SUPPLEMENTARY INFORMATION

Size: px
Start display at page:

Download "SUPPLEMENTARY INFORMATION"

Transcription

1 SUPPLEMENTARY INFORMATION doi: /nture10698 Rg1 µmt LPLs CD3 LPLs CD11c hi LPLs CD3 splenocytes CD19 LPLs CD19 splenocytes 2 Ocontrol J 4 CD11c Supplementry Figure 1 Chrcteriztion of intestinl lmin propri-derived TNFα cells in wildtype, Rg2 nd µmt mice., Intestinl lmin propri cells (LPC) of wild-type (), Rg2 nd µmt mice were isolted nd nlyzed y flow cytometry. Representtive flow cytometry plots of LPC stined for CD11c nd re shown. A significnt reduction in cells ws oserved in the smll intestinl lmin propri (n = 4 per group). NB: The residul ppernce of some -producing cells in µmt mice my e ssocited with the smll numers of immture B cells in their intestinl LP 9., Splenocytes nd intestinl lmin propri cells were stined nd sorted y flow cytometry. Genomic DNAs from sorted cells were mplified y PCR for hevy chin V(D)J-rerrnged products using the V ll primer nd the J 4-C intronic primer to mplify joints, seprted on n grose gel, southern lotted nd proed with n internl (coding region) J 4-specific proe. 1

2 RESEARC SUPPLEMENTARY INFORMATION c Supplementry Figure 2 Chrcteriztion of expression in smll intestinl lmin propri-derived cells y cytospin nd immune fluorescence microscopy. Smll intestinl lmin propri cells (LPC) of wild-type mixed chimeric mice were isolted, cytospins prepred nd stined nd nlyzed y fluorescence microscopy., nucleic cid stin (lue) nd (green),, (lue) nd (red), c, (lue), (green) nd (red). As depicted y the rrows, the expression of is restricted to plsm cells. Cytoplsmic locliztion of ppers to positively correlte with high expression, declining upon cell surfce locliztion of. Emedded in the pictures re mgnifictions of single cells. Representtive pictures re shown following imge cquisition under oil t 630x. 2

3 SUPPLEMENTARY INFORMATION RESEARC d e TNFα TNFα c f TNFα TNFα Supplementry Figure 3 Chrcteriztion of nd TNFα expression in smll intestinl lmin propriderived cells y cytospin nd immune fluorescence microscopy. Smll intestinl lmin propri cells (LPC) of wild-type mixed chimeric mice were isolted, cytospins prepred nd stined nd nlyzed y fluorescence microscopy., nucleic cid stin (lue) nd (green),, (lue) nd TNFα (red), c, (lue), (green) nd TNFα (red), d, (lue), e, (lue) nd TNFα (red), f, (lue), (green) nd TNFα (red). On top of the pictures mgnifictions of single cells re shown. As depicted y the rrows, the expression of nd/or TNFα is restricted to plsm cells, indicting the presence of TNFα, - TNFα s well s TNFα - plsm cells. Representtive pictures re shown following imge cquisition under oil t 630x. 3

4 RESEARC SUPPLEMENTARY INFORMATION Longitudinl Trnsverse Merge YFP EpCAM Supplementry Figure 4 Chrcteriztion nd locliztion of intestinl plsm cells in AID YFP nimls. Longitudinl nd trnsverse sections of smll intestines of AID YFP nimls were stined with specific fluorochrome-tgged ntiodies for EpCAM (lue) which stins the epithelil lyer, nd (red), nd nlyzed y fluorescence microscopy. The rrows highlight AID plsm cells, which pper in yellow. Representtive pictures re shown from totl of 2 seprte experiments, n=3 mice per experiment. 4

5 SUPPLEMENTARY INFORMATION RESEARC S17 one mrrow strom B220 BM cells (CD45.2) IL-7/TGFβ/IL-21 Gut strom (CD45.1) B220 BM cells (CD45.2) IL-7/TGFβ/IL-21 gted on CD isotype αcd40 YFP (AID) gted on CD isotype αcd40 YFP (AID) S17 BM cells (CD45.2) IL-7,TGFβ,IL-21,αCD40 BM strom (CD45.1) BM cells (CD45.2) IL-7,TGFβ,IL-21,αCD40 Gut strom (CD45.1) BM cells (CD45.2) IL-7,TGFβ,IL-21,αCD40 Gut strom (LTβR ) BM cells (CD45.2) IL-7,TGFβ,IL-21,αCD40 gted on CD Supplementry Figure 5 In vitro genertion of -producing plsm cells., B220 one mrrow (BM) cells derived from AID-YFP mice were co-cultured for up to 7 dys with CD45.1 intestinl lmin propri cells ( Gut strom ) or the S17 one mrrow stroml cell line, in the presence of IL-7, TGFβ, IL-21 nd αcd40 ntiody. The expression of, nd YFP ws nlyzed y flow cytometry. cells = green rectngle, - cells = lue rectngle nd - - cells = red rectngle. Dt re representtive of t lest three independent experiments. Representtive flow cytometry plots re shown., B220 one mrrow (BM) cells from CD45.2 wild type mice were co-cultured for 7 dys in the presence of IL-7, TGFβ, IL-21 nd αcd40 ntiody with: the BM-derived stroml cell line S17, CD45.1 BM-derived cells ( BM strom ), CD45.1 intestinl lmin propri cells ( Gut strom ), CD45.1 intestinl lmin propri cells ( Gut strom ) from LTβR nimls (NB, LTβR mice hve een ck-crossed to the CD45.1 congenic ckground). To ensure selective nlysis of BMderived precursors, cells were pre-gted on the CD popultion. Representtive flow cytometry plots of cells nlyzed for nd. cells re depicted y the red rectngle. Dt re representtive of t lest three independent experiments. 5

6 RESEARC SUPPLEMENTARY INFORMATION mixed chimers: All cells cn mke TNF/ Control mixed chimers: 60% of ll cells cn mke TNF/ dko mixed chimers: B cells cnnot mke TNF/ J B cell- deficient vs TNFα X B cell- deficient vs TNFα X J B cell- deficient Supplementry Figure 6 Genertion of mixed one mrrow chimeric mice Schemtic representtion of mixed one mrrow chimer genertion. Rg2 or J mice were irrdited to deplete rdio-sensitive cells nd nimls were reconstituted with mixture of 1) one mrrow from wild-type () J nimls (yielding mice where ll B cells re TNFα ), 2) one mrrow from TNFα - - doule-deficient nimls (yielding reconstituted mice where most B cells nd other rdio-sensitive cells re TNFα ) nd 3) one mrrow from TNFα - - doule-deficient J nimls (yielding reconstituted mixed chimers where ll B cells re TNFα - - ). 6

