From Gene to Protein
|
|
- Cleopatra Harrison
- 6 years ago
- Views:
Transcription
1 From Gene to Protein
2 Protein Synthesis: overview One gene-one enzyme hypothesis (Bedle nd Ttum) One gene-one polypeptide (protein) hypothesis Trnscription: synthesis of RNA under the direction of DNA (mrna) Trnsltion: ctul synthesis of polypeptide under the direction of mrna
3 The Centrl Dogm Flow of genetic informtion in cell How do we move informtion from DNA to proteins? DNA RNA protein trit repliction
4 From gene to protein nucleus DNA trnscription cytoplsm mrna trnsltion ribosome protein trit
5 Trnscription from DNA nucleic cid lnguge to RNA nucleic cid lnguge
6 RNA ribose sugr N-bses urcil insted of thymine U : A C : G single strnded lots of RNAs mrna, trna, rrna, sirna DNA trnscription RNA
7 Trnscription Mking mrna trnscribed DNA strnd = templte strnd untrnscribed DNA strnd = coding strnd sme sequence s RNA synthesis of complementry RNA strnd trnscription bubble enzyme RNA polymerse coding strnd 5 DNA C G 3 A G A T T C T A rewinding G C T A G G C C C G A A T T U A C C G G G C T U A A 3 T T A C G A C T A G T A T unwinding 3 5 build RNA 5 3 mrna 5 RNA polymerse templte strnd
8 RNA polymerses 3 RNA polymerse enzymes RNA polymerse 1 only trnscribes rrna genes mkes ribosomes RNA polymerse 2 trnscribes genes into mrna RNA polymerse 3 only trnscribes trna genes ech hs specific promoter sequence it recognizes
9 Which gene is red? Promoter region binding site before beginning of gene TATA box binding site binding site for RNA polymerse & trnscription fctors Enhncer region binding site fr upstrem of gene turns trnscription on HIGH
10 Trnscription Fctors Initition complex trnscription fctors bind to promoter region suite of proteins which bind to DNA hormones? turn on or off trnscription trigger the binding of RNA polymerse to DNA
11 Mtching bses of DNA & RNA Mtch RNA bses to DNA bses on one of the DNA strnds U G U C C G A A U A G A C U 5' A A C C RNA 3' G polymerse G C A G U A U C T G G T A C A G C T A G T C A T C G T A C C G T
12 Trnscription: the process 1.Initition~ trnscription fctors medite the binding of RNA polymerse to n initition sequence (TATA box) 2.Elongtion~ RNA polymerse continues unwinding DNA nd dding nucleotides to the 3 end 3.Termintion~ RNA polymerse reches termintor sequence
13 Eukryotic genes hve junk! Eukryotic genes re not continuous exons = the rel gene expressed / coding DNA introns = the junk inbetween sequence intron = noncoding (inbetween) sequence eukryotic DNA exon = coding (expressed) sequence
14 mrna splicing Post-trnscriptionl processing eukryotic mrna needs work fter trnscription primry trnscript = pre-mrna mrna splicing edit out introns mke mture mrna trnscript eukryotic DNA primry mrna trnscript mture mrna trnscript intron = noncoding (inbetween) sequence ~10,000 bse exon = coding (expressed) sequence pre-mrna ~1,000 bse spliced mrna
15 Discovery of exons/introns Richrd Roberts CSHL Philip Shrp MIT denovirus common cold bet-thlssemi
16 Splicing must be ccurte No room for mistkes! single bse dded or lost throws off the reding frme AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG CGG UCC GAU AAG GGC CAU Met Arg Ser Asp Lys Gly His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG CGG GUC CGA UAA GGG CCA U Met Arg Vl Arg STOP
17 RNA splicing enzymes snrnps smll nucler RNA proteins Spliceosome severl snrnps recognize splice site sequence cut & pste gene snrna snrnps exon intron exon 5' 3' spliceosome 5' 3' lrit 5' 3' exon mture mrna 5' exon 3' excised intron
18 Alterntive splicing Alterntive mrnas produced from sme gene when is n intron not n intron different segments treted s exons
19 More post-trnscriptionl processing Need to protect mrna on its trip from nucleus to cytoplsm enzymes in cytoplsm ttck mrna protect the ends of the molecule dd 5 GTP cp dd poly-a til longer til, mrna lsts longer: produces more protein
20 From gene to protein nucleus DNA trnscription cytoplsm mrna trnsltion ribosome protein trit
21 Trnsltion from nucleic cid lnguge to mino cid lnguge
22 How does mrna code for proteins? DNA 4 ATCG TACGCACATTTACGTACGCGG mrna 4 AUCG AUGCGUGUAAAUGCAUGCGCC? protein 20 Met Arg Vl Asn Al Cys Al How cn you code for 20 mino cids with only 4 nucleotide bses (A,U,G,C)?
