HSC Biology. Year 2014 Mark Pages 21 Published Jan 12, Biology: Option Genetics: The Code Broken. By Leah (97.7 ATAR)
|
|
- Eleanore Bond
- 5 years ago
- Views:
Transcription
1 HSC Bilgy Year 2014 Mark Pages 21 Published Jan 12, 2017 Bilgy: Optin Genetics: The Cde Brken. By Leah (97.7 ATAR)
2 Pwered by TCPDF ( Yur ntes authr, Leah. Leah achieved an ATAR f 97.7 in 2014 while attending Tara Anglican Schl Fr Girls Currently studying Bachelr f Primary Educatin at The University f Sydney Achievements: 2nd in State HSC Gegraphy 2014 Caltex All Runder Award 2014 Gegraphy Teacher's Assciatin Arthur Phillip Award 2011 and 2012 Band 6 HSC Bilgy Band 6 HSC General Mathematics Band 6 HSC Gegraphy (mark f 97) Band 6 HSC Fd Technlgy Band 6 Studies f Religin I Leah says: Hi all, I achieved an ATAR f 97.7 in the 2014 HSC ranking 2nd in the State in Gegraphy. I'm currently studying a Bachelr f Primary Educatin at the University f Sydney and am super passinate abut educating yung peple t achieve incredible things. I have ver 2 years f tutring experience and my ntes cmprehensively cver all HSC syllabus dt pints. My advice is wrk hard and play hard- after all, this is yur last year f schl! Enjy yur last sprts carnivals, muck up days and all the extra curricular activities yu d whilst studying diligently and thrughly t enjy the all imprtant balance f year 12.
3 GENETICS THE CODE BROKEN HSC BIOLOGY NOTES Transfer f infrmatin frm DNA thrugh RNA t prduce a sequence f amin acids in a plypeptide- DNA RNA Nucletides- single base, sugar, phsphate Wund t frm duble helix In chrmsmes f eukarytic (membrane bund) rganisms- DNA is wrapped arund prteins called histnes Gene begins with a nn-cding sequence called a prmted, ends with a terminatr Genes cntain exns (cding) and nn-cding sequences called intrns Cndensatin- DNA wraps int a tight spiral- cils and flds many times during replicatin preparatin mrna (messenger RNA), trna (transfer RNA), rrna (ribsmal RNA) RNA structure- single stranded, ribse sugar, Uracil instead f thymine, nly a few thusands bases lng trna- clver shape, anti-cdn n ne end, accepting end hlds amin acid nn-cding strand cdes fr a prtein intrns are transcribed with exns then later intrns are cut ut because mrna is s lng, several ribsmes can attach t it, making several plypeptides at the same time Functin Ribsme- site f prtein synthesis trna- carries amin acid t ribsme DNA- carries genetic infrmatin, prvides a template fr plypeptide synthesis 1.a Cnstruct a DNA mdel- Dexyribnucleic sugar and phsphate backbne Cmplementary bases- Adenine& thymine, guanine& cytsine Nucletide- ne sugar, phsphate, nitrgenus base Duble helix- spiral Phsphate smaller than sugar
4 GENETICS THE CODE BROKEN HSC BIOLOGY NOTES 2 1.b Outline the current understanding f gene expressin- Gene expressin- refers t a gene being turned n t prduce a plypeptide which then shws the trait phentypically 1. Unpacking the chrmsme DNA wund arund histnes, DNA must be unpacked in the regin f the chrmsme t be read 2. Turning n the gene An enhancer must bind t a prmter fr gene expressin t ccur Prmtr (marker)- shrt regulatry area at the start f a gene, acts as a binding site (TATA bx- adenine and thymine) Enhancer (marker)- shrt regin f DNA that is far away frm the gene they influence- when in cntact with prmtr, increase the rate f transcriptin Transcriptin factrs (regulatry prteins) bring enhancers t prmtrs and bind them- this marker signals RNA plymerase t bind and start transcriptin in PCR plymerase chain reactin 3. Transcriptin in the nucleus 4. RNA prcessing (spicing f intrns, capping and tailing) mrna is made f 80% nn-cding junk DNA called intrns mrna needs t be mdified befre leaving the nucleus intrns remved by RNA splicing (restrictin enzyme cuts and leaves sticky endsligase enzyme pastes ) mrna receives a cap and tail (cnsisting f several bases) t prevent mlecule frm being degraded mrna is used thusands f times at ribsmes befre it is recycled 5. Translatin At ribsme in cytplasm t prduce plypeptide 6. Prtein Mdificatin Prteins assembled by cutting, flding and crss linking plypeptides t frm a specific #D prtein Jined and flded depending n functin 2.1 Characteristics determined by multiple alleles- Multiple alleles Invlves ne gene- but many alleles exist 2 r mre alleles cntrl 1 characteristic (hwever each individual can nly have a maximum f 2 alleles) Gives rise t discrete characteristics Fund n the same lcus n hmlgus chrmsmes
