ONLINE DATA SUPPLEMENT
|
|
- Dale Hodges
- 5 years ago
- Views:
Transcription
1 ONLINE DATA SUPPLEMENT mir-199a-5p silencing regulates the unfolded protein response in COPD and α1 antitrypsin deficiency Tidi Hassan, Tomás P. Carroll, Patrick G. Buckley, Robert Cummins, Shane J. O Neill, Noel G. McElvaney, Catherine M. Greene. E1
2 METHODS Isolation, culture and treatment of peripheral blood monocytes Mononuclear cells were isolated from heparinized venous peripheral blood. Density gradient centrifugation was carried out using Lymphoprep (Axis Shield). Briefly the mononuclear cell band was aspirated, washed with HBSS (Invitrogen) and purified using the EasySep Human CD14 Selection Cocktail (StemCell Technologies). The cells were cultured in RPMI 1640 containing 10% (v/v) fetal calf serum (Life Technologies) and 1% penicillin/streptomycin (Invitrogen) at 37 o C in a 5% CO 2 atmosphere. MM monocytes were treated with DMSO (vehicle control) or Thapsigargin (TG) (Sigma-Aldrich) at 10, 50 or 100nM for 1 hour. Quantitative assessment of mrna and mirna levels RNA was isolated using TRI reagent (Sigma-Aldrich) according to the manufacturer s instructions. Equal quantities of RNA calculated using a Nanodrop 8000 (ThermoScientific, Welmington) were reverse transcribed into cdna using the Quantitect Reverse Transcription kit (Qiagen). The cdna was used as template for quantitative real-time PCR. Oligonucleotide primers were synthesized (MWG Operon) (Table E1) and quantitative PCR reactions performed in 20µl containing 2µl of template cdna, SYBR Green MasterMix (Roche) and 10 pmol of each primer. mirna expression was measured using Taqman mirna assays (Applied Biosystems) according to manufacturer s instructions. Amplification of both mrna and mirna was performed on the Roche LC480 Lightcycler in triplicate, including no-template controls. Relative expression of mrna and mirna relative to GAPDH and U6 snrna was determined using the 2 - Ct method (26). mirna expression profiling using the ncounter mirna Expression Assay mirnas were profiled commercially from asymptomatic MM and ZZ monocytes (n=3 in each group) with the ncounter mirna Expression Assay (Nanostring Technologies). The samples were prepared with the ncounter mirna Sample Preparation Kit according to manufacturer s instructions. Raw data was normalized based on the relative number of positive and negative control counts and adjusted for probe and background corrections for each mirna as instructed in the ncounter Data Analysis Guidelines. E2
3 DNA isolation, sodium bisulfite conversion and pyrosequencing analysis Genomic DNA was isolated from the monocytes of asymptomatic and symptomatic MM and ZZ individuals (n=3 from each group) and bisulfite converted using the EZ DNA Methylation Direct kit (ZymoResearch) as per the manufacturer s instructions. Commercialized non-methylated, methylated (Epigen Dx) and bisulfite converted DNA (ZymoResearch) were used as quality controls. PCR amplification was performed on 25ng of the bisulfite-treated DNA using the PyroMark Q24 CpG LINE-1 assay (Qiagen) for amplification of the LINE-1 retrotransposable elements. PCR primers for mir-199a-2 promoter were designed using the Bisulfite Primer Seeker 12S software (ZymoResearch) and were as follows: forward primer, 5 - TGGTTAAGYGGTATTTGGTAAATTTTAATAGATTTAG-3 and biotinylated reverse primer 5 -TAACCTTCCTAATTTCCCTCAACTATTTTAAC-3. The resultant PCR products were analyzed by gel electrophoresis to confirm the size of the product and rule out the formation of primer dimers. PCR products were subjected to quantitative pyrosequencing analysis using the PyroMark Q24 CpG LINE-1 and PyroMark Gold Q24 (Qiagen) assay for LINE-1 elements and mir-199a-2 promoter, respectively according to the manufacturer s protocol. The