7 SUPPLEMENTARY INFORMATION RESEARC dko E04 Schemtic representtion of mixed one mrrow chimer genertion. Rg2 or J mice E03 were irrdited to deplete rdio-sensitive cells nd nimls were reconstituted with E02 mixture of 1) one mrrow from wild-type () J nimls (yielding mice 00 where ll 1.0E01 B cells re TNFα), 2) one mrrow from TNFα-- doule-deficient 1.0E00 CD3ε nimls (yielding reconstituted mice where most B cells nd other rdio-sensitive cells MdCAM1 B220 re TNFα ) nd 3) one mrrow from TNFα-- doule-deficient J CD11 mdc 05 B cells Numer/spleen dko 1.0E05 06 Neutrophils 1.0E06 CD8 T cells CD35 B220 CD3ε Genertion of mixed one mrrow chimeric mice Supplementry Figure 6 07 CD4 T cells 1.0E07 pdc CD8 DC c cells/spleen (1.0E) nimls (yielding reconstituted mixed chimers where ll B cells re TNFα--). Supplementry Figure 7 Anlysis of splenic rchitecture of mixed chimeric mice. Anlysis of splenic rchitecture of mixed chimeric mice. Sec>ons of spleens from nd dko mixed one chimeric miceone weremrrow stined with specific fluorochrome tgged n>odies for, Sections of recons>tuted spleens from nd dkomrrow reconstituted mixed chimeric mice CD35 (green), B220 (red) nd CD3e (lue), CD3ε (green), MdCAM1 (red) nd B220 (lue), nd nlyzed y fluorescence microscopy. igh levels of CD35 re expressed y Folliculrwere Dendri>c Cells (FDC), nd MdCAM1 is expressedntiodies in the mrginl (MZ) sinus. In mice tht lck TNFα in B cells, FDC network stined with specific fluorochrome-tgged for,zone CD35 (green), B220 nd the MZ re disrupted10. Dt re represent>ve of t lest four independent mixed chimeric nimls nlyzed. Represent>ve pictures re shown. c, Spleens from nd dko(red) recons>tuted were MdCAM1 isolted, single suspensions prepred nd the totl counts of the indicted cell nd CD3εmixed (lue)chimeric, CD3 mice ε (green), (red)cell nd B220 (lue), nd nlyzed susets were determined y flow cytometry. Asolute cell suset counts (logrithmic scle) in spleen re not different etween nd dko mice (lck versus grey rs respec>vely) in non infected mice. y fluorescence microscopy. igh levels of CD35 re expressed y Folliculr Dendritic Cells (FDC), nd MdCAM1 is expressed in the mrginl zone (MZ) sinus. In mice tht lck TNFα in B cells, FDC networks nd the MZ re disrupted1. Dt re representtive of t lest four independent mixed chimeric nimls nlyzed. Representtive pictures re Supplementry Figure 7 shown. c, Spleens from nd dko reconstituted mixed chimeric mice were isolted, single cell suspensions prepred nd the totl counts of the indicted cell susets were determined y flow cytometry. Asolute cell suset counts (logrithmic scle) in spleen re not different etween nd dko mice (lck rs versus grey rs respectively) in non-infected mice. 5 Supplementry Figure 8 /TNFα doule-deficient mixed chimers re more susceptile to infection with Citrocter rodentium., Lrge intestines (LI) from nd dko mixed chimers mice were hrvested 11 dys post-infection nd the pthologicl scores were nlyzed y stndrd histologicl stining W W W. N A T U R E. C O M / N A T U R E 7 procedures using hemtoxylin nd eosin (&E). LI s from dko nimls show more

8 RESEARC SUPPLEMENTARY INFORMATION dko 5 Dys post infection Dys post infection % Body weight loss J DKO Jh J Jh J DKO Jh dko J -20 * c CFU spleen liver cecum Spleen Liver 3.5x10 5 ** 5.0x10 5 ** 3.0x x x x x x x x x x10 4 * 6.0x x x x x x10 08 Cecum DKO!Jh Jh DKO!Jh DKO!Jh Jh DKO!Jh DKO!Jh Jh DKO!Jh dko J J dko J dko J J dko J dko J J dko J Supplementry Figure 8 7.0x x x x x x x /TNFα doule-deficient mixed chimers re more susceptile to infection with Citrocter rodentium., Lrge intestines (LI) from nd dko mixed chimers mice were hrvested 11 dys post-infection nd the pthologicl scores were nlyzed y stndrd histologicl stining procedures using hemtoxylin nd eosin (&E). LI s from dko nimls show more severe pthology. &E stining of two representtive dko mice nd mice re shown. Note the infiltrtes in the dko mice (rrows) nd the shortened crypt length (scle rs). The pnel shows the originl mgnifiction of 10x nd scle rs represent 250 µm., The percentge of ody weight loss in dko J versus J dko J mixed chimers fter C. rodentium infection over time is depicted. Significntly higher ody weight loss in J dko J mice ws oserved from dy 7 to dy 11 post-infection (n = 7 per group). NB: One J dko J mouse ws found ded t dy 10 post-infection. Also note tht in this experiment, C. rodentium ws somewht ttenuted compred to prior experiments, thus resulting in lter onset of weight loss nd lrger vriility in weight loss. c, The coloniztion y C. rodentium ws determined 11 dys fter infection y homogenizing spleens, livers nd cecums followed y seril dilution plting on nlidixic cid-contining LB pltes nd counting of colonies. C. rodentium coloniztion of ll 3 orgns is significntly enhnced in dko mice t dy 11 post-infection. * p < 0.05, ** p <

9 SUPPLEMENTARY INFORMATION RESEARC Tle I Frequency of CD11c lo cells (n=20) LTβ (n=6) LTβR (n=6) J (n=6) dko (n=5) % CD11c lo 0.50** Men (SEM) & (0.05) 0.03 (0.01) 0.01 (0.00) (0.00) 0.03 (0.03) All vlues indicte Men nd (SEM) nd represent t lest 3 different experiments. Frequency of CD11c lo from totl live lymphocytes. **Significnt difference when is compred with the other four groups, p< Tle II Frequency of /TNFα cells (n=14) dko (n=10) % Men (SEM) % TNFα Men (SEM) 1.27 (0.42)* 0.73 (0.26) 6.50 (1.51)* 3.72 (1.09)) % TNFα 0.76 (0.17)* 0.37 (0.13) All vlues indicte Men nd (SEM) nd represent t lest 3 different experiments. Cells re gted previously on B220 - live cells. * Significnt difference when is compred with dko in ech condition, p<0.05. cells represented 14.5% /- 2.1% of the totl lmin propri preprtion from the cohort of mice. 9