5 Pwered by TCPDF ( GENETICS THE CODE BROKEN HSC BIOLOGY NOTES 3 E.g. in human bld types- I A antigen A, I B antigen B, I n antigens E.g. in drsphilia melangaster (fruit fly)- w + red eyes, w a aprict eyes, w h hney eyes, w p pearl eyes, w i ivry eyes, w white eyes E.g. fur clur in rabbits- C intense black, c ch chinchilla (white fur, black tips), c h Himalayan (black eyes, nse, feet), c albin 2.2 Inheritance f ABO and Rhesus bld grups- If transfusin are given t thse wh are nt bld type cmpatible- agglutinatin- immune system attaches t cells and cause them t clump Bld Types ABO A (I a, I a )- a antigen, b antibdies B (I b, I b )- b antigen, a antibdies AB (I a,i b )- bth antigens, n antibdies O (I,i)- n antigens, a and b antibdies A and B c-dminant (tw alleles expressed heterzygus), O recessive Bld O universal dnr - bld can be given t anyne Bld AB universal recipient - accept any bld Bld grups can be used in paternity tests t determine wh is nt the father (nt definitive n wh is the father) Rhesus factr is an extra antigen n bld cells- nt a prblem with transfusins but is a prblem with difficult pregnancies Rh negative- recessive- prduce antibdies (Rh- dd) Rh psitive- dminant- n antibdies (Rh+ Dd r DD) If mum is Rh-, and baby is Rh+, in prblem pregnancies, mums immune system prduces antibdies and memry cells. If 2 nd pregnancy difficult, blds mix, mums antibdies cause agglutinatin in baby and destry fetal cells 2.a Predict the inheritance patterns f ABO bld grups and Rhesus factr-
HSC Biology. Year 2014 Mark Pages 32 Published Jan 12, Biology: Maintaining A Balance. By Leah (97.7 ATAR)
HSC Bilgy Year 2014 Mark 90.00 Pages 32 Published Jan 12, 2017 Bilgy: Maintaining A Balance. By Leah (97.7 ATAR) Pwered by TCPDF (www.tcpdf.rg) Yur ntes authr, Leah. Leah achieved an ATAR f 97.7 in 2014
More informationLectures 10/11, Module 1 - DNA, Protein and the Central Dogma: DNA o o
Lectures 10/11, Mdule 1 - DNA, Prtein and the Central Dgma: DNA Genetic material Plymer cnsisting f nucletides Nucletides cnsist f a nitrgenus base, a pentse sugar (dexyribse) and a phsphate grup Bases
More informationChapter 7 DNA Fingerprinting By the end of this chapter you will be able to:
Chapter 7 DNA Fingerprinting By the end f this chapter yu will be able t: Explain hw crime scene evidence is cllected and prcessed t btain DNA Describe hw radiactive prbes are used in DNA fingerprinting
More informationSTAAR Year Review. Carbohydrates Lipids Proteins Nucleic Acids C,H,O C,H,O,N C,H,O,N,P. Long term energy storage/ hormones
Bimlecules- essential mlecules fr life. Als seen in lessns thrughut the year Structure Carbhydrates Lipids Prteins Nucleic Acids Functin C, H, O (1:2:1) Structure Shrt term energy C,H,O C,H,O,N C,H,O,N,P
More informationStudy questions for the lectures 1-4
Study questins fr the lectures 1-4 1. What infrmatin(s) culd yu btain frm a genetic apprach f studying mutants defective in a particular prcess? [L: 1, S: 9] The ptential functin f the prtein f interest
More informationAP Biology Exam Review: DNA, Protein Synthesis & Biotechnology
AP Bilgy Exam Review: DNA, Prtein Synthesis & Bitechnlgy Helpful Vides and Animatins: 1. Bzeman Bilgy: DNA Replicatin 2. Bzeman Bilgy: DNA and RNA - Part 1 3. Bzeman Bilgy: DNA and RNA - Part 2 4. Cld
More informationCAFS Core 1: COMPLETE Research Methodology Notes. HSC Community & Family Studies. Year 2016 Mark Pages 13 Published Feb 22, 2018
HSC Cmmunity & Family Studies Year 2016 Mark 95.00 Pages 13 Published Feb 22, 2018 CAFS Cre 1: COMPLETE Research Methdlgy Ntes By Katie (99.15 ATAR) Pwered by TCPDF (www.tcpdf.rg) Yur ntes authr, Katie.