sequencing primers for mir-199a-2 were; 5 -GATTTGTTAGAAGATTTGA-3 for CpG sites 1 and 2 and 5 -GATGTTTTAAATAAAAATTG-3 for CpG site 3 designed using the PyroMark Assay Design Software 2.0. Pyrosequencing analysis was performed using the PyroMark Q24 Software (Qiagen). Methylation inhibitor studies. Monocytic THP-1 cells (1x10 5 in triplicate) were left untreated or treated with 2 µg/ml of 5-Aza-2 Deoxycytidine (5 AZA) or DMSO vehicle for 48 h. Luciferase reporter plasmid transfection HEK293 cells (1 x 10 5 in triplicate) were transfected with 250 ng of a luciferase reporter vector containing either the full-length wild type (WT) 3 UTR of ATF6 (pmir-atf6 3 UTR, Origene), NFκB1 for p50 (pgl3-p50 3 UTR as a gift from Prof. Gao, Shandong University Medical School) or RELA for p65 (pag23/rela 3 UTR, Addgene), and 100ng of the reference Renilla luciferase reporter plasmid prlsv40 (Promega). The SERPINA1 3 UTR plasmid vector (Origene) was used as a negative control. Negative control reporter plasmids containing the full-length 3 UTR of ATF6, NFκB1 and RELA with mutations in the E3
4 predicted binding sites for mir-199a-5p was constructed by site-directed mutagenesis using the QuikChange Site-Directed Mutagenesis Kit (Agilent). Mutagenic oligonucleotide primers were designed individually according to the desired mutation (highlighted in bold) using the following primers: ATF6 3 UTR, forward primer, 5'- CCCATCTATTTGGAAAGCAAGGGAATTCAGATGCAAGAG-3, reverse primer 5'- CTCTTGCATCTGAATTCCCTTGCTTTCCAAATAGATGGG-3'; NFκB1, forward primer 5'-GTATCTAGCAATCACAACTCGGGCTGAGCGGATGCATCTG-3', reverse primer 5'- CAGATGCATCCGCTCAGCCCGAGTTGTGATTGCTAGATAC-3'; RELA 3 UTR, forward primer 5'-CAGCCCCTGTATGGCTTAGGCATTGTCCCTGTG-3', reverse primer 5'-CACAGGGACAATGCCTAAGCCATACAGGGGCTG-3'. Cells were co-transfected with a total of 30nM synthetic pre-mir-199a-5p or a scrambled control (Applied Biosystems) using Genejuice (Novagene) for plasmid DNA and Ribojuice (Novagen) for mirna in OptimMEM reduced serum media (Life Technologies) as per the recommended conditions. Cell lysates were prepared 24 hours after transfection, and measurement of firefly luciferase was performed using the Luciferase assay system (Promega) and coelenterazine (Marker Gene Technologies). Firefly luciferase activity was normalized to the Renilla luciferase activity. Transfection of pre-mirs and anti-mirs for mirna overexpression/inhibition Isolated monocytes (1x10 5 cells in triplicate) were non-transfected or transfected with 60nM of a scrambled control or synthetic pre- or anti-mir-199a-5p (Applied Biosystems) using siport-neofx (Invitrogen) in OptiMEM-reduced serum media (Life Technologies). A fluorescently labeled non-targeting miridian mirna mimic (Dharmacon) was used to monitor transfection efficiency. After 48h total RNA was extracted with TRI reagent (Sigma- Aldrich) as per manufacturer s protocol. Equal volumes of cell lysates transfected for 48h were prepared for protein analysis using RIPA buffer (50mM Tris, 150mM sodium chloride, 0.1% SDS, 0.5% sodium deoxycholate, 1% Triton X-100). Immediately before use, this buffer was supplemented with complete mini protease inhibitor (Roche). Western blot analyses Equal volumes of cell lysates were separated by NuPage Novex 4-12% Bis-Tris Gels (Life Technologies) in MOPS SDS running buffer (Life Technologies) and transferred onto nitrocellulose membranes (Sigma-Aldrich). Membranes were then probed with primary E4