23 mrna codes for proteins in triplets DNA mrna TACGCACATTTACGTACGCGG codon AUGCGUGUAAAUGCAUGCGCC? protein Met Arg Vl Asn Al Cys Al
24 Crcking the code Crick determined 3-letter (triplet) codon system Nirenberg & Khorn WHYDIDTHEREDBATEATTHEFATRAT n Nirenberg (47) & Khorn (17) u determined mrna mino cid mtch u dded fbricted mrna to test tube of ribosomes, trna & mino cids n creted rtificil UUUUU mrna n found tht UUU coded for phenyllnine
25 Mrshll Nirenberg Hr Khorn
26 The code Code for ALL life! strongest support for common origin for ll life Code is redundnt severl codons for ech mino cid 3rd bse wobble n n Strt codon u u AUG methionine Stop codons u UGA, UAA, UAG
27 How re the codons mtched to mino cids? DNA mrna trna mino cid 3 5 TACGCACATTTACGTACGCGG 5 3 AUGCGUGUAAAUGCAUGCGCC 3 5 UAC Met GCA Arg CAU Vl codon nti-codon
28 From gene to protein nucleus DNA trnscription cytoplsm mrna trnsltion ribosome protein trit
29 Trnsfer RNA structure Clover lef structure nticodon on clover lef end mino cid ttched on 3 end
30 Loding trna Aminocyl trna synthetse enzyme which bonds mino cid to trna bond requires energy ATP AMP bond is unstble so it cn relese mino cid t ribosome esily ctivting enzyme Trp C=O Trp C=O Trp H 2 O OH OH O O trna Trp nticodon tryptophn ttched to trna Trp A C C U G G trna Trp binds to UGG condon of mrna mrna
31 Ribosomes Fcilitte coupling of trna nticodon to mrna codon orgnelle or enzyme? Structure ribosoml RNA (rrna) & proteins 2 subunits lrge smll E P A
32 Ribosomes A site (minocyl-trna site) holds trna crrying next mino cid to be dded to chin P site (peptidyl-trna site) holds trna crrying growing polypeptide chin E site (exit site) empty trna leves ribosome from exit site Met 5' E U A C A U G P A 3'
33 Building polypeptide Initition brings together mrna, ribosome subunits, inititor trna Elongtion dding mino cids bsed on codon sequence Termintion end codon Met Leu Met Met Met Leu Leu Leu Vl Ser Al Trp relese fctor trna 5' 5' UA C GAC UAC UAC GAC AA C AAU 5' AUG C UG AAU 5' mrna A UG C UG U 3' AUG UG 3' 3' E P A UAC GAC C AA U AUG UG 3' A CC U GG UA A 3'
34 Destintions: Protein trgeting n secretion n nucleus Signl peptide n mitochondri ddress lbel n chloroplsts n cell membrne n cytoplsm n strt of secretory pthwy etc
35 DNA RNA polymerse Cn you tell the story? pre-mrna exon intron 5' GTP cp mino cids trna lrge ribosoml subunit mture mrna poly-a til minocyl trna synthetse 3' polypeptide 5' smll ribosoml subunit E P A trna ribosome
36 Prokryote vs. Eukryote genes Prokryotes DNA in cytoplsm circulr chromosome nked DNA no introns Eukryotes DNA in nucleus liner chromosomes DNA wound on histone proteins introns vs. exons eukryotic DNA intron = noncoding (inbetween) sequence exon = coding (expressed) sequence
37 Trnsltion in Prokryotes Trnscription & trnsltion re simultneous in bcteri DNA is in cytoplsm no mrna editing ribosomes red mrna s it is being trnscribed
38 Trnsltion: prokryotes vs. eukryotes Differences between prokryotes & eukryotes time & physicl seprtion between processes tkes eukryote ~1 hour from DNA to protein no RNA processing
What do genes code for?