More informationBS 50 Genetics and Genomics Week of Dec 12
BS 50 Genetics and Genmics Week f Dec 12 Additinal Practice Prblems fr Sectin Questin 1 (20 pts) Yu islate 6 mutant strains (Eye-A, Eye-B, Eye-C, Eye-D, Eye-E and Eye- F) that have abnrmal eye develpment.
More information"Central dogma" of molecular biology (textbook pages 57-58)
Evidence that DNA is the genetic material: Dexyribnucleic acid (DNA) was described as a bichemical substance in 1871, but its rle as the carrier f genetic infrmatin was nt published until 1944. DNA was
More informationBIOLOGY 111. CHAPTER 7: Darwinian Evolution. Life Changes
BIOLOGY 111 CHAPTER 7: Darwinian Evlutin Life Changes BIOLOGY 101 CHAPTER 7b: Evlutin f Ppulatins: Evlutin f Ppulatins: CONCEPTS: 7.5 Genetic Variatin Makes Evlutin Pssible 7.6 Frces that can alter allele
More informationBiochemistry 462a Nucleic Acid Structure Reading - Chapter 10 Practice problems - Chapter 10: #2,3,6,8,9,11; Nucleic Acids extra problems
Bichemistry 462a ucleic Acid Structure Reading - Chapter 10 Practice prblems - Chapter 10: #2,3,6,8,9,11; ucleic Acids extra prblems Primary Structure As is the case fr prteins, nucleic acids have a primary
More informationWeek 5: Molecular Cloning Strategies
Week 5: Mlecular Clning Strategies - 2 ptins fr gene clning: Traditinal recmbinant plasmid clning f the gene f interest PCR amplificatin f the gene f interest within bkended primers - Bth yield many cpies
More informationSemester 1 Biology Mid-Term Exam Review Guide
2014-2015 Semester 1 Bilgy Mid-Term Exam Review Guide Please knw that the exam will include the cncepts belw (including but nt limited t). Students are als respnsible t lk ver the Quizzes, Interactive
More informationGenetics Lecture Notes
Bilgy Genetics Lecture Ntes Name Per Learning Gals Yu will be able t explain hw ffspring receive genes frm their parents Yu will be able t calculate prbabilities f passing genes frm ffspring t ffspring
More informationGenetics Lecture Notes
Bilgy Genetics Lecture Ntes Name Per Learning Gals FOR BIWEEKLY QUIZ #7 Yu will be able t explain hw ffspring receive genes frm their parents Yu will be able t calculate prbabilities f simple Mendelian
More informationCh. 11 The Molecular Basis of Inheritance BIOL 100
h. 11 he Mlecular Basis f Inheritance BIOL 100 Overview: Life s Opera9ng Instruc9ns James Watsn and Francis rick 1953 - prduced duble-helical mdel fr the structure f DN Rsalind Franklin and Maurice Wilkins
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by
More informationChapter 3 Heredity and Evolution
Chapter 3 Heredity and Evlutin Genetics The first part f the chapter may be a review fr yu r yur first intrductin t the cncepts assciated with genetics. Genetics is the branch f science that deals with
More informationName Period Section Due Date BIOMOLECULES
Name Perid Sectin Due Date This review packet is t be cmpleted with pwer pint ntes. The key symbl begins a new BIG IDEA f the review. Fr yur benefit, slide numbers frm the pwer pint has been included fr
More informationCCE Application Guidelines