5 antibodies for either mouse anti-atf6 (Imgenex, 1:500 dilution), rabbit anti-p50 (Santa Cruz, 1:1000 dilution) or mouse anti-p65 (Santa Cruz, 1:1000 dilution). Signal detection was determined using the Immobilon Western HRP Substrate (Milipore) on the Syngene G:Box chemi XL gel documentation system. Densitometry was performed using GeneTools software on the same system. Analysis of XBP-1 mrna splicing XBP-1 mrna splicing was analyzed using an assay described by Calfon et al. (27). RNA was isolated using TRI reagent (Sigma-Aldrich) and cdna synthesized using the method described above. The following primers were used to amplify XBP-1 cdna: forward primer 5 -AAACAGAGTAGCAGCTCAGACTGC-3 ; reverse primer 5 - TCCTTCTGGGTAGACCTCTGGGA-3. The amplified products were resolved on a 2.5% agarose gel to reveal a product of 480 bp and 454 bp for unspliced and spliced XBP-1, respectively. Statistical analysis All analyses were performed using GraphPad PRISM 4.0 (San Diego, CA). Results are expressed as the mean ± SEM and were compared by Student t test or ANOVA as appropriate. Differences were considered significant at p E5
6 FIGURES Figure E1. 43 differentially expressed mirnas in asymptomatic ZZ compared to asymptomatic MM monocytes were enriched in the protein processing in ER pathway. Data is presented using y-logarithmic axis of p-values generated from DIANA mirpath. E6
7 Figure E2. Relative expression of mir-199a-5p in THP-1 cells (1x10 5 in triplicate) treated with 20 µg/ml of 5-Aza-2 Deoxycytidine (5 AZA) for 48 hours Data are represented as mean ± SEM and were compared by student t-test versus both untreated and DMSO (nonparametric, one-tailed) (***p<0.001). E7
8 Figure E3. MiR-199a-5p targeting ATF6, NF-κB1 (p50) and RELA (p54) mrna 3 UTR predicted by microrna.org. Highly conserved mirna recognition elements (MRE) for mir- 199a-5p are shown with the site of each MRE indicated before the base sequence labeled 5-3. MiRSVR scores, a regression method for predicting the likelihood of target mrna downregulation from sequence and structure features in mirna/mrna predicted target sites are indicated above the MREs. E8
9 TABLE Table E1. Primers used in this study. Gene Primers (5-3 ) GRP78 ATF6 NFκB1 (p50) RELA (p65) ATF4 CHOP GADD34 GRP58 GRP94 sxbp1 GAPDH F- CATCACGCCGTCCTATGTCG R- CGTCAAAGACCGTGTTCTCG F- TGAACTTCGAGGATGGGTTC R- TCACTCCCTGAGTTCCTGCT F-TCAGACGCCATCTATGACAGTAAAG R-CTGGATGTCATCTTTCTGAACTTTG F-GCAGAAAGAGGACATTGAGGTG R-CTGCATGGAGACACGCACAGGAG F-AAGCCTAGGTCTCTTAGATG R-TTCCAGGTCATCTATACCCA F-ATGAGGACCTGCAAGAGGTCC R-TCCTCCTCAGTCAGCCAAGC F-AAGCTCACAGAACCTCTAC R-GATGTCCACAGAAGAACTTC F-TATGATGGGCCTAGGACTGC R-GATTCAACGTTGGTGTGTGC F- TCTATGTGCGCCGTGTATTCA R- GCGGGAAACATTCAAGGGGA F- CCGCAGCAGGTGCAGG R GAGTCAATACCGCCAGAATCCA F GAGTCAACGGATTTGGTCGT R TGGGATTTCCATTGATGACA E9
RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationCell death analysis using the high content bioimager BD PathwayTM 855 instrument (BD
Supplemental information Materials and Methods: Cell lines, reagents and antibodies: Wild type (A3) and caspase-8 -/- (I9.2) Jurkat cells were cultured in RPMI 164 medium (Life Technologies) supplemented
More informationSupplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered
Supplementary Information: Materials and Methods Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered saline (PBS) and lysed in TNN lysis buffer (50mM Tris at ph 8.0, 120mM NaCl
More informationTranscriptional Regulation of Pro-apoptotic Protein Kinase C-delta: Implications for Oxidative Stress-induced Neuronal Cell Death
SUPPLEMENTAL DATA Transcriptional Regulation of Pro-apoptotic Protein Kinase C-delta: Implications for Oxidative Stress-induced Neuronal Cell Death Huajun Jin 1, Arthi Kanthasamy 1, Vellareddy Anantharam
More informationMeCP2. MeCP2/α-tubulin. GFP mir1-1 mir132
Conservation Figure S1. Schematic showing 3 UTR (top; thick black line), mir132 MRE (arrow) and nucleotide sequence conservation (vertical black lines; http://genome.ucsc.edu). a GFP mir1-1 mir132 b GFP
More informationBlimp-1/PRDM1 rabbit monoclonal antibody (C14A4) was purchased from Cell Signaling
