Is faba bean on the threshold of a golden era of gene identification?
|
|
- Calvin Hunt
- 6 years ago
- Views:
Transcription
1 School of Agriculture, Policy and Development Is faba bean on the threshold of a golden era of gene identification? Donal O Sullivan 29 th January 2015, Copenhagen University of Reading
2 In brief Why faba bean? It s not all genetics. But it is, really.. An entirely SNP-based consensus map for faba bean Exploitation of simple patterns of synteny with Medicago Mutagenesis 2
3 Why faba bean? 1. Faba bean is the broadacre grain legume best placed (in UK) to provide: sustainably produced protein for food and feed return N to soil in a sustainable rotation 2. We have identified several researchable topics that can be readily addressed IF we have the right tools to do so. Stem nematode resistance More reliable pod set Nutritional quality For humans (VC) For animals (protein content, aa comp, low tannins) Herbicide resistance
4 We are addicted to Haber-Bosch N From: Erisman et al (2008) Nature Geoscience
5 5
6 Erith (1930) Genetica 6
7 Hc hc Erith (1930) Genetica 7
8
9 SNP DISCOVERY
10 23.2k contigs ALBUS nematode-susceptible white flower 454 sequence of RNA From 10-day old seedlings Alignment of 14k gene transcripts present in both lines to Mt3.5 predicted CDSs 26.7k contigs BPL10 nematode resistant normal flower 40,000 putative SNPs >ALBUS AGGACTTGTACGTACG >BPL10 AGGACATGTACGTACG >Mt3.5 ACGACTTGTAGGTACG 888 new KASPAR assays designed Validation on 37 reference lines
11 MAPPING
12 Populations used ALBUS x BPL10 (anchor) 136 F 2 s Segregates for white flower (zero tannin) NV657 x NV F 2 s Segregates for ZT NV644 x NV F 2 s Segregates for dwarfism, hilum colour, ZT NV639 x NV F 2 s Segregates for closed flower mutation Mélodie x ILB F4s Segregates for stipule spotting, hilum colour and vicine-convicine Côte D Or/1 x BPL4628/ RILs Segregates for frost tolerance Call rate across pops ranged from 98-99%
13 A consensus faba bean SNP linkage map 687 high quality SNPs mapped Map length 1,404 cm 6 linkage groups = haploid chromosome number each LG cross-linked to previous gene-based maps Chr Mt synteny # Markers Map length (cm) I 2>7>6> II 3> Mapped traits Cf vc, Hc SSP1 Zt1 qsd,qct Webb et al (2015) Plant Biotechnology Journal, in press References unpublished Khazaei et al (2015) Mol Breed; Khazaei et al (2014) Mol Breed Webb et al (2015) Plant Biotech J; Khazaei et al (2014) TAG III ; IV 4>8> Sc Khazaei et al (2014) TAG V 7>5> Dwf1 unpublished VI 8> qsw Khazaei et al (2014) TAG
14 SYNTENY
15 From Choi (2004) PNAS 15
16 Mt1 Vf1 (4) Mt2 Vf2 (2) Mt3 Mt4 Vf3 (1) Mt5 Mt6 Mt7 Vf4 Vf5 (2) (3) Mt8 Vf6 (2)
17 Faba Medicago Lentil synteny Vf2 = Mt2 = Lc3 Vf5 = Mt7 = Lc6 17
18 ALBUS white flower BPL10 normal flower? The Vicia faba orthologue of the WD40 TF AtTTG1/Pisum A2 gene is a good positional and biological candidate for ZT
19 VfWD40-1 = ZT1 PCR BPL10 Zt1 normal flower ALBUS zt1 white flower Genome walking ALBUS (zt1) 19
20 Vicine and convicine anti-nutritional compounds Causes favism in G6PD-deficient humans (400 million worldwide) Lowers weight gain and egg weight/number in laying hens 20
21 How much VC in our germplasm? Mélodie/2 Betty Disco ILB938/2 Mélodie/2 x ILB938/2 RIL (Khazaei & Stoddard) Khamassi et al (2013) PGRCU 21
22 qv-c qc qv Linked Vc and Hc loci Vf_Mt2g005900_001 Vf_Mt1g083330_001 Vf_Mt2g007220_001 hc Hc 4.4 Vf_Mt2g010740_001 Vf_Mt2g010880_ HC 12.5 Vf_Mt2g015010_001 Vicine Convicine Vicine-convicine 26.3 Vf_Mt2g021130_ Vf_Mt2g026550_ Vf_Mt2g028620_ Vf_Mt2g030200_ Vf_Mt2g033460_001 Khazaei et al, 2015, Mol Breed, online 22