10 RESEARC SUPPLEMENTARY INFORMATION Tle III Frequency of different popultions of YFP vs YFP - cells (n=14) - AID - AID - AID Men (SEM) 1.18 (0.19) (0.78) 1.70 (0.32) All vlues indicte Men nd (SEM) nd represent t lest 2 different experiments using AID-cre x YFP mice. Tle IV Frequency of /TNFα cells AID (n=9) - AID (n=9) - AID - (n=7) % Men (SEM) % TNF Men (SEM) 3.37 (0.94)** 0.31 (0.11) 0.05 (0.02) 4.55 (0.47)*** 0.72 (0.41) (0.005) % TNF 1.50 (0.68)* 0.03 (0.01) (0.004) All vlues indicte Men nd (SEM) nd represent t lest 2 different experiments using AID-cre x YFP mice. Significnt difference when AID is compred with the other two groups, *p<0.05, **p<0.005, ***p<

11 SUPPLEMENTARY INFORMATION RESEARC References 1 Tumnov, A. V. et l. Cellulr source nd moleculr form of TNF specify its distinct functions in orgniztion of secondry lymphoid orgns. Blood 116, , (2010). 11

Lineage-specific functions of Bcl6 in immunity and inflammation are mediated through distinct biochemical mechanisms

Lineage-specific functions of Bcl6 in immunity and inflammation are mediated through distinct biochemical mechanisms Supplementry informtion for: Linege-specific functions of Bcl6 in immunity nd inflmmtion re medited through distinct iochemicl mechnisms Chunxin Hung, Kterin Htzi & Ari Melnick Division of Hemtology nd

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION % chnge in ody mss. -.. Smll intestinl mss (g) -1. -. -. Villi length in proximl jejunum (µm) 1 # of crypts/ mm of jejunum g Proximl jejunum # of enterocytes in jejunl villi 1 1 e. -. d Smll intestinl

More information

Nod2-mediated recognition of the microbiota is critical for mucosal adjuvant activity of cholera toxin

Nod2-mediated recognition of the microbiota is critical for mucosal adjuvant activity of cholera toxin Supplementry informtion Nod2-medited recognition of the microiot is criticl for mucosl djuvnt ctivity of choler toxin Donghyun Kim 1,2, Yun-Gi Kim 1,2, Sng-Uk Seo 1,2, Dong-Je Kim 1,2, Nouhiko Kmd 3, Dve

More information

nm nm nm nm nm nm. Seed surface. oi-ab. oi-ad. ii-ab. ii-ad/endothelium. endosperm.

nm nm nm nm nm nm. Seed surface. oi-ab. oi-ad. ii-ab. ii-ad/endothelium. endosperm. B 360-370nm Seed surfce oi- 90-100nm A 630-640nm oi-d ii- ii-d/endothelium 230-240nm 220-230nm 240-280nm 1mm endosperm C oi-d D ii-d/endothelium ii- endosperm Supplementry Figure 1 Cell wll thickness mesurements

More information

Fluorescence Intensities of. GFP-PAC-1 Strains

Fluorescence Intensities of. GFP-PAC-1 Strains DOI: 10.1038/ncb3168 Arbitrry Fluorescence Units 2500 2000 1500 1000 500 0 full length (1-4) Fluorescence Intensities of GFP-PAC-1 Strins ΔPH 392-838 575-4 GFP-PAC-1 Strins 2-610 1-574 b control c pc-1(3

More information

Supplementary information

Supplementary information PP GC B Epithelil cell Peyer s ptch B lymphocyte Dendritic cell Bsophil Neutrophil Mst cell Nturl killer cell T lymphocyte Supplementry informtion EAF2 medites germinl center B cell poptosis to suppress

More information

1. Supplementary Figures and Legends a b

1. Supplementary Figures and Legends a b doi:10.1038/nture09540 1. Supplementry Figures nd Legends Supplementry Figure 1. Scnning trnsmission electron microgrphs (STEM) of NCC., STEM prepred from fst evportion of dilute NCC suspension shows individul

More information

Substrate elasticity provides mechanical signals for the expansion of hemopoietic stem and progenitor cells

Substrate elasticity provides mechanical signals for the expansion of hemopoietic stem and progenitor cells correction notice Nt. Biotechnol. 28, 1123 1128 (21); pulished online 3 Octoer 21; corrected fter print 27 April 211 Sustrte elsticity provides mechnicl signls for the expnsion of hemopoietic stem nd progenitor

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Mgneto-erotctic cteri deliver drug-contining nnoliposomes to tumour hypoxic regions Oujdi Felfoul, Mhmood Mohmmdi, Smir Therkhni, Dominic de Lnuze, Yong Zhong Xu, Dumitru Loghin, Sherief Ess, Sylwi Jncik,

More information

Supplementary Fig

Supplementary Fig Supplementry Fig. 1 * 180-115- 82-64- 49-37- * 180-115- 85-64- 49-37- 26-26- Mem Cyt Mem Cyt Supplementry Fig.1 Specificity of nti-tie2 ntiodies. HUVECs were homogenized nd centrifuged t 400 000g to otin

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 1.138/nc2274 EpH4 Prentl -/MDCK EpH4 Prentl -/MDCK - FERM- Figure S1 (kd) delferm- (1-438)- c Prentl MDCK -/MDCK deljfr- Input Control IP IP Input Control IP IP d Control Control Figure S1 () Specificity

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementry Figure 1 d6 d8 d9 SSC.575 27.4 35.1 d1 d12 d2 39.6 5.4 67.3 NKX2-5-GFP Supplementry Figure 1 Differentition kinetics of the NKX2-5-GFP HES3 hesc line (Elliott et l., 211). Flow cytometric

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nture77 c 2 2 1 15 1 1 5 1 1 5 5 129Sv 1.5 h IL-6 / HPRT 3 h 5 h 6 4 2 d 129Sv 4 4 3 3 2 1 1 8 6 4 2 e f g C57/BL6 Poly(dA-dT) Cell numer (normlized to medium control) 1 5 1 5 1 5 Fluorescence

More information

Supplementary Figure 1. Zhang et al.

Supplementary Figure 1. Zhang et al. Supplementry Figure 1. Zhng et l. T30-SurA: GGCAGTTTCATCATGAATGTGCAGGAGCTTGCAACAATTAAGGTGGAGAATCTCCC T30-SurB: GGCAGTTTCATCATGAATGTGCAGGAGCTAGCAACTATTAAGGTGGAGAATCTCCC T41-SurA: ACTGAATAATCAACACTTGGGAATGGTGGTTCAATGGGAGGATCGGTTCTAT

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/nc2307 c No Jsplkinolide Jsplkinolide MDCK AP2-GFP Trnsferrin Merge BSC1 Trnsferrin fluorescence (.u.) MDCK - Jsplkinolide Jsplkinolide AP2-GFP fluorescence (.u.) Trnsferrin fluorescence (.u.)