1 2 3 4 5 6 7 8 9 10 11 Supplementary Methods Antibodies Blimp-1/PRDM1 rabbit monoclonal antibody (C14A4) was purchased from Cell Signaling (Danvers, MA) and used at 1:1000 to detect the total PRDM1 protein
More informationSupplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53
Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -
More informationsirna Transfection Into Primary Neurons Using Fuse-It-siRNA
sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1137999/dc1 Supporting Online Material for Disrupting the Pairing Between let-7 and Enhances Oncogenic Transformation Christine Mayr, Michael T. Hemann, David P. Bartel*
More informationSupporting Information
Supporting Information SI Materials and Methods RT-qPCR The 25 µl qrt-pcr reaction mixture included 1 µl of cdna or DNA, 12.5 µl of 2X SYBER Green Master Mix (Applied Biosystems ), 5 µm of primers and
More informationComparative Analysis of Argonaute-Dependent Small RNA Pathways in Drosophila
Molecular Cell, Volume 32 Supplemental Data Comparative Analysis of Argonaute-Dependent Small RNA Pathways in Drosophila Rui Zhou, Ikuko Hotta, Ahmet M. Denli, Pengyu Hong, Norbert Perrimon, and Gregory
More informationCell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).
1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well
More informationFig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.
Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination
More informationSupplementary information for: Mutant p53 gain-of-function induces epithelial-mesenchymal transition. through modulation of the mir-130b-zeb1 axis
Supplementary information for: Mutant p53 gain-of-function induces epithelial-mesenchymal transition through modulation of the mir-3b-zeb axis AUTHORS: Peixin Dong, Mihriban Karaayvaz, Nan Jia, Masanori
More informationSupplemental Methods Cell lines and culture
Supplemental Methods Cell lines and culture AGS, CL5, BT549, and SKBR were propagated in RPMI 64 medium (Mediatech Inc., Manassas, VA) supplemented with % fetal bovine serum (FBS, Atlanta Biologicals,
More informationDocument S1. Supplemental Experimental Procedures and Three Figures (see next page)
Supplemental Data Document S1. Supplemental Experimental Procedures and Three Figures (see next page) Table S1. List of Candidate Genes Identified from the Screen. Candidate genes, corresponding dsrnas
More informationApoptosis assay: Apoptotic cells were identified by Annexin V-Alexa Fluor 488 and Propidium
Apoptosis assay: Apoptotic cells were identified by Annexin V-Alexa Fluor 488 and Propidium Iodide (Invitrogen, Carlsbad, CA) staining. Briefly, 2x10 5 cells were washed once in cold PBS and resuspended
More informationSupplementary Methods Plasmid constructs
Supplementary Methods Plasmid constructs. Mouse cdna encoding SHP-1, amplified from mrna of RAW264.7 macrophages with primer 5'cgtgcctgcccagacaaactgt3' and 5'cggaattcagacgaatgcccagatcacttcc3', was cloned
More informationGenomic DNA fragments identified by ChIP-chip assay for MR [28] corresponding to two
Supplemental Materials and Methods Genomic DNA fragments identified by ChIP-chip assay for MR [28] corresponding to two upstream regions of the human Klf9 gene (-5139 to -5771 bp and -3875 to -4211 bp)
More informationSupplemental Table S1. RT-PCR primers used in this study
Supplemental Table S1. RT-PCR primers used in this study -----------------------------------------------------------------------------------------------------------------------------------------------
More informationFig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of
Fig. S1 TGF RI inhibitor SB525334 effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of different concentrations of SB525334. Cells were lysed and
More informationEfficient Method for Isolation of High Quality Concentrated Cellular RNA with Extremely Low Levels of Genomic DNA Contamination Application
