the top of each page Make sure you have all pages

Before starting, write your name on the top of each page Make sure you have all pages Biology 105: Introduction to Genetics Name Student ID Before starting, write your name on the top of each page Make sure you have all pages You can use the back-side of the pages for scratch, but we will

More information

SNP calling and Genome Wide Association Study (GWAS) Trushar Shah

SNP calling and Genome Wide Association Study (GWAS) Trushar Shah SNP calling and Genome Wide Association Study (GWAS) Trushar Shah Types of Genetic Variation Single Nucleotide Aberrations Single Nucleotide Polymorphisms (SNPs) Single Nucleotide Variations (SNVs) Short

More information

GENE MAPPING. Genetica per Scienze Naturali a.a prof S. Presciuttini

GENE MAPPING. Genetica per Scienze Naturali a.a prof S. Presciuttini GENE MAPPING Questo documento è pubblicato sotto licenza Creative Commons Attribuzione Non commerciale Condividi allo stesso modo http://creativecommons.org/licenses/by-nc-sa/2.5/deed.it Genetic mapping

More information

Genome annotation & EST

Genome annotation & EST Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary

More information

GBS Usage Cases: Examples from Maize

GBS Usage Cases: Examples from Maize GBS Usage Cases: Examples from Maize Jeff Glaubitz (jcg233@cornell.edu) Senior Research Associate, Buckler Lab, Cornell University Panzea Project Manager Cornell IGD/CBSU Workshop June 17 18, 2013 Some

More information

1) (15 points) Next to each term in the left-hand column place the number from the right-hand column that best corresponds:

1) (15 points) Next to each term in the left-hand column place the number from the right-hand column that best corresponds: 1) (15 points) Next to each term in the left-hand column place the number from the right-hand column that best corresponds: natural selection 21 1) the component of phenotypic variance not explained by

More information

Chapter 5. Structural Genomics

Chapter 5. Structural Genomics Chapter 5. Structural Genomics Contents 5. Structural Genomics 5.1. DNA Sequencing Strategies 5.1.1. Map-based Strategies 5.1.2. Whole Genome Shotgun Sequencing 5.2. Genome Annotation 5.2.1. Using Bioinformatic

More information

Quantitative Genetics, Genetical Genomics, and Plant Improvement

Quantitative Genetics, Genetical Genomics, and Plant Improvement Quantitative Genetics, Genetical Genomics, and Plant Improvement Bruce Walsh. jbwalsh@u.arizona.edu. University of Arizona. Notes from a short course taught June 2008 at the Summer Institute in Plant Sciences

More information

PCR. What is PCR? What is PCR? Why chain? What is PCR? Why Polymerase?

PCR. What is PCR? What is PCR? Why chain? What is PCR? Why Polymerase? What is PCR? PCR the swiss army knife Claudia Stäubert, Institute for biochemistry PCR is an exponentially progressing synthesis of the defined target DNA sequences in vitro. It was invented in 1983 by

More information

MEHDI FARID PAGE 1 OF 5

MEHDI FARID PAGE 1 OF 5 MEHDI FARID PAGE 1 OF 5 MEHDI FARID BSc. Agronomy, MSc. Crop Physiology, Ph.D. Plant Breeding & Genetics AFNS Department, University of Alberta Edmonton, Alberta T6G 2R3 587-778-3139 mfarid@ualberta.ca

More information

UNIT III: Genetics Chapter 9 Frontiers of Biotechnology

UNIT III: Genetics Chapter 9 Frontiers of Biotechnology UNIT III: Genetics Chapter 9 Frontiers of Biotechnology I. Manipulating DNA (9.1) A. Scientists use several techniques to manipulate DNA 1. DNA is a very large molecule 2. Still to small to see or work

More information

Application of Genotyping-By-Sequencing and Genome-Wide Association Analysis in Tetraploid Potato

Application of Genotyping-By-Sequencing and Genome-Wide Association Analysis in Tetraploid Potato Application of Genotyping-By-Sequencing and Genome-Wide Association Analysis in Tetraploid Potato Sanjeev K Sharma Cell and Molecular Sciences The 3 rd Plant Genomics Congress, London 12 th May 2015 Potato

More information

Motivation From Protein to Gene

Motivation From Protein to Gene MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein

More information

SELECTED TECHNIQUES AND APPLICATIONS IN MOLECULAR GENETICS

SELECTED TECHNIQUES AND APPLICATIONS IN MOLECULAR GENETICS SELECTED TECHNIQUES APPLICATIONS IN MOLECULAR GENETICS Restriction Enzymes 15.1.1 The Discovery of Restriction Endonucleases p. 420 2 2, 3, 4, 6, 7, 8 Assigned Reading in Snustad 6th ed. 14.1.1 The Discovery

More information

C. Incorrect! Second Law: Law of Independent Assortment - Genes for different traits sort independently of one another in the formation of gametes.

C. Incorrect! Second Law: Law of Independent Assortment - Genes for different traits sort independently of one another in the formation of gametes. OAT Biology - Problem Drill 20: Chromosomes and Genetic Technology Question No. 1 of 10 Instructions: (1) Read the problem and answer choices carefully, (2) Work the problems on paper as needed, (3) Pick

More information

Using mutants to clone genes

Using mutants to clone genes Using mutants to clone genes Objectives 1. What is positional cloning? 2. What is insertional tagging? 3. How can one confirm that the gene cloned is the same one that is mutated to give the phenotype

More information

Lecture 21: Association Studies and Signatures of Selection. November 6, 2006

Lecture 21: Association Studies and Signatures of Selection. November 6, 2006 Lecture 21: Association Studies and Signatures of Selection November 6, 2006 Announcements Outline due today (10 points) Only one reading for Wednesday: Nielsen, Molecular Signatures of Natural Selection

More information

MOLECULAR TYPING TECHNIQUES

MOLECULAR TYPING TECHNIQUES MOLECULAR TYPING TECHNIQUES RATIONALE Used for: Identify the origin of a nosocomial infection Identify transmission of disease between individuals Recognise emergence of a hypervirulent strain Recognise

More information

2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology

2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes

More information

Association studies (Linkage disequilibrium)

Association studies (Linkage disequilibrium) Positional cloning: statistical approaches to gene mapping, i.e. locating genes on the genome Linkage analysis Association studies (Linkage disequilibrium) Linkage analysis Uses a genetic marker map (a

More information

MSc specialization Animal Breeding and Genetics at Wageningen University

MSc specialization Animal Breeding and Genetics at Wageningen University MSc specialization Animal Breeding and Genetics at Wageningen University The MSc specialization Animal Breeding and Genetics focuses on the development and transfer of knowledge in the area of selection

More information