From ene to Protein How enes Work 2007-2008 Wht do genes code for? How does code for cells & bodies? how re cells nd bodies mde from the instructions in proteins cells bodies he entrl Dogm Flow of genetic
More informationFrom Gene to Protein
From Gene to Protein Protein Synthesis: overview One gene-one enzyme hypothesis (Bedle nd Ttum) One gene-one polypeptide (protein) hypothesis Trnscription: synthesis of RNA under the direction of DNA (mrna)
More informationFrom Gene to Protein. How Genes Work
From Gene to Protein How Genes Work 2007-2008 Wht do genes code for? How does DNA code for cells & bodies? how re cells nd bodies mde from the instructions in DNA DNA proteins cells bodies The Centrl Dogm
More informationWhat do genes code for? The Central Dogma. From gene to protein DNA. protein. trait RNA. Transcription 1/9/2015. From Gene to Protein.
Wht do genes code for? From ene to rotein How does code for cells & bodies? how re cells nd bodies mde from the instructions in How enes Work s cells bodies he entrl Dogm Flow of genetic informtion in
More informationFrom Gene to Protein. How Genes Work (Ch. 17)
From Gene to Protein How Genes Work (Ch. 17) What do genes code for? How does DNA code for cells & bodies? how are cells and bodies made from the instructions in DNA DNA proteins cells bodies The Central
More informationFrom Gene to Protein. How Genes Work
From Gene to Protein How Genes Work 2007-2008 The Central Dogma Flow of genetic information in a cell How do we move information from DNA to proteins? DNA RNA protein replication phenotype You! Step 1:
More informationFrom DNA to Protein. Chapter 14
From DNA to Protein Chapter 14 What do genes code for? How does DNA code for cells & bodies? How are cells and bodies made from the instructions in DNA? DNA proteins cells bodies The Central Dogma Flow
More informationFrom Gene to Protein: How Genes Work. AP Biology
From ene to Protein: How enes Work How does single fulty gene result in the drmtic ppernce of n lbino deer nd rcoon? ene expression, the process by which DN directs protein synthesis, includes two stges:
More informationChapter 17. From Gene to Protein. AP Biology
Chapter 17. From Gene to Protein Metabolism teaches us about genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton) PKU (phenylketonuria)
More informationCh. 10 From DNA to Protein. AP Biology
Ch. 10 From DNA to Protein Protein Synthesis Metabolism and Gene Expression n Inheritance of metabolic diseases suggests that genes coded for enzymes n Diseases (phenotypes) caused by non-functional gene
More informationCH 17 :From Gene to Protein
CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there
More informationAP Biology
Chapter 17. From Gene to Protein Metabolism teaches us about genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton) PKU (phenylketonuria)
More informationFrom Genes to Protein
From Genes to Protein Transcription and Translation Metabolism Teaches Us About Genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from
More information1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation
1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous
More informationFrom Genes to Protein
From Genes to Protein Transcription and Translation Metabolism Teaches Us About Genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from
More informationProtein Synthesis Making Proteins
Protein Synthesis Making Proteins 2009-2010 Bodies Cells DNA Bodies are made up of cells All cells run on a set of instructions spelled out in DNA DNA Cells Bodies How does DNA code for cells & bodies?