More information

H. Randall Smith; Ph.D. Agronomy and Wayne Porter: Ph.D. Horticulture Mississippi State University Extension Service

H. Randall Smith; Ph.D. Agronomy and Wayne Porter: Ph.D. Horticulture Mississippi State University Extension Service Effect of SumGrow on growth, development nd yield of Irish pottoes (Solnum tuerosum) t the Beumont Reserch Sttion (Mississippi Stte University) during 217 H. Rndll Smith; Ph.D. Agronomy nd yne Porter:

More information

a ATP release 4h after induction

a ATP release 4h after induction doi:1.138/nture9413 ATP relese 4h fter induction of poptosis (nm) 5 ATP 4 3 2 1 UV UV + zvad 1μM 3μM 5μM UV + 1μM 3μM 5μM UV + 18AGA 1μM 3μM 5μM UV + FFA HeL monolyer Scrpe Dye trnsfer HeL HeL-Cx43 HeL-Cx43

More information

Interplay between NS3 protease and human La protein---- by Ray and Das Supplementary fig 1. NS3 pro

Interplay between NS3 protease and human La protein---- by Ray and Das Supplementary fig 1. NS3 pro Interply etween tese nd humn L protein---- y Ry nd Ds Supplementry fig 1 1 2 3 4 UV crosslinking ssy: α[ 32 P]UTP leled HCV IRES RNA ws UV-crosslinked to incresing concentrtions (0.1, 0.2 nd 0.4µM) in

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nture10177 MDYKDHDGDYKDHDIDYKDD DDKMAPKKKRKVGIHGVPAA MAERPFQCRICMRKFAQSGD LTRHTKIHTGEKPFQCRICM RNFSRSDVLSEHIRTHTGEK PFACDICGKKFADRSNRIKH TKIHTGSQKPFQCRICMRNF SRSDNLSEHIRTHTGEKPFA

More information

their response to inoculation with the bacterium which causes walnut blight. Tested germplasm was selectedj for its unusual

their response to inoculation with the bacterium which causes walnut blight. Tested germplasm was selectedj for its unusual WALNUT BLIGHT: SUSCEPTIBILITY OF GERMPLASM AND THE RETENTION OF OVERWINTERING PATHOGN POPULATIONS Keith Woeste, Gle McGrnhn, Roy Yri nd M.N. Schroth ABSTRACT Aspects of the susceptibility of English wlnu~

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nture12040 + + + Glc Gln Supplementry Figure 1., Reltive prolifertion of PDAC cell lines (8988T, Tu8902, Pnc1, Mipc2, PL45 nd MPnc96) nd low pssge primry humn PDAC cell lines (#1 nd #2) under

More information

a b c Nature Neuroscience: doi: /nn.3632

a b c Nature Neuroscience: doi: /nn.3632 c Supplementry Figure 1. The reltion etween stndrd devition (STD) nd men of inter-press intervls (IPIs) under different schedules. -c, Disproportionlly fster decrese of the stndrd devition compred to the

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/nc2885 kd M ΔNZipA 66.4 55.6 ZipA 42.7 34.6 6x His NiNTA 27.0 c 1.,, 2. evnescent field supported memrne Supplementry Figure 1 Experimentl ssy. () Illustrtion of protein interctions (dpted

More information

Supplemental Figure S1

Supplemental Figure S1 Supplementl Figure S1 TG nrt1.5- Li et l., 1 nrt1.5- Lin et l., 8 F L CTGCCT R T 5'UTR 3'UTR 1 3 81p (k) nrt1.5- C nrt1.5- Supplementl Figure S1. Phenotypes of the T-DN insertion mutnts (this pper), nrt1.5-

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nture10970 I. GN directly grown on the h-bn relese lyer Figure S1 shows X-ry diffrction with the 2θ/ω configurtion nd n opticl microscopy imge for the GN directly grown on the h-bn relese lyer.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nture09470 prmt5-1 prmt5-2 Premture Stop Codon () GGA TGA PRMT5 Hypocotyl Length (Reltive to Drk) 0.5 0.3 0.1 ** 30 *** c prmt5-1 d ** *** 150 prmt5-2 ** *** 28 100 26 24 50 prmt5-1 prmt5-2

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:1.138/nture11895 G FSC Linege + PI Sc-1 CD48 c-kit Fc!R CD34 Flk2 CD15 CD15 G ex vivo ± cytokines BfA c WT 2-NBD glucose +cytokines (6h) -cytokines (6h) WT G +cytokines (6h) -cytokines (6h) 2-NBD glucose

More information

Figure S1 Yoo et al.

Figure S1 Yoo et al. doi:.38/nture6543 8 8 6 6 4 4 d Protoplsts Leves Reltive promoter ctivity (%) Reltive trnscript level 2 2 88 66 44 22 32 2 2 MKK-MYC MPK ctivity nti-mpk6 c ctr MKK - 4 5 4 5 MKK-MYC MPK3 ctivity MPK6 ctivity

More information

CHAPTER 5 SEISMIC RESERVOIR CHARACTERIZATION.

CHAPTER 5 SEISMIC RESERVOIR CHARACTERIZATION. CHAPTER 5 ISMIC RERVOIR CHARACTERIZATION. ISMIC RERVOIR CHARACTERIZATION Centrl Scotin Slope Study CANADA June 2016 Ojectives: Chrcterize the snd distriution, using the Mrthon nd Verits 3D post-stck seismic

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION 1 1 μm c d EGF + TPA + e f Intensity 1.8 1.6 1.4 1.2 1.8.6.4.2 2 4 8 2 4 8 (Hours) 2 4 6 8 1 Time (Hours) Reltive luciferse ctivity 4 3 2 1 + CAMEK1 FRE reporter Figure S1 inhiitor incresed protein expression

More information

In situ evaluation of DGT techniques for measurement of trace. metals in estuarine waters: a comparison of four binding layers

In situ evaluation of DGT techniques for measurement of trace. metals in estuarine waters: a comparison of four binding layers Electronic Supplementry Mteril (ESI) for Environmentl Science: Processes & Impcts. This journl is The Royl Society of Chemistry 2015 Supplementry Informtion for: In situ evlution of DGT techniques for

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11809 Supplementary Figure 1. Antibiotic treatment reduces intestinal bacterial load and allows access of non-pathogenic bacteria to the MLN, inducing intestinal

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SI Fig. PrpS is single copy gene k 3. 9... EcoRV EcoRV k 5 BmH Pst c well k HindIII HindIII HindIII.3.5 3.. Southern lots of Ppver genomic DNA from plnts with SS8 hplotypes, hyridized with PrpS proe..