Efficient Method for Isolation of High Quality Concentrated Cellular RNA with Extremely Low Levels of Genomic DNA Contamination Application Gene Expression Authors Ilgar Abbaszade, Claudia Robbins, John
More informationSupporting Information
Supporting Information Liu et al. 10.1073/pnas.0901216106 SI Materials and Methods Reagents. Thioglycolate and LPS from Escherichia coli 0111:B4 were from Sigma-Aldrich. PAM3CSK4 and poly(i:c) were from
More informationRNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the
Supplementary Methods RT-PCR and real-time PCR analysis RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the manufacturer s protocol and quantified by measuring the
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1154040/dc1 Supporting Online Material for Selective Blockade of MicroRNA Processing by Lin-28 Srinivas R. Viswanathan, George Q. Daley,* Richard I. Gregory* *To whom
More informationused at a final concentration of 5 ng/ml. Rabbit anti-bim and mouse anti-mkp2 antibodies were
1 Supplemental Methods Reagents and chemicals: TGFβ was a generous gift from Genzyme Inc. (Cambridge, MA) and was used at a final concentration of 5 ng/ml. Rabbit anti-bim and mouse anti-mkp2 antibodies
More informationSupplementary information
Supplementary information Table of Content: Supplementary Results... 2 Supplementary Figure S1: Experimental validation of AP-MS results by coimmunprecipitation Western blot analysis.... 3 Supplementary
More informationSOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency
Molecular Cell, Volume 52 Supplemental Information SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency Kengo Homma, Takao Fujisawa, Naomi Tsuburaya, Namiko
More informationSUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION
SUPPLEMENTAL MATERIALS SIRTUIN PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF ACTIVATION Haranatha R. Potteti*, Subbiah Rajasekaran*, Senthilkumar B. Rajamohan*, Chandramohan R. Tamatam,
More informationFunctional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update
Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks
More informationPartial list of differentially expressed genes from cdna microarray, comparing MUC18-
Supplemental Figure legends Table-1 Partial list of differentially expressed genes from cdna microarray, comparing MUC18- silenced and NT-transduced A375SM cells. Supplemental Figure 1 Effect of MUC-18
More informationTo generate the luciferase fusion to the human 3 UTRs, we sub-cloned the 3 UTR
Plasmids To generate the luciferase fusion to the human 3 UTRs, we sub-cloned the 3 UTR fragments downstream of firefly luciferase (luc) in pgl3 control (Promega). pgl3- CDK6 was made by amplifying a 2,886
More informationSupplementary Figure 1 - Characterization of rbag3 binding on macrophages cell surface.
Supplementary Figure 1 - Characterization of rbag3 binding on macrophages cell surface. (a) Human PDAC cell lines were treated as indicated in Figure 1 panel F. Cells were analyzed for FITC-rBAG3 binding
More informationTo determine MRK-003 IC50 values, cell lines were plated in triplicate in 96-well plates at 3 x
Supplementary methods: Cellular growth assay and cell cycle analysis To determine MRK-003 IC50 values, cell lines were plated in triplicate in 96-well plates at 3 x 10 3 cells/well (except for TALL1 and
More informationSupplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell
Supplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell Supplementary Figures S1-S3 Supplementary Methods Supplementary Figure S1. Identification
More informationMicroRNA microarray Methods are as described in text. For full description, see Chen et al. 1. RNA extraction Methods are as described in text.