23 Mt2 kb SNP mining in the VC region
24 New validation populations for VC Hedin/2 x Disco 167 x F2 Albus/3 x Disco 150 x F2 Disco x NV x F2 Disco x NV x F2 Hedin/2 x Betty/3 41 x F2 Total 539 F2s 24
25 MUTAGENESIS
26 26
27 Hedin/2 inbred line ~Medium-small seeds Spring habit Highly autofertile Highly inbred Summer 2013 multiplication 2x pollinator-free cages Isolation distance 2 x single inbred plant progenies 300 plants total c. 25,000 seeds 27
28 Mutagenesis next steps Spring 2014 >10,000 M 0 harvest bulk of >1,000,000 M 1 Spring 2015 screen batches of 50,000 M 2 using a high density seedling screen every 10 days Herbicide targets amidosulfuron (Bayer Eagle) TBC 28
29 Sebastien 1992 sulfonylurea-resistant soybean patent 29
30 Acknowledgements: University of Reading Laurence Hansen, Caroline Hadley, Deepti Angra NIAB Jane Thomas, Amanda Cottage, Anne Webb, Krystyna Gostciewicz, Douglas Hobbs Visiting Scientist (INAT,Tunisia) - Khalil Khamassi Wherrys - Peter Smith NPZ-Lembke Olaf Sass Collaborators Ana Maria Torres (IFAPA), Wolfgang Link (Goettingen), Fred Stoddard (Helsinki), Gérard Duc (INRA-Dijon), Fouad Maalouf, Francis Ogbonnaya (ICARDA), Mahmoud Zeid (Alexandria)
31 THANK YOU! TAK!
Flanking SNP markers for vicine convicine concentration in faba bean (Vicia faba L).
Flanking SNP markers for vicine convicine concentration in faba bean (Vicia faba L). Article Accepted Version Khazaei, H., O'Sullivan, D. M., Jones, H., Pitts, N., Sillanpää, M. J., Pärssinen, P., Manninen,
More informationPulse Improvement: Chickpea and Field Pea. W. Erskine & T.N. Khan CLIMA/DAFWA
Pulse Improvement: Chickpea and Field Pea W. Erskine & T.N. Khan CLIMA/DAFWA Content Pulse (Field Pea & Chickpea) importance Chickpea Breeding aims Current approaches Future Field Pea Breeding aims Current
More informationApplying next-generation sequencing to enable marker-assisted breeding for adaptive traits in a homegrown haricot bean (Phaseolus vulgaris L.
Applying next-generation sequencing to enable marker-assisted breeding for adaptive traits in a homegrown haricot bean (Phaseolus vulgaris L.) Andrew Tock Prof Eric Holub & Dr Guy Barker University of
More informationPROJECT CODE BRE1010
1 TITLE Implementation of Markers for Pulses (imap) PROJECT CODE BRE1010 INVESTIGATORS Co-Principal Investigators: Bunyamin Tar an and Kirstin Bett, Department of Plant Sciences, University of Saskatchewan
More informationBrassica carinata crop improvement & molecular tools for improving crop performance
Brassica carinata crop improvement & molecular tools for improving crop performance Germplasm screening Germplasm collection and diversity What has been done in the US to date, plans for future Genetic
More informationGBS Usage Cases: Examples from Maize
GBS Usage Cases: Examples from Maize Jeff Glaubitz (jcg233@cornell.edu) Senior Research Associate, Buckler Lab, Cornell University Panzea Project Manager Cornell IGD/CBSU Workshop June 17 18, 2013 Some
More informationKey access and utilization descriptors for faba bean genetic resources
Key access and utilization descriptors for faba bean genetic resources This list consists of an initial set of characterization and evaluation descriptors for faba bean utilization. This strategic set
More informationI.1 The Principle: Identification and Application of Molecular Markers
I.1 The Principle: Identification and Application of Molecular Markers P. Langridge and K. Chalmers 1 1 Introduction Plant breeding is based around the identification and utilisation of genetic variation.