More informationDegenerate Code. Translation. trna. The Code is Degenerate trna / Proofreading Ribosomes Translation Mechanism
Translation The Code is Degenerate trna / Proofreading Ribosomes Translation Mechanism Degenerate Code There are 64 possible codon triplets There are 20 naturally-encoding amino acids Several codons specify
More informationDNA is the MASTER PLAN. RNA is the BLUEPRINT of the Master Plan
Sec. 12-3 RNA and Protein Synthesis Roles of DNA and RNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 1 RNA uses the information from DNA to make proteins Differs from DNA: 1. Ribose
More informationProtein Synthesis Making Proteins
Protein Synthesis Making Proteins 2009-2010 Bodies Cells DNA Bodies are made up of cells All cells run on a set of instructions spelled out in DNA DNA Cells Bodies How does DNA code for cells & bodies?
More informationBiomolecules: lecture 6
Biomolecules: lecture 6 - to learn the basics on how DNA serves to make RNA = transcription - to learn how the genetic code instructs protein synthesis - to learn the basics on how proteins are synthesized
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationHuman Gene,cs 06: Gene Expression. Diversity of cell types. How do cells become different? 9/19/11. neuron
Human Gene,cs 06: Gene Expression 20110920 Diversity of cell types neuron How do cells become different? A. Each type of cell has different DNA in its nucleus B. Each cell has different genes C. Each type
More informationChapter 14 From Gene to Protein
Chapter 14 From Gene to Protein Metabolim Teache U About Gene Metabolic defect tudying metabolic dieae uggeted that gene pecified protein alkaptonuria (black urine from alkapton a.k.a. homogentiic acid
More information6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA
6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA DNA mrna Protein DNA is found in the nucleus, but making a protein occurs at the ribosome
More informationDNA Replication and Repair
DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands
More informationBiomolecules: lecture 6
Biomolecules: lecture 6 - to learn the basics on how DNA serves to make RNA = transcription - to learn how the genetic code instructs protein synthesis - to learn the basics on how proteins are synthesized
More informationDNA, RNA, and PROTEIN SYNTHESIS
DNA, RNA, and PROTEIN SYNTHESIS 1 DNA DNA contains genes, sequences of nucleotide bases The genes code for polypeptides (proteins) Proteins are used to build cells and do much of the work inside cells
More informationProtein Synthesis Honors Biology
Protein Synthesis What do we know? Metabolism is controlled by enzymes enzymes are proteins DNA contains the genetic information to build proteins. DNA is only in the nucleus. Ribosomes are not. How then
More informationGene Expression: Transcription, Translation, RNAs and the Genetic Code
Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationChapter 17 From Gene to Protein
Chapter 17 From Gene to Protein Question? How does DNA control a cell? By controlling Protein Synthesis. Proteins are the link between genotype and phenotype. For tests: Name(s) of experimenters Outline
More informationProtein Synthesis: Transcription and Translation
Review Protein Synthesis: Transcription and Translation Central Dogma of Molecular Biology Protein synthesis requires two steps: transcription and translation. DNA contains codes Three bases in DNA code
More informationChapter 17 From Gene to Protein
Chapter 17 From Gene to Protein Describe the structure of DNA. What is its elemental makeup? Name the subunit that makes up DNA. What components make up the DNA molecule? How are the two strands related
More informationGene function at the level of traits Gene function at the molecular level
Gene expression Gene function at the level of traits Gene function at the molecular level Two levels tied together since the molecular level affects the structure and function of cells which determines
More informationBioinformatics CSM17 Week 6: DNA, RNA and Proteins
Bioinformatics CSM17 Week 6: DNA, RNA and Proteins Transcription (reading the DNA template) Translation (RNA -> protein) Protein Structure Transcription - reading the data enzyme - transcriptase gene opens
More informationKey Area 1.3: Gene Expression
Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?