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION S shrna S Viility, % of NT sirna trnsfete ells 1 1 Srmle NT sirna Csp-8 sirna RIP1 Atin L929 shrna sirna: Csp8 Atin L929: shrna Csp8 e Viility, % of NT sirna trnsfete ells NT sirna Csp-8 sirna M45 M45mutRHIM

More information

Supplemental Data. Antosz et al. Plant Cell (2017) /tpc SPT6/SPT6L. genomic DNA ACT2 +RT -RT +RT -RT

Supplemental Data. Antosz et al. Plant Cell (2017) /tpc SPT6/SPT6L. genomic DNA ACT2 +RT -RT +RT -RT A B C SPT6/SPT6L genomic DNA ACT2 +RT -RT Col- seedlings +RT -RT PSB-D cells Supplementl Figure 1. Expression of SPT6L nd SPT6. (Supports Figure 1.) Trnscript levels of of SPT6L (At1g6544) nd SPT6 (At1g6321)

More information

Effect of Transplant Size on Yields and Returns of Bell Peppers. Nathan Howard, Brent Rowell, and John C. Snyder Department of Horticulture

Effect of Transplant Size on Yields and Returns of Bell Peppers. Nathan Howard, Brent Rowell, and John C. Snyder Department of Horticulture Effect of Trnsplnt Size on Yields nd Returns of Bell Peppers Nthn Howrd, Brent Rowell, nd John C. Snyder Deprtment of Horticulture Introduction Bell peppers hve een mjor vegetle crop for frmers in western

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nture11303 c Supplementry Figure 1: Genertion of INCB18424 persistent B/F3 Epor- V617F (EporVF) cells, which re cross resistnt to other inhiitors. : () Nïve EporVF

More information

Supplementary Figure 1. Xbp1 deficiency does not alter hematopoietic cellularity.

Supplementary Figure 1. Xbp1 deficiency does not alter hematopoietic cellularity. Supplementary Figure 1 Xbp1 deficiency does not alter hematopoietic cellularity. Absolute number of leukocytes obtained from bone marrow (BM, 2 tibias and 2 femurs per mouse) of Xbp1 f/f and Xbp1 Vav1

More information

Supplementary Figure 1. Phenotype, morphology and distribution of embryonic GFP +

Supplementary Figure 1. Phenotype, morphology and distribution of embryonic GFP + Supplementary Figure 1 Supplementary Figure 1. Phenotype, morphology and distribution of embryonic GFP + haematopoietic cells in the intestine. GFP + cells from E15.5 intestines were obtained after collagenase

More information

Tree Shelters Fail to Enhance Height Growth of Northern Red Oak in the Upper Peninsula of Michigan. 1

Tree Shelters Fail to Enhance Height Growth of Northern Red Oak in the Upper Peninsula of Michigan. 1 Tree Shelters Fil to Enhnce Height Growth of Northern Red Ok in the Upper Peninsul of Michign. 1 Dougls O. Lntgne, Associte Professor, MSU Deprtment of Forestry nd Rymond Miller, Resident Forester, Upper

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/nc2473 AP-2 EEA1 APPL1 EEA1 APPL1 EEA1 APPL1 c d e AP-2 FCHO2 merge f g h i k FCHO1 EFC domin FCHO2 EFC domin 10X 1X 3X 10X 10X 1X 3X 10X FCHO1/FCHO2 _ + + + _ + + + PtdIns(4,5)P 2 S P S P

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:.38/nture126 Supplementry Tle 1. Oligonucleotides used in this study Nme Sequence ( -3 ) Construction of ptx hld Delt Bm CTAGATCACAGAGATGTGATGGATCCTAGTTGATGAGTTG Delt Mlu GTTGGGATGGCTTAATAACGCGTACTTTTAGTACTATACG

More information

Nonlinear Mixed Effects Model for Swine Growth

Nonlinear Mixed Effects Model for Swine Growth Nonliner Mixed Effects Model for Swine Growth A. P. Schinckel nd B. A. Crig Deprtment of Animl Sciences nd Deprtment of Sttistics, Purdue University Introduction Severl nonliner growth functions model

More information

Supplementary Figure 1. Characterization of the POP2 transcriptional and post-transcriptional regulatory elements. (A) POP2 nucleotide sequence

Supplementary Figure 1. Characterization of the POP2 transcriptional and post-transcriptional regulatory elements. (A) POP2 nucleotide sequence 1 5 6 7 8 9 10 11 1 1 1 Supplementary Figure 1. Characterization of the POP transcriptional and post-transcriptional regulatory elements. (A) POP nucleotide sequence depicting the consensus sequence for

More information

Won Jung, Seung Min An, Whaseon Lee-Kwon, Mario Chiong1, Sergio Lavandero1,2, and Hyug

Won Jung, Seung Min An, Whaseon Lee-Kwon, Mario Chiong1, Sergio Lavandero1,2, and Hyug Supplementry Informtion suppresses IL-1-medited immunomodultion Soo Youn Choi, Hwn Hee Lee, Jun Ho Lee, Byeong Jin Ye, Eun Jin Yoo, Hyun Je Kng, Gyu Won Jung, Seung Min An, Whseon Lee-Kwon, Mrio Chiong1,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:1.138/nture1371 As Brc11 (null) Brc5-13cK (conditioned llele) Reltive levels of mrna d C 1.2 1.8.6.4.2 Cereellum Ec Ev Ev As KO c Frequency Thymus KO KO 1 neo 11 Ec As 4 loxp

More information

Receptor Revision Diminishes the Autoreactive B Cell Response after Antigen. PNA Tet. Day 8. Day 16

Receptor Revision Diminishes the Autoreactive B Cell Response after Antigen. PNA Tet. Day 8. Day 16 Receptor Revision Diminishes the Autoreactive Cell Response after Antigen Activation Ying-Hua Wang and etty Diamond Supplemental data: PNA Tet 5 8 11 16 Supplemental Figure 1: Kinetic analysis of tetramer-binding

More information

DC enriched CD103. CD11b. CD11c. Spleen. DC enriched. CD11c. DC enriched. CD11c MLN

DC enriched CD103. CD11b. CD11c. Spleen. DC enriched. CD11c. DC enriched. CD11c MLN CD CD11 + CD + CD11 d g CD CD11 + CD + CD11 CD + CD11 + Events (% of max) Events (% of max) CD + CD11 Events (% of max) Spleen CLN MLN Irf fl/fl e Irf fl/fl h Irf fl/fl DC enriched CD CD11 Spleen DC enriched

More information

Evaluation of Winter Canola Grown in 30 inch Rows

Evaluation of Winter Canola Grown in 30 inch Rows Evlution of Winter Cnol Grown in 3 inch Rows Chd Godsey, Oilseed Cropping Systems Specilist Pst reserch in Oklhom hs indicted tht yield potentil my decrese from to 1% when cnol is grown in 3 inch rows,