CCE Applicatin Guidelines - 2017 General This dcument cntains infrmatin n hw t cmplete and submit yur CCE applicatin. If yu have any questins, please cntact Susan McGuire at smcguire@acce.rg. Tips befre
More informationCCE Application Guidelines
CCE Applicatin Guidelines - 2018 General This dcument cntains infrmatin n hw t cmplete and submit yur CCE applicatin. If yu have any questins, please cntact Susan McGuire at smcguire@acce.rg. Tips befre
More informationBIOLOGY 101. CHAPTER 23: Evolution of Populations: Alleles Change
BIOLOGY 101 CHAPTER 23: Evlutin f Ppulatins: Evlutin f Ppulatins: CONCEPTS: 23.1 Genetic Variatin Makes Evlutin Pssible 23.3 Frces that can alter allele frequencies in a ppulatin 23.4 Natural selectin
More informationFermentation. Lesson Overview. Lesson Overview 13.1 RNA
13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to
More information5 th Grade Goal Sheet
5 th Grade Gal Sheet Week f December 3 rd, 2018 Frm Ms. Simmns: Upcming dates: 12/4 Prgress Reprts fr 2 nd Quarter 12/4 Math Benchmark Testing 12/11- Parent Partnership Meeting: ELA, the Cmmn Cre, and
More informationEnergy Consumption. Rated Life. Environmental Considerations
Energy Cnsumptin When cmparing LED t metal halide street lighting, there is typically a 50 percent energy reductin with cmparable light levels. Fr example, a 250-watt metal halide fixture wuld typically
More informationOpen House Fact Sheet
Open Huse Fact Sheet What is an Open Huse? An pen huse is an infrmal meeting prcess where participants begin by explring varius displays, r statins, related t the meeting purpse. Each statin has a knwledgeable
More informationProteins and Protein Synthesis body structures, hormones, enzymes & antibodies amino acids sequence number DNA chemical code codon 'initiator'
Proteins and Protein Synthesis - Proteins : large complex molecules that make up body structures, hormones, enzymes & antibodies : are composed of subunits called amino acids : there are 20 different amino
More informationHowever, nitrogen can only be used by plants in the form of the nitrate ion (NO 3
The Nitrgen Cycle the cycling f nitrgen thrugh the bisphere Nitrgen is plentiful in ur atmsphere as N 2(g) Hwever, nitrgen can nly be used by plants in the frm f the nitrate in (NO 3 ) There are tw ways
More informationProtein Synthesis: Transcription and Translation
Protein Synthesis: Transcription and Translation Proteins In living things, proteins are in charge of the expression of our traits (hair/eye color, ability to make insulin, predisposition for cancer, etc.)
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationThis handout relates to the Writing your Report webinar and covers the following: Advice on what to do after you have completed your report
The Ryal Sciety fr the Preventin f Accidents Writing yur Reprt Rad Safety Evaluatin Webinar Handut: Writing yur Reprt Evaluatin webinar handut Intrductin This handut relates t the Writing yur Reprt webinar
More informationFoolProof Teacher Guide. Module 4. Road Trip. Explores checking accounts, debit cards, and banking.