More informationMarker types. Potato Association of America Frederiction August 9, Allen Van Deynze
Marker types Potato Association of America Frederiction August 9, 2009 Allen Van Deynze Use of DNA Markers in Breeding Germplasm Analysis Fingerprinting of germplasm Arrangement of diversity (clustering,
More informationPharmacogenetics: A SNPshot of the Future. Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001
Pharmacogenetics: A SNPshot of the Future Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001 1 I. What is pharmacogenetics? It is the study of how genetic variation affects drug response
More informationSolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze
SolCAP Solanaceae Coordinated Agricultural Project Supported by the National Research Initiative Plant Genome Program of USDA CSREES for the Improvement of Potato and Tomato Executive Commitee : David
More informationUC Davis Bean Breeding Program
UC Davis Bean Breeding Program: Garbanzos 2017 2018 Report to the California Dry Bean Advisory Board Researchers: A. Palkovic (Assistant Specialist), Kay Watt (Graduate student), P. Gepts (Principal Investigator)
More informationDissecting the genetic basis of grain size in sorghum. Yongfu Tao DO NOT COPY. Postdoctoral Research Fellow
Dissecting the genetic basis of grain size in sorghum Yongfu Tao Postdoctoral Research Fellow Why study grain size? The importance of grain size: Key yield component Key quality issue for grain growers
More informationAssociation Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010
Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010 Traditional QTL approach Uses standard bi-parental mapping populations o F2 or RI These have a limited number of
More informationUsage Cases of GBS. Jeff Glaubitz Senior Research Associate, Buckler Lab, Cornell University Panzea Project Manager
Usage Cases of GBS Jeff Glaubitz (jcg233@cornell.edu) Senior Research Associate, Buckler Lab, Cornell University Panzea Project Manager Cornell CBSU Workshop Sept 15 16, 2011 Some potential applications
More informationA brief introduction to Marker-Assisted Breeding. a BASF Plant Science Company
A brief introduction to Marker-Assisted Breeding a BASF Plant Science Company Gene Expression DNA is stored in chromosomes within the nucleus of each cell RNA Cell Chromosome Gene Isoleucin Proline Valine
More informationIdentifying Genes Underlying QTLs
Identifying Genes Underlying QTLs Reading: Frary, A. et al. 2000. fw2.2: A quantitative trait locus key to the evolution of tomato fruit size. Science 289:85-87. Paran, I. and D. Zamir. 2003. Quantitative
More informationUtilization of Genomic Information to Accelerate Soybean Breeding and Product Development through Marker Assisted Selection
Utilization of Genomic Information to Accelerate Soybean Breeding and Product Development through Marker Assisted Selection Presented by: Ruth Wagner August 5, 2014 SOY2014 Rico Caldo,Vergel Concibido,
More informationFuture (of) GM feed ingredients for livestock
Future (of) GM feed ingredients for livestock Drivers for GM products in feeds 1. Agronomic traits providing increased yield or efficiency Pest resistance Stress resistance Herbicide tolerance 2. Non-food
More informationGenomic resources and gene/qtl discovery in cereals
Genomic resources and gene/qtl discovery in cereals Roberto Tuberosa Dept. of Agroenvironmental Sciences & Technology University of Bologna, Italy The ABDC Congress 1-4 March 2010 Gudalajara, Mexico Outline
More informationAssociation Mapping in Wheat: Issues and Trends
Association Mapping in Wheat: Issues and Trends Dr. Pawan L. Kulwal Mahatma Phule Agricultural University, Rahuri-413 722 (MS), India Contents Status of AM studies in wheat Comparison with other important
More informationEffectiveness of breeding methods for production of superior genotypes and maintenance of genetic variance in Faba Bean (Vicia faba, L.
American Journal of Life Sciences 2015; 3(1): 11-16 Published online January 20, 2015 (http://www.sciencepublishinggroup.com/j/ajls) doi: 10.11648/j.ajls.20150301.13 ISSN: 2328-5702 (Print); ISSN: 2328-5737
More informationPulse Crop Genetic Improvement Network:
Pulse Crop Genetic Improvement Network: Abstract: Pulse crops and Defra policy objectives: Crop diversification and lowering inputs are major drivers for sustainable agricultural policy. Pulse crops can
More informationUK Wheat Productivity Research Targets and Needs. Commercial Wheat Breeding Perspective. Dr. Richard Summers RAGT Seeds
UK Wheat Productivity Research Targets and Needs Commercial Wheat Breeding Perspective Dr. Richard Summers RAGT Seeds UK Wheat Productivity Research Targets and Needs Global population growth Increased
More informationNew Plant Breeding Techniques Group 1 Targeted Mutagenesis
WORKSHOP COMPERATIVE SITUATION OF NEW PLANT BREEDING TECHNIQUES 12-13 SEPTEMBER 2011 SEVILLE, SPAIN New Plant Breeding Techniques Group 1 Targeted Mutagenesis Maria Lusser Joint Research Centre, European
More informationMap-Based Cloning of Qualitative Plant Genes
Map-Based Cloning of Qualitative Plant Genes Map-based cloning using the genetic relationship between a gene and a marker as the basis for beginning a search for a gene Chromosome walking moving toward
More informationPhilippines Rice Breeding and Production. Elvira D. Morales Plant Variety Protection Office Philippines
Philippines Rice Breeding and Production Elvira D. Morales Plant Variety Protection Office Philippines O GOAL Increase productivity in the different rice growing ecosystems O OBJECTIVE To identify high
More informationSelection and breeding process of the crops. Breeding of stacked GM products and unintended effects
Selection and breeding process of the crops. Breeding of stacked GM products and unintended effects Critical steps in plant transformation Getting the gene into the plant genome Getting the plant cell
More informationSupplementary Data 1.