More information

Supplementary Material

Supplementary Material Supplementry Mteril Kineticlly-controlled Synthesis of LiNi 0.5 Mn 1.5 O 4 Micro/nno-structured Hollow Spheres s High-rte Cthode Mterils for Lithium Ion Btteries Sheng Li, Guo M, Bing Guo, Zeheng Yng,

More information

Supplementary Materials

Supplementary Materials Supplementry Mterils Supplementry Figure 1 Supplementry Figure 2 in Fh deficient mice. Supplementry Figure 3 Supplementry Figure 4 Supplementry Figure 5 Supplementry Figure 6 Supplementry Figure 7 Supplementry

More information

Nature Immunology: doi: /ni Supplementary Figure 1

Nature Immunology: doi: /ni Supplementary Figure 1 Supplementary Figure 1 PPAR-γ is dispensable for the development of tissue macrophages in the heart, kidneys, lamina propria and white adipose tissue. Plots show the expression of F4/80 and CD11b (a) or

More information

Nature Immunology: doi: /ni.3694

Nature Immunology: doi: /ni.3694 Supplementary Figure 1 Expression of Bhlhe41 and Bhlhe40 in B cell development and mature B cell subsets. (a) Scatter plot showing differential expression of genes between splenic B-1a cells and follicular

More information

Supplementary Figure 1. A TRPC5-like channel in the neurites and somata of aortic baroreceptor neurons.

Supplementary Figure 1. A TRPC5-like channel in the neurites and somata of aortic baroreceptor neurons. Supplementl Figure 1 c d e f Supplementry Figure 1. A TRPC5-like chnnel in the neurites nd somt of ortic roreceptor neurons. Cell-ttched ptch recordings from the neurite terminls (-c) nd the somt (d-f)

More information

Supplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM

Supplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM Supplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM of Cx3cr1 GFP/+ mice related to Fig. 1a. MDP was defined

More information

Crystallization Time (min) PCL block. PCL homopolymer. Crystallization Time (min)

Crystallization Time (min) PCL block. PCL homopolymer. Crystallization Time (min) Figure S-1 Crystllinity of PCL Chins.4.3.2.1 2 PCL homopolymer T c = -54 o C D = 13. nm PCL lock 4 6 8 1 Crystlliztion Time (min) Crystllinity of PCL Chins.4.3.2.1 PCL lock PCL homopolymer T c = -45 o

More information

Supplementary Figure S1

Supplementary Figure S1 Supplementary Figure S1 Supplementary Figure S1. CD11b expression on different B cell subsets in anti-snrnp Ig Tg mice. (a) Highly purified follicular (FO) and marginal zone (MZ) B cells were sorted from

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:.38/nture59 lmd phosphtse Okdic cid h COS7 SHSY5Y Clf lkline phosphtse Mouse rin c lmd phosphtse Okdic cid h 3P IB () COS7 Supplementry Figure is phosphoprotein., Okdic cid

More information

Title: SUPPLEMENTARY INFORMATION. Gradient Confinement Induced Uniform Tensile Ductility in Metallic Glass

Title: SUPPLEMENTARY INFORMATION. Gradient Confinement Induced Uniform Tensile Ductility in Metallic Glass SUPPLEMENTARY INFORMATION Title: Grdient Confinement Induced Uniform Tensile Ductility in Metllic Glss X.L. Lu 1, Q.H. Lu 1, Y. Li* 1,2 nd L. Lu* 1 1 Shenyng Ntionl Lortory for Mterils Science, Institute

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature12474 Supplementary Figure 1 Analysis of mtdna mutation loads in different types of mtdna mutator mice. a, PCR, cloning, and sequencing analysis of mtdna mutations

More information

Crop Performance and Plant Microbe-Interactions are Affected by the Sequence and Frequency of Pulse Crops in the Canadian Prairie

Crop Performance and Plant Microbe-Interactions are Affected by the Sequence and Frequency of Pulse Crops in the Canadian Prairie Crop Performnce nd Plnt Microbe-Interctions re Affected by the Sequence nd Frequency of Pulse Crops in the Cndin Pririe Nvrro-Borrell A 1,2 ; Di M 2 ; Hmel C 1,2 ; Fernndez MR 2 ; Gn Y 2 ; Germid J 1.

More information

Supplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating

Supplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating Supplemental Figure Legend: Supplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating strategy for mouse MDSC. CD11b + Ly6C high Ly6G - cells are defined as M-MDSC. CD11b + Ly6C low

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION NCS (ng/ml) Time (min) kd 500 500 0 30 0 30 IP: IP: 112 105 75 IB: ps407 IB: Mdm2 NCS + + IB: IB: tuulin IP input sup NCS (ng/ml) 50 100 500 Time (min) 0 15 30 60 120 15 30 60 120 15 30 60 120 IB: ps407

More information

Food Arthropod Abundance Associated with Rest-Rotation Livestock Grazing. Hayes B. Goosey. Department of Animal and Range Sciences

Food Arthropod Abundance Associated with Rest-Rotation Livestock Grazing. Hayes B. Goosey. Department of Animal and Range Sciences Food Arthropod Aundnce Associted with Rest-Rottion Livestock Grzing Hyes B. Goosey Deprtment of Animl nd Rnge Sciences Montn Stte University We hve completed the second seson of investigtion into the response

More information

supplementary information

supplementary information DOI: 10.1038/nc2014 SM/C-2.6(-) CD31, CD45, SM/C-2.6 PDGFRα CD13 36.1 CD29 91.6 CD34 30.4 CD90 65.7 CXCR4 1.3 c-kit 0.1 Sc-1 86.4 Integrin α7 0.1 PDGFRα PDGFRα(-)SM/C-2.6(+) CD31, CD45, PDGFRα SM/C-2.6

More information

COS-1 cells transiently transfected with either HA hgr wt, HA hgr S211A or HA hgr S226A

COS-1 cells transiently transfected with either HA hgr wt, HA hgr S211A or HA hgr S226A 1 SUPPLEMENTRY FIGURES Fig. 1 & Specificity of the nti-p-s211 nd nti-p-s226 ntibodies COS-1 cells trnsiently trnsfected with either H hgr wt, H hgr S211 or H hgr S226 were treted with 1nM Dex for 1 hour.

More information

Distribution of human ILCs during chronic lung disease.