Mike Sheffer Directr f Educatin FlPrf Teacher Guide Mdule 4 Rad Trip Lessn: Explres checking accunts, debit cards, and banking. Time: Three 45-60 minute class perids Tw parts: pre-teach & pst-teach Due
More informationDNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
More informationThe primary antibody and the secondary antibody are not compatible. Not enough primary antibody is bound to the protein of interest
Trubleshting and using cntrls in IHC and ICC N staining The primary antibdy and the secndary antibdy are nt cmpatible Use a secndary antibdy that was raised against the species in which the primary was
More informationI. Gene Expression Figure 1: Central Dogma of Molecular Biology
I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases
More informationBuildertrend/Xero Integration Guidelines. Buildertrend/Xero integration guidelines v1.0 February 2018 pg. 1
Buildertrend/Xer Integratin Guidelines www.luckman.c.nz Buildertrend/Xer integratin guidelines v1.0 February 2018 pg. 1 Cntents Xer Integratin... 3 Prcess Xer Integratin... 4 Buildertrend Training Vides
More informationVideos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
More informationIESBA Meeting (November/December 2015) Long Association Proposed Changes to Section 290 (MARK-UP from ED)
IESBA Meeting (Nvember/December 2015) Agenda Item 5-B General Prvisins Lng Assciatin Prpsed Changes t Sectin 290 (MARK-UP frm ED) 290.148A Familiarity and self-interest threats, which may impact an individual
More informationNEW LAWS REGARDING BUILDING PRODUCTS (QLD)
BUILDING SERVICES Ref: LEG 17-05 Current at Nvember 2017 NEW LAWS REGARDING BUILDING PRODUCTS (QLD) Frm 1 Nvember new laws regarding nn-cnfrming building prducts apply t all building prjects in Queensland.
More informationRedeployment Due to Ill Health
Redeplyment Due t Ill Health Guide fr managers This guide utlines steps t fllw when managing an emplyee thrugh the redeplyment prcess due t ill health Main tpic areas Overview General principles The prcess
More informationSection 14.1 Structure of ribonucleic acid
Section 14.1 Structure of ribonucleic acid The genetic code Sections of DNA are transcribed onto a single stranded molecule called RNA There are two types of RNA One type copies the genetic code and transfers
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationRepton Hockey Club PRIVACY NOTICE FOR OUR JUNIOR MEMBERS
Reptn Hckey Club PRIVACY NOTICE FOR OUR JUNIOR MEMBERS We at the Reptn Hckey Club want t make sure all the persnal details we hld abut yu are safe and secure, s we have put tgether this nte t tell all
More informationChapter 4 Genetics: The Science of Heredity
Chapter 4 Genetics: The Science of Heredity The Cell s Genetic Code Heredity is the passing of traits from parent to offspring Genetics is the scientific study of passing of traits from parent to offspring
More informationDNA - DEOXYRIBONUCLEIC ACID
DNA - DEOXYRIBONUCLEIC ACID blueprint of life (has the instructions for making an organism) established by James Watson and Francis Crick codes for your genes shape of a double helix made of repeating
More informationGuidance notes for completing the International Start-up Form
Guidance ntes fr cmpleting the Internatinal Start-up Frm These guidance ntes are designed t supprt yu in cmpleting the Internatinal start-up frm. Yu will als need t refer t a) yur Stage 2 applicatin frm
More informationVideos. Bozeman Transcription and Translation: Drawing transcription and translation:
Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain
More informationBiology (2017) INTERNATIONAL GCSE. TOPIC GUIDE: Genetic modification and cloning. Pearson Edexcel International GCSE in Science
INTERNATIONAL GCSE Bilgy (2017) TOPIC GUIDE: Genetic mdificatin and clning Pearsn Edexcel Internatinal GCSE in Science Intrductin t the teaching f genetic mdificatin and clning Specificatin In the 2011
More informationDNA Structure DNA Nucleotide 3 Parts: 1. Phosphate Group 2. Sugar 3. Nitrogen Base
DNA,, RNA,, AND PROTEIN SYNTHESIS DNA Deoxyribonucleic Acid Enables cells to have different forms and perform different functions Primary functions of DNA: Store and transmit genetic information that tells
More informationBIRMINGHAM CITY COUNCIL STRATEGY FOR OPEN DATA
What we are trying t achieve BIRMINGHAM CITY COUNCIL STRATEGY FOR OPEN DATA This strategy sets ut hw Birmingham City Cuncil will prvide regular cmprehensive releases f public pen data and hw it will use
More informationMIS Exam Revision Modules 1-11!