More informationRNA and PROTEIN SYNTHESIS. Chapter 13
RNA and PROTEIN SYNTHESIS Chapter 13 DNA Double stranded Thymine Sugar is RNA Single stranded Uracil Sugar is Ribose Deoxyribose Types of RNA 1. Messenger RNA (mrna) Carries copies of instructions from
More informationChapter Twelve Protein Synthesis: Translation of the Genetic Message
Mary K. Campbell Shawn O. Farrell international.cengage.com/ Chapter Twelve Protein Synthesis: Translation of the Genetic Message Paul D. Adams University of Arkansas 1 Translating the Genetic Message
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationDaily Agenda. Warm Up: Review. Translation Notes Protein Synthesis Practice. Redos
Daily Agenda Warm Up: Review Translation Notes Protein Synthesis Practice Redos 1. What is DNA Replication? 2. Where does DNA Replication take place? 3. Replicate this strand of DNA into complimentary
More informationProtein Synthesis. Application Based Questions
Protein Synthesis Application Based Questions MRNA Triplet Codons Note: Logic behind the single letter abbreviations can be found at: http://www.biology.arizona.edu/biochemistry/problem_sets/aa/dayhoff.html
More informationChapter 17. From Gene to Protein
Chapter 17 From Gene to Protein One Gene One Enzyme Hypothesis Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria Beadle
More informationI. Gene Expression Figure 1: Central Dogma of Molecular Biology
I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases
More informationFROM GENE TO PROTEIN. One Gene One Enzyme Hypothesis 3/12/2013. Basic Principles of Transcription & Translation
One Gene One Enzyme Hypothesis FROM GENE TO PROTEIN C H A P T E R 1 7 Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria
More informationLecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
More informationLevel 2 Biology, 2017
91159 911590 2SUPERVISOR S Level 2 Biology, 2017 91159 Demonstrate understanding of gene expression 2.00 p.m. Wednesday 22 November 2017 Credits: Four Achievement Achievement with Merit Achievement with
More informationChapter 14. How many genes? Control of Eukaryotic Genome. Repetitive DNA. What about the rest of the DNA? Fragile X Syndrome
Chapter 14 Control of Eukaryotic Genome How many genes? Genes only ~3% of human genome protein-coding sequences 1% of human genome non-protein coding genes 2% of human genome trna ribosomal RNAs sirnas
More informationHonors packet Instructions
Honors packet Instructions The following are guidelines in order for you to receive FULL credit for this bio packet: 1. Read and take notes on the packet in full 2. Answer the multiple choice questions
More informationProtein Synthesis. DNA to RNA to Protein
Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.
More informationStation 1: DNA Structure Use the figure above to answer each of the following questions. 1.This is the subunit that DNA is composed of. 2.
1. Station 1: DNA Structure Use the figure above to answer each of the following questions. 1.This is the subunit that DNA is composed of. 2.This subunit is composed of what 3 parts? 3.What molecules make
More informationLecture 19A. DNA computing
Lecture 19A. DNA computing What exactly is DNA (deoxyribonucleic acid)? DNA is the material that contains codes for the many physical characteristics of every living creature. Your cells use different
More informationThe combination of a phosphate, sugar and a base forms a compound called a nucleotide.
History Rosalin Franklin: Female scientist (x-ray crystallographer) who took the picture of DNA James Watson and Francis Crick: Solved the structure of DNA from information obtained by other scientist.
More informationGenes and How They Work. Chapter 15
Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central
More informationThe Genetic Code: Translation. Pre-class reading Chapter 17: Pages
The Genetic Code: Translation Pre-class reading Chapter 17: Pages 336-348 Nomenclature needed: Translation RN (m, t, r) Signal peptide sequence Mutations Ribosomes + Polyribosomes Codon (triplet code)
More informationChapter 10. The Structure and Function of DNA. Lectures by Edward J. Zalisko
Chapter 10 The Structure and Function of DNA PowerPoint Lectures for Campbell Essential Biology, Fifth Edition, and Campbell Essential Biology with Physiology, Fourth Edition Eric J. Simon, Jean L. Dickey,
More information1. Overview of Gene Expression
Chapter 17: From Gene to 1. Overview of Gene Expression 2. Transcription 3. The Genetic Code 4. Translation 5. Mutations 1. Overview of Gene Expression Chapter Reading pp. 334-337 How are Genes related
More informationThe Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16
Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes
More informationRNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013
RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein
More informationA. Incorrect! This feature does help with it suitability as genetic material.