Supplementary Data 1. Evaluation of the effects of number of F2 progeny to be bulked (n) and average sequencing coverage (depth) of the genome (G) on the levels of false positive SNPs (SNP index = 1).
More informationDevelopment of Early Maturing GEM lines with Value Added Traits: Moving U.S. Corn Belt GEM Germplasm Northward
Development of Early Maturing GEM lines with Value Added Traits: Moving U.S. Corn Belt GEM Germplasm Northward Marcelo J. Carena Department of Plant Sciences, North Dakota State University (NDSU) I am
More informationSept 2. Structure and Organization of Genomes. Today: Genetic and Physical Mapping. Sept 9. Forward and Reverse Genetics. Genetic and Physical Mapping
Sept 2. Structure and Organization of Genomes Today: Genetic and Physical Mapping Assignments: Gibson & Muse, pp.4-10 Brown, pp. 126-160 Olson et al., Science 245: 1434 New homework:due, before class,
More informationChapter 1 Molecular Genetic Approaches to Maize Improvement an Introduction
Chapter 1 Molecular Genetic Approaches to Maize Improvement an Introduction Robert T. Fraley In the following chapters prominent scientists will discuss the recent genetic improvements in maize that have
More informationStrategies for Funding Problem Solving Research on the Alliums. Michael J. Havey USDA-ARS and University of Wisconsin
Strategies for Funding Problem Solving Research on the Alliums Michael J. Havey USDA-ARS and University of Wisconsin USDA-NIFA Specialty Crops Research Initiative (SCRI) USDA Specialty Crops Research Initiative
More informationHCS806 Summer 2010 Methods in Plant Biology: Breeding with Molecular Markers
HCS806 Summer 2010 Methods in Plant Biology: Breeding with Molecular Markers Lecture 7. Populations The foundation of any crop improvement program is built on populations. This session will explore population
More informationCertified Reference Materials AOCS 0707-C5
Mail Address: AOCS, P.O. Box 17190, Urbana, IL 61803-7190 USA Street Address: AOCS, 2710 S. Boulder Drive, Urbana, IL 618026996 USA Phone: +1-217-359-2344; Fax: +1-217-351-8091; E-Mail: CRM@aocs.org; Web:
More informationDevelopments in Biotechnology in the U.S. Wheat Sector. Shannon Schlecht, Director of Policy U.S. Wheat Associates
Developments in Biotechnology in the U.S. Wheat Sector Shannon Schlecht, Director of Policy U.S. Wheat Associates Biotech Defined Biotechnologically derived crops also referred to as: Genetically modified
More informationJon Degner PhD candidate Centre for Forest Conservation Genetics University of British Columbia
Molecular methods in forestry: From seeds to trees Connections Through Seed Surrey, BC 17 October, 2018 Jon Degner PhD candidate Centre for Forest Conservation Genetics University of British Columbia jonathan.degner@ubc.ca
More informationGENETICS - CLUTCH CH.20 QUANTITATIVE GENETICS.