MIS Exam Revisin Mdules 1-11 Mdules 1-4 Chapter 1: Why MIS? The Imprtance f MIS All based arund Mre s Law. The number f transistrs per square inch n an integrated chip dubles every 18 mnths. Speed f a
More informationGuidance on the Privacy and Electronic Communications (EC Directive) Regulations
Infrmatin Security Guidance Title: Status: Guidance n the Privacy and Electrnic Cmmunicatins (EC Directive) Regulatins Released 1. Purpse This guidance n the Privacy and Electrnic Cmmunicatins (EC Directive)
More informationDNA, Replication and RNA
DNA, Replication and RNA The structure of DNA DNA, or Deoxyribonucleic Acid, is the blue prints for building all of life. DNA is a long molecule made up of units called NUCLEOTIDES. Each nucleotide is
More informationSeptember ABC Consumer Magazines Reporting Standards (UK)
September 2018 ABC Cnsumer Magazines Reprting Standards (UK) Changes have been agreed t the ABC Cnsumer Magazine Reprting Standards. We have updated the latest Reprting Standards t incrprate these changes
More informationThe Molecular Basis of Inheritance
Chapter 16 The Mlecular Basis f Inheritance Lecture Outline Overview: Life s Operating Instructins In April 1953, James Watsn and Francis Crick shk the scientific wrld with an elegant duble-helical mdel
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationibdreg: An R package for Genetic Linkage with Covariates
ibdreg: An R package fr Genetic Linkage with Cvariates Jasn Sinnwell Daniel Schaid August 10, 2007 ibdreg: utline Intr t Linkage (brief) Why d linkage with cvariates? Methdlgy in ibdreg Dem f ibdreg n
More informationII. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes Frank Griffith- discovered DNA in 1928
HEREDITY = passing on of characteristics from parents to offspring I. DNA, Chromosomes, Chromatin, and Genes DNA = blueprint of life (has the instructions for making an organism) Chromatin= uncoiled DNA
More informationDNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted
DNA RNA PROTEIN Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA Molecule of heredity Contains all the genetic info our cells inherit Determines
More informationExtended Inventory Items
Extended Inventry Items Using the Item Number SmartFinder buttn Extended Inventry Items Extended Inventry Items is an enhanced replacement fr the Sage I/C Items screen. It prvides yu with mre functinality
More informationAs we know, the media like something dramatic, something different, something relevant to the news of the day or something novel.
Media resurces Attracting media attentin Publicising LIW, literacy and the services we prvide t ur cmmunity is a vital part f the prfessinal practice f library and infrmatin service prviders and ther participating
More informationSOCIAL MEDIA IN YOUR JOB SEARCH
SOCIAL MEDIA IN YOUR JOB SEARCH Vlunteer State Cmmunity Cllege Office f Career Services and Cmmunity Engagement 615-230-3307 http://www.vlstate.edu/careerplacement/ Scial Media in Yur Jb Search Scial media
More informationLesson Overview. Fermentation 13.1 RNA
13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA
More informationGene Expression. Student:
Gene Expression Student: 1. A ribozyme is A. a section of the DNA that is expressed in the mrna. B. a self-splicing intron that acts like an enzyme. C. a complex made up of many ribosomes replicating the
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationIMI2 PROPOSAL TEMPLATE FIRST STAGE PROPOSAL
IMI2 PROPOSAL TEMPLATE FIRST STAGE PROPOSAL IN TWO-STAGE PROCEDURE (TECHNICAL ANNEX) RESEARCH AND INNOVATION ACTIONS & INNOVATION ACTIONS Nte: This is fr infrmatin nly. The definitive template fr yur call
More informationLFH Long- Flanking Homology PCR
LFH Lng- Flanking Hmlgy PCR igem LMU- Munich 2012 up-fwd up-rev up dwn res 1. PCR genex d-fwd d-rev resistance cassette up-fwd d-rev up dwn 2. Jining-PCR genex Step 1 : Chsing a cassette and designing
More informationOfficial Rules. The McAllen Business Plan Competition - Official Rules 2018
Official Rules REGULATION MC-BD-FO-1229V00 The McAllen Business Plan Cmpetitin - Official Rules 2018 The cmpetitin is intended t simulate the real-wrld prcess f entrepreneurs sliciting start-up funds frm
More informationLecture Overview. Overview of the Genetic Information. Marieb s Human Anatomy and Physiology. Chapter 3 DNA & RNA Protein Synthesis Lecture 6
Marieb s Human Anatomy and Physiology Marieb Hoehn Chapter 3 DNA & RNA Protein Synthesis Lecture 6 Lecture Overview The Genetic Information Structure of DNA/RNA DNA Replication Overview of protein synthesis
More informationBio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
More informationThe purpose of IPRO 304 is to create a software package to assist A. Finkl & Sons in tracking of parts in heat treatment furnaces.