College Biology - Problem Drill 08: Gene Structures and Functions No. 1 of 10 1. Which of the statements below is NOT true in explaining why DNA is a suitable genetic material? #01 (A) Its double helix
More information7.016 Problem Set 3. 1 st Pedigree
7.016 Problem Set 3 Question 1 The following human pedigree shows the inheritance pattern of a specific disease within a family. Assume that the individuals marrying into the family for all generations
More informationChapter 10: Gene Expression and Regulation
Chapter 10: Gene Expression and Regulation Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are the workhorses but contain no information THUS Information in DNA must
More informationNucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
More informationA Zero-Knowledge Based Introduction to Biology
A Zero-Knowledge Based Introduction to Biology Konstantinos (Gus) Katsiapis 25 Sep 2009 Thanks to Cory McLean and George Asimenos Cells: Building Blocks of Life cell, membrane, cytoplasm, nucleus, mitochondrion
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationHello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.
Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)
More informationGene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
More informationNUCLEIC ACID METABOLISM. Omidiwura, B.R.O
NUCLEIC ACID METABOLISM Omidiwura, B.R.O Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid
More informationDivision Ave. High School AP Biology
Division ve. High School Making s From ene to Protein How enes Work Organelles nucleus ribosomes endoplasmic reticulum (ER) olgi apparatus vesicles small nuclear pore ribosomal mrn large ribosomal cytoplasm
More informationUNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS
UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS Nucleic acids are extremely large molecules that were first isolated from the nuclei of cells. Two kinds of nucleic acids are found in cells: RNA (ribonucleic
More informationANCIENT BACTERIA? 250 million years later, scientists revive life forms
ANCIENT BACTERIA? 250 million years later, scientists revive life forms Thursday, October 19, 2000 U.S. researchers say they have revived bacteria that have been dormant for more then 250 million years,
More informationThe Flow of Genetic Information
Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins
More informationMULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.
Ch 17 Practice Questions MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) Garrod hypothesized that "inborn errors of metabolism" such as alkaptonuria
More informationChapter 7: Genetics Lesson 7.1: From DNA to Proteins
Chapter 7: Genetics Lesson 7.1: From DNA to Proteins The spiral structure in the picture is a large organic molecule. Can you guess what it is? Here s a hint: molecules like this one determine who you
More informationFrom Gene to Protein. Chapter 17
From Gene to Protein Chapter 17 What you need to know: The key terms: gene expression, transcription, and translation. The major events of transcription. How eukaryotic cells modify RNA after transcription.
More informationDNA REPLICATION. DNA structure. Semiconservative replication. DNA structure. Origin of replication. Replication bubbles and forks.