!! www.clutchprep.com CONCEPT: MATHMATICAL MEASRUMENTS Common statistical measurements are used in genetics to phenotypes The mean is an average of values - A population is all individuals within the group
More informationDEPARTMENT OF PLANT BREEDING AND GENETICS
DEPARTMENT OF PLANT BREEDING AND GENETICS Course No. PBG 511 (Principles of Genetics and Cell Biology ) Cr. Hr. 3(2+1) Teacher Dr. D.K.Gothwal 16 5.10.15 Extra chromosomal inheritance 17 6.10.15 Concepts
More informationIntegrating and Leveraging Cereal and Grass Genome Resources. David Marshall Information and Computational Sciences Group
Integrating and Leveraging Cereal and Grass Genome Resources David Marshall Information and Computational Sciences Group David.Marshall@hutton.ac.uk What I m going to cover Brief overview of the new barley
More informationGenomic selection in American chestnut backcross populations
Genomic selection in American chestnut backcross populations Jared Westbrook The American Chestnut Foundation TACF Annual Meeting Fall 2017 Portland, ME Selection against blight susceptibility in seed
More informationABSTRACT : 162 IQUIRA E & BELZILE F*
ABSTRACT : 162 CHARACTERIZATION OF SOYBEAN ACCESSIONS FOR SCLEROTINIA STEM ROT RESISTANCE AND ASSOCIATION MAPPING OF QTLS USING A GENOTYPING BY SEQUENCING (GBS) APPROACH IQUIRA E & BELZILE F* Département
More informationChina-CIMMYT Partnership: The Past, and the Future
China-CIMMYT Partnership: The Past, and the Future Prof. Chun-Ming Liu Director General Institute of Crop Sciences (ICS) Chinese Academy of Agricultural Sciences (CAAS) China: providing sufficient food
More informationDEVELOPMENT OF DNA MARKER SELECTION TOOLS IN AUSTRALIA S MAJOR PLANTATION EUCALYPTS
DEVELOPMENT OF DNA MARKER SELECTION TOOLS IN AUSTRALIA S MAJOR PLANTATION EUCALYPTS Dr Simon Southerton Gondwana Genomics Pty Ltd FWPA Webinar, 9 th Sept 2015 Gondwana Genomics Delivers marker-assisted
More informationAP 2010 Biotechnologie-Bioressources
AP 2010 Biotechnologie-Bioressources Développer de nouvelles variétés de blé pour une agriculture durable: une approche intégrée de la génomique à la sélection Breeding for economically and environmentally
More informationLegumes For Sustainable Agriculture
Legumes For Sustainable Agriculture ARC ITRH 2015 Presented by Associate Professor Brent N. Kaiser Centre for Carbon Water and Food Faculty of Agriculture and Environment Camden NSW. Legumes for Sustainable
More informationGENOMITE: New generation sustainable tools to control emerging mite pests under climate change. Jerry Cross NIAB EMR, Stephane Rombauts, VIB Belgium
GENOMITE: New generation sustainable tools to control emerging mite pests under climate change Jerry Cross NIAB EMR, Stephane Rombauts, VIB Belgium Two-spotted spider mite Tetranychus urticae: an increasing
More informationMolecular and Applied Genetics
Molecular and Applied Genetics Ian King, Iain Donnison, Helen Ougham, Julie King and Sid Thomas Developing links between rice and the grasses 6 Gene isolation 7 Informatics 8 Statistics and multivariate
More informationImproving barley and wheat germplasm for changing environments
AWARD NUMBER: 2011-68002-30029 Improving barley and wheat germplasm for changing environments Triticeae CAP (T-CAP) 56 participants, 28 institutions, 21 states Integration of wheat and barley research
More informationSCSC, GENE, MEPS and BIOT 654: Analysis of Complex Genomes (Lec) Spring 2018
SCSC, GENE, MEPS and BIOT 654: Analysis of Complex Genomes (Lec) 1. Instructor: Spring 2018 Name: Professor Dr. Hongbin Zhang E-mail: hbz7049@tamu.edu Office: 427A Heep Center Office Phone: 862-2244 Office
More informationCertified Reference Materials AOCS 0707-C6
Street Address: AOCS, 2710 S. Boulder Drive Urbana, IL 61802-6996 USA Phone: +1-217-359-2344 Fax: +1-217-351-8091 E-Mail: CRM@aocs.org Web: www.aocs.org Certified Reference Materials AOCS 0707-C6 Report
More informationPROGRESS REPORT TO THE NEBRASKA DRY BEAN COMMISSION. Core Project Title
PROGRESS REPORT TO THE NEBRASKA DRY BEAN COMMISSION Core Project Title Selecting for and Improving Chickpea Adaptation to Western Nebraska WBS 26-6243-0204-005 Submitted: April 22, 2009 Investigators:
More informationBiotechnology & Art HC 177 FOOD: nourishment
Biotechnology & Art HC 177 FOOD: nourishment Gregor Mendel (left), in the 1850s made the first observation that plant traits are inherited. Mendel noticed that when green and yellow peas were crossed,