Prject Plan Reprt: Heat Treat Subgrup 1.0 Objective The purpse f IPRO 304 is t create a sftware package t assist A. Finkl & Sns in tracking f parts in heat treatment furnaces. Objective fr Spring 2008:
More informationMEDICINAL CHEMISTRY HD LECTURE NOTES UTS COURSE CODE COMPLETED 2017 SPRING
MEDICINAL CHEMISTRY HD LECTURE NOTES UTS COURSE CODE 65001 COMPLETED 2017 SPRING Enzymes: Structure and Functin Prtein Structure and Enzymes: Prteins cntain amin acid residues sticking ut frm the plypeptide
More informationApprenticeship ERR Workbook
Apprenticeship ERR Wrkbk Emplyee Rights and Respnsibilities Welcme and Intrductin Dear apprentice, Bth emplyers and emplyees have a range f statutry rights and respnsibilities under Emplyment Law. It is
More informationName: Class: Date: ID: A
Class: _ Date: _ CH 12 Review Multiple Choice Identify the choice that best completes the statement or answers the question. 1. How many codons are needed to specify three amino acids? a. 6 c. 3 b. 12
More informationName: Class Period: Date: Guided Notes Agriculture
Name: Class Perid: Date: Guided Ntes Agriculture Hunters and Gatherers Befre humans. Grups f related. They traveled frequently. rts, berries, and nuts, and. By c-perating tgether they met their basic needs
More informationStep 3: The nitrates and nitrites are used by plants to make amino acids which are then used to make plant proteins.
The Nitrgen Cycle Organisms require nitrgen t prduce amin acids. Nitrgen makes up seventy-eight percent f the atmsphere, but mst rganisms can nt use this frm f nitrgen, and must have the fixed frm. The
More informationBLG Applied Genetics. Biology
BLG-5070-2 Applied Genetics Bilgy BLG-5070-2 Applied Genetics INTRODUCTION The curse entitled Applied Genetics is aimed at enabling adult learners t functin effectively in situatins frm the Research and
More informationCustomer best practices
Custmer dcument Custmer best practices Recmmendatins fr new Basware transactin services custmers Basware Crpratin Cpyright Basware Crpratin All rights reserved 1 (11) 1 Intrductin Our best advice This
More informationConsider your network. Before setting your project s fundraising goal, you need to consider your team s networks size and giving potential.
PROJECT TOOLKIT Thughtful preparatin is key t yur prject s verall success. The pre-launch phase begins fur t six weeks befre yur prject s launch date and is fcused n utreach strategies and explring netwrks
More informationPersonal Computing Services FAQ s
What s cvered under the PCS cntract? PCS will generally cver all f the Break/Fix services n the Cre Hardware that is lcated at the schls. Cre Hardware cnsists f: DESKTOPS, LAPTOPS, SERVERS, and PRINTERS.
More informationGENETICS 1 Classification, Heredity, DNA & RNA. Classification, Objectives At the end of this sub section you should be able to: Heredity, DNA and RNA
Classification, Heredity, DNA and Objectives At the end of this sub section you should be able to: RNA Heredity and Variation Gene Expression DNA structure DNA Profiling Protein Synthesis 1. Discuss the
More informationUK Recycling Index 2018
UK Recycling Index 2018 Prepared by Edelman Intelligence 1 Cntents Objectives and Methdlgy 2017 Findings (Recap) Cnsideratins 2018 Findings Detailed Research Findings Sectin 1: The recycling landscape
More informationRNA & PROTEIN SYNTHESIS
RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide
More informationWhat does DNA stand for?