Distribution of human ILCs during chronic lung disease. Supplementary Figure 1 Distribution of human ILCs during chronic lung disease. Quantification of flow cytometric analysis of lung tissue from patients with COPD or IPF identifying (a) frequencies of total

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10772 Supplementary Figures: Supplementary Figure 1. Location of CNS1 within of the Foxp3 locus highlighting CNS1 and indicating transcription factor binding motifs downstream of TCR,

More information

Organic Cover Crop Research at WSU Puyallup

Organic Cover Crop Research at WSU Puyallup Orgnic Cover Crop Reserch t WSU Puyllup Ferury 8 Crig Cogger, Andy Bry, nd Liz Myhre Wshington Stte University Puyllup Reserch nd Extension Center Astrct: Cover crops re loclly grown source of orgnic mtter

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:.8/nture99 Supplementry Tle : Primers nd proes. Sequences re written in 5 - direction. Vector construction cirs-7 forwrd cirs-7 reverse cirs-7ir forwrd cirs-7ir reverse cirs-7fs

More information

SEEDING CLOVERS OR GRASSES INTO OLDER ALFALFA BENEFITS AND HAZARDS ABSTRACT INTRODUCTION

SEEDING CLOVERS OR GRASSES INTO OLDER ALFALFA BENEFITS AND HAZARDS ABSTRACT INTRODUCTION SEEDING CLOVERS OR GRASSES INTO OLDER ALFALFA BENEFITS AND HAZARDS STANDS- Mick Cnevri1, Dn Putnm2, Brbr Reed3, Rchel Long4, Steve Orlo~, Tom Lnini6, nd Lrry Godfrey7 ABSTRACT Deciding wht to do with n

More information

Supplementary Figure 1 Generation of migg1-yf mice. (A) Targeting strategy. Upper panel: schematic organization of the murine ɣ1 immunoglobulin

Supplementary Figure 1 Generation of migg1-yf mice. (A) Targeting strategy. Upper panel: schematic organization of the murine ɣ1 immunoglobulin Supplementary Figure 1 Generation of migg1-yf mice. (A) Targeting strategy. Upper panel: schematic organization of the murine ɣ1 immunoglobulin locus. The EcoRI restriction site between exons M1 and M2

More information

CONSERVATION TILLAGE IMPROVES SOIL PHYSICAL PROPERTIES ON DIFFERENT LANDSCAPE POSITIONS OF A COASTAL PLAIN SOIL.

CONSERVATION TILLAGE IMPROVES SOIL PHYSICAL PROPERTIES ON DIFFERENT LANDSCAPE POSITIONS OF A COASTAL PLAIN SOIL. CONSERVATION TILLAGE IMPROVES SOIL PHYSICAL PROPERTIES ON DIFFERENT LANDSCAPE POSITIONS OF A COASTAL PLAIN SOIL Frncisco J. Arrig* 1, Andre S. Biscro 2, Kipling S. Blkcom 1, Joey N. Shw 3, Edzrd vn Snten

More information

isolated from ctr and pictreated mice. Activation of effector CD4 +

isolated from ctr and pictreated mice. Activation of effector CD4 + Supplementary Figure 1 Bystander inflammation conditioned T reg cells have normal functional suppressive activity and ex vivo phenotype. WT Balb/c mice were treated with polyi:c (pic) or PBS (ctr) via

More information

Flow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences).

Flow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences). Mice C57BL/6-Ly5.1 or -Ly5.2 congenic mice were used for LSK transduction and competitive repopulation assays. Animal care was in accordance with the guidelines of Keio University for animal and recombinant

More information

HeLa. CaSki. Supplementary Figure 1. Validation of the NKX6.1 expression in mrna level and

HeLa. CaSki. Supplementary Figure 1. Validation of the NKX6.1 expression in mrna level and Supplementry Figure. Li et l. Reltive expression ( / GAPDH ) 6 5 4 3 2 5 Reltive expression ( / GAPDH ) 4 3 2 Reltive expression ( / GAPDH ) 4 3 2 Reltive expression ( / GAPDH ) 4 3 2 Ve S Ve S2 S S2 Ve

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figure 1. Defective T and B cell lineage development in the absence of 53BP1. a, Average number of thymocytes in WT, 53BP1 /, p53 /, 53BP1 / / p53, Nbs1 tr735 and 53BP1 / Nbs1 tr735 mice

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:.38/nture965 footprinting deep-sequencing Supplementry Figure. Schemtic of riosome profiling experiment for quntifiction of riosome occupncy long mrna. The protocol for cteril riosome profiling with

More information

Jay S Desgrosellier, Leo A Barnes, David J Shields, Miller Huang, Steven K Lau, Nicolas Prévost, David Tarin, Sanford J Shattil and David A Cheresh

Jay S Desgrosellier, Leo A Barnes, David J Shields, Miller Huang, Steven K Lau, Nicolas Prévost, David Tarin, Sanford J Shattil and David A Cheresh Integrin αvβ3/c-src Oncogenic Unit Promotes Anchorge-independence nd Tumor Progression Jy S Desgrosellier, Leo A Brnes, Dvid J Shields, Miller Hung, Steven K Lu, Nicols Prévost, Dvid Trin, Snford J Shttil

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/4/9/eaat5401/dc1 Supplementary Materials for GLK-IKKβ signaling induces dimerization and translocation of the AhR-RORγt complex in IL-17A induction and autoimmune

More information

Tetrad analysis. Life cycle and meiosis in yeast. Fig.1. Life cycle of yeast

Tetrad analysis. Life cycle and meiosis in yeast. Fig.1. Life cycle of yeast Tetrd nysis Tetrd nysis in genetics refers to nysis of four products formed from meiosis. In orgnisms like yest the tetrd contins four spores while in cse of Neurospor the scus in which products of meiosis

More information

Supplemental Information The Sensing of Environmental Stimuli by Follicular Dendritic Cells Promotes Immunoglobulin A Generation in the Gut

Supplemental Information The Sensing of Environmental Stimuli by Follicular Dendritic Cells Promotes Immunoglobulin A Generation in the Gut Immunity, Volume 33 Supplemental Information The Sensing of Environmental Stimuli by Follicular Dendritic Cells Promotes Immunoglobulin A Generation in the Gut Keiichiro Suzuki, Mikako Maruya, Shimpei

More information

Population Distribution

Population Distribution Nme: Period: Why? Popultion Distriution How does popultion distriution ffect the environment? Alsk contins over 127 million cres of untouched forest lnd. It is the lrgest stte in the United Sttes, yet

More information

Evaluation of Corn Varieties for Certified Organic Production Crawfordsville Trial, 1998

Evaluation of Corn Varieties for Certified Organic Production Crawfordsville Trial, 1998 Evlution of Corn Vrieties for Certified Orgnic Production Crwfordsville Tril, 1998 Dr. Kthleen Delte, ssistnt professor, Depts. of Horticulture & Agronomy Kevin Vn Dee, frm superintendent, Southest Reserch

More information

Bridge or Barrier? The Role of Transportation in Visiting National Parks by Racial/Ethnic Minorities

Bridge or Barrier? The Role of Transportation in Visiting National Parks by Racial/Ethnic Minorities Bridge or Brrier? The Role of Trnsporttion in Visiting Ntionl Prks by Rcil/Ethnic Minorities Elizbeth Perry 1, Xio Xio 1,2, Robert Mnning 1, nd Dniel Krymkowski 3 1 Rubenstein School Prk Studies Lb, UVM

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting.