More informationIdentifying fire blight resistance in M. sieversii for scion breeding. PI: Jay Norelli Co-PI (2): Kate Evans
FINAL PROJECT REPORT Project Title: Identifying fire blight resistance in M. sieversii for scion breeding PI: Jay Norelli Co-PI (2): Kate Evans Organization: USDA-ARS-AFRS Organization: WSU Tree Fruit
More informationIntroduction to the course
8/19/08 Introduction to the course FISH/CMBL 7660 Molecular Genetics and Biotechnology Instructor: John Liu Tel. 334-844-8727 Zliu@acesag.auburn.eduauburn edu Why Molecular Genetics Capability to across
More informationDeveloping New GM Products and Detection Methods
Developing New GM Products and Detection Methods Dave Grothaus Monsanto Company Slides Thanks to: International Life Sciences Institute Crop Life International Indus try Colleagues Hope Hart - Syngenta
More informationCertified Reference Materials AOCS 0306-F6
Mail Address: AOCS, P.O. Box 17190, Urbana, IL 61803-7190 USA Street Address: AOCS, 2710 S. Boulder Drive, Urbana, IL 618026996 USA Phone: +1-217-359-2344; Fax: +1-217-351-8091; E-Mail: CRM@aocs.org; Web:
More informationSoybean IPM Elements Revised March, 2012
Soybean IPM Elements Revised March, 2012 Edited by Jim Jasinski Contributing Authors: Ron Hammond, Andy Michels (Entomology); Mark Loux, Mark Sulc, Peter Thomison (Horticulture & Crop Science); Robert
More informationCertified Reference Materials AOCS 0707-C5
Street Address: AOCS, 2710 S. Boulder Drive Urbana, IL 618026996 USA Phone: +1-217-359-2344; Fax: +1-217-351-8091; E-Mail: CRM@aocs.org; Web: www.aocs.org Certified Reference Materials AOCS 0707-C5 Report
More informationA high density GBS map of bread wheat and its application for genetic improvement of the crop
A high density GBS map of bread wheat and its application for genetic improvement of the crop Sukhwinder-Singh Wheat-Lead Seeds of Discovery (suk.singh@cgiar.org) International Maize and Wheat Improvement
More informationSTANDER, l.r., Betaseed, Inc. P.O. Box 859, Kimberly, ID The relationship between biotechnology and classical plant breeding.
STANDER, l.r., Betaseed, Inc. P.O. Box 859, Kimberly, ID 83341. The relationship between biotechnology and classical plant breeding. Plant breeders have been relatively successful over the years. Duvick
More informationGene Mapping in Natural Plant Populations Guilt by Association
Gene Mapping in Natural Plant Populations Guilt by Association Leif Skøt What is linkage disequilibrium? 12 Natural populations as a tool for gene mapping 13 Conclusion 15 POPULATIONS GUILT BY ASSOCIATION
More informationAgricultural Applications for Genome Sequencing
Agricultural Applications for Genome Sequencing AEIC April 2012 Presented by Joe Clarke, NGS Platform Lead, Syngenta RTP NC 2 Syngenta at Home and Abroad Who we are and what we do Syngenta is one of the
More informationBreeding plants and animals for mitigation and adaptation to a changed climate in the Nordic countries
Breeding plants and animals for mitigation and adaptation to a changed climate in the Nordic countries www.slu.se/mistrabiotech Lotta Rydhmer, Dept. Animal Breeding and Genetics, SLU LH Zhu, E Andreasson,
More informationBiol 432L Midterm Oct 6, 2008 Name: 1. Midterm 1, Answer Key Oct. 26, 2009
Biol 432L Midterm Oct 6, 2008 Name: 1 Midterm 1, Answer Key Oct. 26, 2009 Honor Pledge: I have neither given nor received any unauthorized help on this exam: Name Printed: Signature: 1a. (2 pts) Imagine
More informationGrain Legumes Highlights,
Review Meeting Grain Legumes 2012-2016 Grain Legumes Highlights, 2012-2016 Shoba Sivasankar Director CRP Grain Legumes S.Sivasankar@cgiar.org 4 Oct 2016 http://grainlegumes.cgiar.org Leveraging legumes
More informationCowpea Breeding. Ainong Shi. University of Arkansas
Cowpea Breeding Ainong Shi University of Arkansas UAF Vegetable Breeding UAF AR USA International Collaboration Classic Breeding Molecular Breeding Student Training Classic breeding such as crossing, generation
More informationREDUCING THE LEVEL OF ANTI-NUTRITIONAL NUTRITIONAL FACTORS IN CANOLA MEAL
REDUCING THE LEVEL OF ANTI-NUTRITIONAL NUTRITIONAL FACTORS IN CANOLA MEAL Randall Weselake University of Alberta Jeff Parker Genome Alberta Canola Meal Research Meeting September 28, 2007 DESIGNING OILSEEDS
More informationSupplementary Text. eqtl mapping in the Bay x Sha recombinant population.