DNA and RNA What does DNA stand for? DNA = deoxribonucleic acid NOTE: the DNA from one cell would stretch 3 metre DNA are coiled and folded. DNA has two strands. What four bases are used in DNA? The four
More informationBEST POSTER COMPETITION CRITERIA
The Pwer f Partnership: Wrking in cllabratin t deliver high-quality health and care infrmatin and supprt BEST POSTER COMPETITION CRITERIA 11th Annual Cnference fr Peple Wrking in Health and Care Infrmatin
More informationof approximately 140 Catholic primary and secondary schools and colleges within the Archdiocese of Brisbane.
Privacy PURPOSE Brisbane Cathlic Educatin (BCE) is respnsible fr the administratin f apprximately 140 Cathlic primary and secndary schls and clleges within the Archdicese f Brisbane. This Privacy Plicy
More informationNew Expectations for HR
1 D SHRM 2015 New Expectatins fr HR 2 Business has new and different expectatins f HR and its cntributins leader f peple strategy fr business utcmes. The technlgy and glbal revlutins are driving that change.
More informationPROTOCOL 1850 Millrace Drive, Suite 3A Eugene, Oregon
PROTOCOL Apptsis-Inducing Factr (AIF) Prtein Quantity Dipstick Assay Kit 1850 Millrace Drive, Suite 3A Eugene, Oregn 97403 MSA31 Rev.0 DESCRIPTION Apptsis-Inducing Factr (AIF) Prtein Quantity Dipstick
More informationSelling and Purchasing Items
Selling and Purchasing Items Selling t custmers invlves the fllwing dcuments: Dcument Qute Invice Custmer Credit Ntes Definitin Qutes are ptinal. A qute is an ffer t sell ne r mre items t a custmer at
More informationYou can also click Jobs in the left hand navigation bar and then select Create Job toward the right hand corner.
T pst a jb n Handshake: 1. Start by clicking Pst a Jb frm yur hme dashbard: Yu can als click Jbs in the left hand navigatin bar and then select Create Jb tward the right hand crner. Yu will nw be asked
More informationProtein Synthesis ~Biology AP~
Protein Synthesis ~Biology AP~ A Meridian Study Guide by David Guan, Jennifer Zheng [Edited by Lei Gong] Introduction: - DNA and RNA are essential for life because they code for enzymes, which regulate
More informationSession 4: What are global supply chains?
Sessin 4: What are glbal supply chains? Age range: 7-11 years Outline Learners will learn what a glbal supply chain is and hw the different stages and players can affect thse at either end f the chain.
More informationE. Incorrect! The four different DNA nucleotides follow a strict base pairing arrangement:
AP Biology - Problem Drill 10: Molecular and Human Genetics Question No. 1 of 10 Instructions: (1) Read the problem and answer choices carefully, (2) Work the problems on paper as 1. Which of the following
More informationWhy are proteins important?
PROTEIN SYNTHESIS Why are proteins important? proteins help build cell structures some proteins are enzymes that promote biological reactions Proteins are found in muscles, blood, bones, etc.. RNA RNA
More informationWOSHA Waste Duty of Care. John Hanson Senior Contract Manager for Veolia (Siemens PLC Contract) November 18 th 2014
WOSHA Waste Duty f Care Jhn Hansn Senir Cntract Manager fr Velia (Siemens PLC Cntract) Nvember 18 th 2014 Intrductin The Duty f Care applies t anyne wh imprts, carries, keeps, treats r dispses f cntrlled
More information9 Things QuickBooks Users Should Know About Microsoft Dynamics 365
9 Things QuickBks Users Shuld Knw Abut Micrsft Dynamics 365 www.intellitecslutins.cm The past few years has brught extrardinary changes t the way we d business. Web-based business applicatins have matured,
More informationGMO Investigator: Part 1
Bilgy 211, Nrth Seattle Cmmunity Cllege Name: GMO Investigatr: Part 1 OBJECTIVES T review the structure and functin f DNA. Understand and perfrm the plymerase chain reactin (PCR) T gain experience using
More informationThe Flow of Genetic Information
Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins
More informationRNA and Protein Synthesis
RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and
More information