MicroRNA microarray Methods are as described in text. For full description, see Chen et al. 1 RNA extraction Methods are as described in text. Real-time RT-PCR quantification of microrna expression To
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation
More informationSupplemental Information
Supplemental Information Intrinsic protein-protein interaction mediated and chaperonin assisted sequential assembly of a stable Bardet Biedl syndome protein complex, the BBSome * Qihong Zhang 1#, Dahai
More informationmmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230
mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual Catalog # MBS826230 For the detection and quantification of mirnas mmu-mir-200a-3p normalized by U6 snrna using Real-time RT-PCR
More informationReagents and cell culture Mcl-1 gene expression: real-time quantitative RT-PCR In vitro PP2A phosphatase assay Detection of Mcl-1 in vivo
Reagents and cell culture Antibodies specific for caspase 3, PARP and GAPDH were purchased from Cell Signaling Technology Inc. (Beverly, MA). Caspase inhibitor z-vad-fmk and ROS scavenger N-acetyl-Lcysteine
More informationRoche Molecular Biochemicals Technical Note No. LC 12/2000
Roche Molecular Biochemicals Technical Note No. LC 12/2000 LightCycler Absolute Quantification with External Standards and an Internal Control 1. General Introduction Purpose of this Note Overview of Method
More informationTotal RNA was isolated using Trizol reagent (Invitrogen) and reverse transcribed using
Supplementary Methods RNA Isolation and Quantitative RT-PCR Total RNA was isolated using Trizol reagent (Invitrogen) and reverse transcribed using random hexamers and superscript II reverse transcriptase
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationSUPPLEMENTARY INFORMATION
Phage-mediated counting by the naked eye of mirna molecules at attomolar concentrations in a Petri dish Supplementary Figure 1-24 Supplementary Table 1 1 NATURE MATERIALS www.nature.com/naturematerials
More informationThe Transfection Collection TCF/LEF Transient Pack Wnt / -catenin Signaling Pathway Catalog #: 79273
Data Sheet The Transfection Collection TCF/LEF Transient Pack Wnt / -catenin Signaling Pathway Catalog #: 79273 Background The Wnt / -catenin signaling pathway controls a large and diverse set of cell
More information8Br-cAMP was purchased from Sigma (St. Louis, MO). Silencer Negative Control sirna #1 and
1 Supplemental information 2 3 Materials and Methods 4 Reagents and animals 5 8Br-cAMP was purchased from Sigma (St. Louis, MO). Silencer Negative Control sirna #1 and 6 Silencer Select Pre-designed sirna
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationUser Manual. Chromofy dsdna binding dye Version 1.0 April 2009 For use in quantitative real-time PCR
User Manual Chromofy dsdna binding dye Version 1.0 April 2009 For use in quantitative real-time PCR Chromofy dsdna binding dye Table of contents Background 4 Contents 4 Storage 4 Fluorescence data 4 Additionally
More informationQuantitative and non-quantitative RT-PCR. cdna was generated from 500ng RNA (iscript;
Supplemental Methods Quantitative and non-quantitative RT-PCR. cdna was generated from 500ng RNA (iscript; Bio-Rad, Hercules, CA, USA) and standard RT-PCR experiments were carried out using the 2X GoTaq
More informationASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
More informationQuantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer. Application Note. Odilo Mueller. Abstract
Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer Application Note Odilo Mueller Abstract This application note describes how the Agilent Technologies 2100 bioanalyzer can be used
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationSupplementary Methods
Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed
More informationSupplementary Fig.1. Over-expression of RNase L in stable polyclonal cell line
Supplemental Data mrna Protein A kda 75 40 NEO/vector NEO/RNase L RNASE L β-actin RNASE L β-actin B % of control (neo vector), normalized 240 ** 200 160 120 80 40 0 Neo Neo/RNase L RNase L Protein Supplementary
More informationsupplementary information
Figure S1 ZEB1 full length mrna. (a) Analysis of the ZEB1 mrna using the UCSC genome browser (http://genome.ucsc.edu) revealed truncation of the annotated Refseq sequence (NM_030751). The probable terminus
More informationTranslation of HTT mrna with expanded CAG repeats is regulated by
Supplementary Information Translation of HTT mrna with expanded CAG repeats is regulated by the MID1-PP2A protein complex Sybille Krauß 1,*, Nadine Griesche 1, Ewa Jastrzebska 2,3, Changwei Chen 4, Désiree
More informationFastLane Kits from Sample Direct to Result
FastLane Kits from Sample Direct to Result New Sample & Assay Technologies Overview of FastLane technology Speed up and simplify your workflow FastLane Kits accelerate and streamline real-time RT-PCR analysis
More informationmmu-mir-34a Real-time RT-PCR Detection Kit User Manual
mmu-mir-34a Real-time RT-PCR Detection Kit User Manual Catalog # CPK1272 For the detection and quantification of mirna mmu-mir-34a using Real-Time RT-PCR detection instruments. For research use only. Not
More informationRoche Molecular Biochemicals Technical Note No. LC 10/2000
Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce
More informationSUPPLEMENTARY INFORMATION
(Supplementary Methods and Materials) GST pull-down assay GST-fusion proteins Fe65 365-533, and Fe65 538-700 were expressed in BL21 bacterial cells and purified with glutathione-agarose beads (Sigma).