Supplementary Text eqtl mapping in the Bay x Sha recombinant population. Expression levels for 24,576 traits (Gene-specific Sequence Tags: GSTs, CATMA array version 2) was measured in RNA extracted from
More informationCertified Reference Materials AOCS 0707-C4
Mail Address: AOCS, P.O. Box 17190, Urbana, IL 61803-7190 USA Street Address: AOCS, 2710 S. Boulder Drive, Urbana, IL 618026996 USA Phone: +1-217-359-2344; Fax: +1-217-351-8091; E-Mail: CRM@aocs.org; Web:
More informationCustomer case study. Hy-Line Internatio nal
Today s laying hens are each capable of producing over 300 eggs per year. The world s human population is growing rapidly and the high-quality protein and nutrient-rich egg is an inexpensive and transportable
More informationBIOBREED & NUTRIEFFICIENT
BIOBREED & NUTRIEFFICIENT Søren K. Rasmussen Plant & Soil Science Section Molecular Plant Breeding Workshop on Nordic PPP on Pre-breeding 17th -18th February 2011, Conference Hotel Siikaranta, Finland
More informationBioinformatics, in general, deals with the following important biological data:
Pocket K No. 23 Bioinformatics for Plant Biotechnology Introduction As of July 30, 2006, scientists around the world are pursuing a total of 2,126 genome projects. There are 405 published complete genomes,
More informationPathway approach for candidate gene identification and introduction to metabolic pathway databases.
Marker Assisted Selection in Tomato Pathway approach for candidate gene identification and introduction to metabolic pathway databases. Identification of polymorphisms in data-based sequences MAS forward
More informationUtilization of the IWGSC Resources: Application to Wheat Breeding
Utilization of the IWGSC Resources: Application to Wheat Breeding Wheat Breeding: Securing Tomorrow s Profitability. Dr. Curtis J. Pozniak IWGSC Workshop, PAG, Jan 2014 Use and/or distribution of these
More informationSensitivity of two garden pea genotypes to physical and chemical mutagens
Slavka Kalapchieva Nasya Tomlekova Sensitivity of two garden pea genotypes to physical and chemical mutagens Authors address: Department of Breeding, Variety Maintenance and Introduction, Maritsa Vegetable
More informationTrudy F C Mackay, Department of Genetics, North Carolina State University, Raleigh NC , USA.
Question & Answer Q&A: Genetic analysis of quantitative traits Trudy FC Mackay What are quantitative traits? Quantitative, or complex, traits are traits for which phenotypic variation is continuously distributed
More informationCharacterization of resistance to Clover yellow vein virus in pea. Sun Hee CHOI, Ryoko SHIMADA, Go ATSUMI, Kenji NAKAHARA and Ichiro UYEDA
Characterization of resistance to Clover yellow vein virus in pea Sun Hee CHOI, Ryoko SHIMADA, Go ATSUMI, Kenji NAKAHARA and Ichiro UYEDA Graduated school of Agriculture Hokkaido University Sapporo, Japan
More informationGenetic modification hidden in modern plant breeding techniques
27.-28. April 2009, FIAP, Paris, France Genetic modification hidden in modern plant breeding techniques University of Amsterdam Pays Bas Novel breeding techniques: - The introduction of Cytoplasmic Male
More informationBiotechnology and Genetically Modified Crops
Biotechnology and Genetically Modified Crops Suggestions for Your Presentation Use a Video to start your presentation. A couple of videos were provided with this slide deck that could be used or use another
More informationHCS806 Summer 2010 Methods in Plant Biology: Breeding with Molecular Markers
HCS Summer Methods in Plant Biology: Breeding with Molecular Markers Lecture 1. This course, breeding with molecular markers, will examine the role of marker assisted selection or genome assisted selection
More informationFruit and Nut Trees Genomics and Quantitative Genetics
Fruit and Nut Trees Genomics and Quantitative Genetics Jasper Rees Department of Biotechnology University of the Western Cape South Africa jrees@uwc.ac.za The Challenges of Tree Breeding Long breeding
More informationDeveloping an integrated system for Asian Soybean Rust control
Developing an integrated system for Asian Soybean Rust control VIII Congresso Brasileiro de Soja, Goiânia, Brasil 13 June 2018 Dr. Karen Century, Project Manager BASF We create chemistry Our chemistry
More informationPatterns and mechanisms of recombination at the barley VRN- H1 locus. James Cockram
Patterns and mechanisms of recombination at the barley VRN- H1 locus James Cockram Talk Outline: Project background Genetic markers used Homologous and non-homologous recombination within BM5A Putative
More informationGREG GIBSON SPENCER V. MUSE
A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.