Nature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting. Supplementary Figure 1 Zranb1 gene targeting. (a) Schematic picture of Zranb1 gene targeting using an FRT-LoxP vector, showing the first 6 exons of Zranb1 gene (exons 7-9 are not shown). Targeted mice

More information

Tumour 2. Tumour 9. Tumour 25 Tumour 26. Tumour 27. t(6;16) doi: /nature06159 SUPPLEMENTARY INFORMATION Supplementary Figure 1

Tumour 2. Tumour 9. Tumour 25 Tumour 26. Tumour 27. t(6;16) doi: /nature06159 SUPPLEMENTARY INFORMATION Supplementary Figure 1 doi: 1.18/nature6159 SUPPLEMENTARY INFORMATION Supplementary Figure 1 Tumour Tumour 9 t(6;16) Tumour 5 Tumour 6 Tumour 7 www.nature.com/nature 1 doi: 1.18/nature6159 SUPPLEMENTARY INFORMATION Supplementary

More information

Report to the Southwest Florida Water Management District. Effects of Microsprinkler Irrigation Coverage on Citrus Performance

Report to the Southwest Florida Water Management District. Effects of Microsprinkler Irrigation Coverage on Citrus Performance Report to the Southwest Florid Wter Mngement District Effects of Microsprinkler Irrigtion Coverge on Citrus Performnce L. R. Prsons University of Florid Institute of Food nd Agriculturl Sciences Citrus

More information

High-Performance, Robust Metal Nanotrough-Embedded Transparent Conducting Film for Wearable Touch Screen Panel Application

High-Performance, Robust Metal Nanotrough-Embedded Transparent Conducting Film for Wearable Touch Screen Panel Application Electronic Supplementry Mteril (ESI) for Nnoscle. This journl is The Royl Society of Chemistry 216 Supporting Informtion High-Performnce, Roust Metl Nnotrough-Emedded Trnsprent Conducting Film for Werle

More information

Soybean Fungicide and Insecticide Seed Treatments (2006 Final Report)

Soybean Fungicide and Insecticide Seed Treatments (2006 Final Report) Soyen Fungicide nd Iecticide Seed Tretments (2006 Finl Report) Purpose: The ojective of this study ws to investigte new iecticide seed tretments for soye. Cruiser ws registered recently nd Gucho hs yet

More information

Endothelial Apelin-FGF Link Mediated by MicroRNAs 424 and 503 is Disrupted in Pulmonary Arterial Hypertension

Endothelial Apelin-FGF Link Mediated by MicroRNAs 424 and 503 is Disrupted in Pulmonary Arterial Hypertension Endothelil Apelin-FGF Link Medited y MicroRNAs 424 nd 53 is Disrupted in Pulmonry Arteril Hypertension Jongmin Kim, Yujung Kng, Yoko Kojim, Jnet K. Lighthouse, Xioyue Hu, Michel A. Aldred, Dnielle L. McLen,

More information

WesternBright TM MCF and MCF-IR

WesternBright TM MCF and MCF-IR WesternBright TM MCF nd MCF-IR Quntittive, multi-color fluorescent Western lotting kits WesternBright MCF visile nd ner infrred (IR) fluorescent Western lotting kits llow the ssy of two proteins t once,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION BRC repet RPA DSB RAD52 DSB Repir doi:1.138/nture9399 Gp Repir ssdna/dsdna junction ssdna/dsdna junction RPA Binding Resection RPA Binding Filment Formtion or or Filment Formtion DNA Piring DNA Piring

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Construction of lnckdm2b RFP reporter and lnckdm2b-knockout mice.

Nature Immunology: doi: /ni Supplementary Figure 1. Construction of lnckdm2b RFP reporter and lnckdm2b-knockout mice. Supplementary Figure 1 Construction of lnckdm2b RFP reporter and lnckdm2b-knockout mice. (a) ILC3s (Lin CD45 lo CD90 hi ) were isolated from small intestines, followed by immunofluorescence staining. LncKdm2b

More information

Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using

Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using Supplementary Methods Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using the Qiagen RNeasy Mini Kit, according to the manufacturer s protocol with on-column DNase digestion

More information

Economic Profitability and Sustainability of Canola Production Systems in Western Canada

Economic Profitability and Sustainability of Canola Production Systems in Western Canada Economic Profitility nd Sustinility of Cnol Production Systems in Western Cnd Elwin Smith, R. Blckshw, Agriculture nd Agri-Food Cnd (AAFC), Lethridge, AB, N. Hrker, J. O'Donovn, AAFC Lcome AB, S. Brndt,

More information

a Lamtor1 (gene) b Lamtor1 (mrna) c WT Lamtor1 Lamtor1 flox Lamtor2 A.U. p = LysM-Cre Lamtor3 Lamtor4 Lamtor5 BMDMs: Φ WT Φ KO β-actin WT BMDMs

a Lamtor1 (gene) b Lamtor1 (mrna) c WT Lamtor1 Lamtor1 flox Lamtor2 A.U. p = LysM-Cre Lamtor3 Lamtor4 Lamtor5 BMDMs: Φ WT Φ KO β-actin WT BMDMs a Lamtor (gene) b Lamtor (mrna) c BMDMs: Φ WT Φ KO Lamtor flox 8 bp LysM-Cre 93 bp..5 p =.4 WT BMDMs: Φ WT Φ KO Lamtor (protein) BMDMs: Φ WT Φ KO Lamtor 8 kda Lamtor 4 kda Lamtor3 4 kda Lamtor4 kda Lamtor5.5

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/1/494/eaak972/dc1 Supplementary Materials for Blockade of surface-bound TGF-β on regulatory T cells abrogates suppression of effector T cell function in the tumor

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 1.138/nc3386 β-ctin (S) (A) - - - TGN46 116 kd 97 45 level (% of ) 1 8 6 4 2 EEA1 (S) (A) c 1 Reltive mrna levels normlized to β-ctin 8 6 4 2 TFEB KD MCOLN1 KD PI4KIIIβ KD PIP5K1α KD PIP5K1β KD VPS

More information

Supplementary Figure 1 Caspase-8 deficient platelets respond normally to agonists and ABT-737 (A) Surface expression of GPIX, GPIb, GPVI and CD41

Supplementary Figure 1 Caspase-8 deficient platelets respond normally to agonists and ABT-737 (A) Surface expression of GPIX, GPIb, GPVI and CD41 Supplementary Figure 1 Caspase-8 deficient platelets respond normally to agonists and ABT-737 (A) Surface expression of GPIX, GPIb, GPVI and CD41 were assessed on purified platelets from Casp8 fl/fl and

More information