DNA REPLICATION 5 4 Phosphate 3 DNA structure Nitrogenous base 1 Deoxyribose 2 Nucleotide DNA strand = DNA polynucleotide 2004 Biology Olympiad Preparation Program 2 2004 Biology Olympiad Preparation Program
More information7.2 Protein Synthesis. From DNA to Protein Animation
7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More informationDeoxyribonucleic Acid DNA. Structure of DNA. Structure of DNA. Nucleotide. Nucleotides 5/13/2013
Deoxyribonucleic Acid DNA The Secret of Life DNA is the molecule responsible for controlling the activities of the cell It is the hereditary molecule DNA directs the production of protein In 1953, Watson
More informationReplication, Transcription, and Translation
Replication, Transcription, and Translation Information Flow from DNA to Protein The Central Dogma of Molecular Biology Replication is the copying of DNA in the course of cell division. Transcription is
More informationCONVERGENT EVOLUTION. Def n acquisition of some biological trait but different lineages
CONVERGENT EVOLUTION Def n acquisition of some biological trait but different lineages Living Rock cactus Baseball plant THE QUESTION From common ancestor or independent acquisition? By Lineage By Convergence
More informationFrom Gene to Protein
8.2 Structure of DNA From Gene to Protein deoxyribonucleic acid - (DNA) - the ultimate source of all information in a cell This information is used by the cell to produce the protein molecules which are
More informationTranscription & Translation notes
Transcription & Translation notes TRNSRIPTION The entral Dogma DN RN proteins Protein Synthesis The DN inherited by an organism leads to specific traits by dictating the synthesis of proteins The process
More informationChemistry 121 Winter 17
Chemistry 121 Winter 17 Introduction to Organic Chemistry and Biochemistry Instructor Dr. Upali Siriwardane (Ph.D. Ohio State) E-mail: upali@latech.edu Office: 311 Carson Taylor Hall ; Phone: 318-257-4941;
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by
More informationFermentation. Lesson Overview. Lesson Overview 13.1 RNA
13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to
More informationThe Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Genetic Code. Genes and How They Work
Genes and How They Work Chapter 15 Early ideas to explain how genes work came from studying human diseases. Archibald Garrod studied alkaptonuria, 1902 Garrod recognized that the disease is inherited via
More informationMOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1
AP BIOLOGY MOLECULAR GENETICS ACTIVITY #2 NAME DATE HOUR PROTEIN SYNTHESIS Molecular Genetics Activity #2 page 1 GENETIC CODE PROTEIN SYNTHESIS OVERVIEW Molecular Genetics Activity #2 page 2 PROTEIN SYNTHESIS
More informationiclicker Question #28B - after lecture Shown below is a diagram of a typical eukaryotic gene which encodes a protein: start codon stop codon 2 3
Bio 111 Handout for Molecular Biology 4 This handout contains: Today s iclicker Questions Information on Exam 3 Solutions Fall 2008 Exam 3 iclicker Question #28A - before lecture Which of the following
More information(a) Which enzyme(s) make 5' - 3' phosphodiester bonds? (c) Which enzyme(s) make single-strand breaks in DNA backbones?
EXAMPLE QUESTIONS AND ANSWERS 1. Topoisomerase does which one of the following? (a) Makes new DNA strands. (b) Unties knots in DNA molecules. (c) Joins the ends of double-stranded DNA molecules. (d) Is
More informationFlow of Genetic Information
Flow of Genetic Information Transcription and Translation Links to the Next Generation Standards Scientific and Engineering Practices: Asking Questions (for science) and Defining Problems (for engineering)
More informationProtein Synthesis Notes
Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription
More informationText Reference, Campbell v.8, chapter 17 PROTEIN SYNTHESIS
AP BIOLOGY Text Reference, Campbell v.8, chapter 17 ACTIVITY 1.22 NAME DATE HOUR PROTEIN SYNTHESIS GENETIC CODE PROTEIN SYNTHESIS OVERVIEW PROTEIN SYNTHESIS TRANSCRIPTION PROTEIN SYNTHESIS TRANSLATION
More informationLesson Overview. Fermentation 13.1 RNA
13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA
More informationUnit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression
Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,
More informationThe Structure of RNA. The Central Dogma
12-3 12-3 RNA and Protein Synthesis The Structure of RNA The Central Dogma Phenotype A gene is a SEQUENCE of DNA that codes for a protein (or functional RNA). Phenotype is the individual s observable trait
More informationBIOLOGY. Gene Expression. Gene to Protein. Protein Synthesis Overview. The process in which the information coded in DNA is used to make proteins
17 CAMPBLL BIOLOGY TNTH DITION Reece Urry Cain Wasserman Minorsky Jackson Gene to Protein Gene xpression The process in which the information coded in is used to make proteins A gene is the part of the
More informationUnit 1. DNA and the Genome
Unit 1 DNA and the Genome Gene Expression Key Area 3 Vocabulary 1: Transcription Translation Phenotype RNA (mrna, trna, rrna) Codon Anticodon Ribosome RNA polymerase RNA splicing Introns Extrons Gene Expression
More informationFrom Gene to Protein
Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp
More information