More informationCertified Reference Materials AOCS 0306-G5
Mail Address: AOCS, P.O. Box 17190, Urbana, IL 61803-7190 USA Street Address: AOCS, 2710 S. Boulder Drive, Urbana, IL 618026996 USA Phone: +1-217-359-2344; Fax: +1-217-351-8091; E-Mail: general@aocs.org;
More informationGenetics. Genetics- is the study of all manifestation of inheritance from the distributions of traits to the molecules of the gene itself
What is Genetics? Genetics Mapping of genes Basis of life Inheritable traits Abnormalities Disease Development DNA RNA Proteins Central dogma - Watson & Crick Genes- segments of DNA that code for proteins
More informationCertified Reference Materials AOCS 0711-D3
Mail Address: AOCS, P.O. Box 17190, Urbana, IL 61803-7190 USA Street Address: AOCS, 2710 S. Boulder Drive, Urbana, IL 618026996 USA Phone: +1-217-359-2344; Fax: +1-217-351-8091; E-Mail: CRM@aocs.org; Web:
More informationNew Plant Breeding Techniques Group 3 Transgenic construct driven breeding
WORKSHOP COMPERATIVE SITUATION OF NEW PLANT BREEDING TECHNIQUES 12-13 SEPTEMBER 2011 SEVILLE, SPAIN 1 New Plant Breeding Techniques Group 3 Transgenic construct driven breeding Maria Lusser Joint Research
More informationMission Icarda/Icrisat/Ciat/AARINENA
Mission Icarda/Icrisat/Ciat/AARINENA Montpellier, Clermont-Ferrand, Dijon (29/03/09 03/04/09) Tentative summary Three strong ideas emerge from this mission: - There are a number of research questions in
More informationFunctional genomics to improve wheat disease resistance. Dina Raats Postdoctoral Scientist, Krasileva Group
Functional genomics to improve wheat disease resistance Dina Raats Postdoctoral Scientist, Krasileva Group Talk plan Goal: to contribute to the crop improvement by isolating YR resistance genes from cultivated
More informationUpdated sesame genome assembly and fine mapping of plant height and seed coat color QTLs using a new high-density genetic map
Wang et al. BMC Genomics (26) 7:3 DOI.86/s2864-5-236-4 RESEARCH ARTICLE Open Access Updated sesame genome assembly and fine mapping of plant height and seed coat color QTLs using a new high-density genetic
More informationApplication of next generation sequencing of a begomovirusresistant. KASPar assay for SNP detection of the Ty1-Ty3 region
Application of next generation sequencing of a begomovirusresistant inbred to design a KASPar assay for SNP detection of the Ty1-Ty3 region Menda, N. 1, S. Strickler 1, D.M. Dunham 1, D.P. Maxwell 2, L.
More informationDivision of Genetics, ICAR-Indian Agricultural Research Institute, New Delhi
Circular ICAR--HRM Training Programme for Scientific Staff ICAR 2017--18 2017 Genomics--Assisted Breeding Genomics for Crop Improvement (March 1-21, 2018) Programme Director: Dr. Ashok K. Singh Division
More informationTraditional Genetic Improvement. Genetic variation is due to differences in DNA sequence. Adding DNA sequence data to traditional breeding.
1 Introduction What is Genomic selection and how does it work? How can we best use DNA data in the selection of cattle? Mike Goddard 5/1/9 University of Melbourne and Victorian DPI of genomic selection
More informationOptimizing Traditional and Marker Assisted Evaluation in Beef Cattle
Optimizing Traditional and Marker Assisted Evaluation in Beef Cattle D. H. Denny Crews, Jr., 1,2,3 Stephen S. Moore, 2 and R. Mark Enns 3 1 Agriculture and Agri-Food Canada Research Centre, Lethbridge,
More informationUSDA Specialty Crops Research Initiative (SCRI)
USDA Specialty Crops Research Initiative (SCRI) USDA Specialty Crops Research Initiative (SCRI) THANKS TO YOU!!! Responding to listening sessions by federal agencies Providing information on specialty
More informationHOW OUR FOOD IS GROWN
OPEN TO YOUR QUESTIONS ABOUT HOW OUR FOOD IS GROWN Genetically modified organisms (GMOs) are a major topic of discussion today. Across our society, media and the Internet, a growing number of people have
More informationApplying Genotyping by Sequencing (GBS) to Corn Genetics and Breeding. Peter Bradbury USDA/Cornell University
Applying Genotyping by Sequencing (GBS) to Corn Genetics and Breeding Peter Bradbury USDA/Cornell University Genotyping by sequencing (GBS) makes use of high through-put, short-read sequencing to provide
More informationGenetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection
Genetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection Awais Khan Adaptation and Abiotic Stress Genetics, Potato and sweetpotato International Potato
More information