More informationNUCLEIC ACID PURIFICATION KITS FAST SIMPLE QUALITY CONVENIENT REPRODUCIBLE
NUCLEIC ACID PURIFICATION KITS FAST SIMPLE QUALITY CONVENIENT REPRODUCIBLE COMPANY PROFILE Since its founding in 1998,, Inc. has been at the forefront of nucleic acid purification by offering products
More informationRoche Molecular Biochemicals Technical Note No. LC 9/2000
Roche Molecular Biochemicals Technical Note No. LC 9/2000 LightCycler Optimization Strategy Introduction Purpose of this Note Table of Contents The LightCycler system provides different detection formats
More informationSupplementary Material
Supplementary Material Supplementary Methods Cell synchronization. For synchronized cell growth, thymidine was added to 30% confluent U2OS cells to a final concentration of 2.5mM. Cells were incubated
More informationIKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity
IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p5 activity H6 5 5 H58 A59 H6 H58 A59 anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα
More informationSupplemental Materials and Methods
Supplemental Materials and Methods In situ hybridization In situ hybridization analysis of HFE2 and genin mrna in rat liver tissues was performed as previously described (1). Briefly, the digoxigenin-labeled
More informationSupplementary Materials for
www.sciencemag.org/cgi/content/full/science.aab3291/dc1 Supplementary Materials for DNA tumor virus oncogenes antagonize the cgas-sting DNA sensing pathway Laura Lau, Elizabeth E. Gray, Rebecca L. Brunette,
More informationApplication Note 18 RNA/DNA/Protein Sample Preparation METHODS AND MATERIALS INTRODUCTION
Application Note 18 /DNA/Protein Sample Preparation Sequential Purification of, DNA and Protein from a Single Sample using 's /DNA/Protein Purification Kit and Comparison to a Market B. Lam, PhD 1, C.
More informationSupplementary Figures S1-S5. a b c
Supplementary Figures S1-S5 a b c Supplementary Figure S1. Generation of IL-17RD-deficient mice. (a) Schematic shows the murine il-17rd gene and the genetrap targeting vector, containing a promoter-less
More informationDNA methylation analysis was carried out using the Epityper system from Sequenom
Supplemental methods Quantitative DNA methylation analysis DNA methylation analysis was carried out using the Epityper system from Sequenom (San Diego, CA). The EpiTYPER assay is a tool for the detection
More informationSpironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice
Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice Supplementary Material Supplementary Methods Materials Spironolactone, aldosterone and β-glycerophosphate were
More informationSelected Techniques Part I
1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative
More information3 UTR (untranslated region) Reporter Clone and its vector, pmirtarget. Application Guide. OriGene Technologies, Inc
3 UTR (untranslated region) Reporter Clone and its vector, pmirtarget Application Guide OriGene Technologies, Inc Package Contents and Storage Conditions 3 UTR reporter clone as 10ug lyophilized plasmid
More informationTable 1. Primers, annealing temperatures, and product sizes for PCR amplification.
Table 1. Primers, annealing temperatures, and product sizes for PCR amplification. Gene Direction Primer sequence (5 3 ) Annealing Temperature Size (bp) BRCA1 Forward TTGCGGGAGGAAAATGGGTAGTTA 50 o C 292
More information1. Cross-linking and cell harvesting
ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine
More informationCRISPR/Cas9 Gene Editing Tools
CRISPR/Cas9 Gene Editing Tools - Guide-it Products for Successful CRISPR/Cas9 Gene Editing - Why choose Guide-it products? Optimized methods designed for speed and ease of use Complete kits that don t
More informationSupplemental Material Igreja and Izaurralde 1. CUP promotes deadenylation and inhibits decapping of mrna targets. Catia Igreja and Elisa Izaurralde
Supplemental Material Igreja and Izaurralde 1 CUP promotes deadenylation and inhibits decapping of mrna targets Catia Igreja and Elisa Izaurralde Supplemental Materials and methods Functional assays and
More informationSUPPORTING INFORMATION. A cleavage-responsive stem-loop hairpin for assaying guide RNA activity
SUPPORTING INFORMATION A cleavage-responsive stem-loop hairpin for assaying guide RNA activity Tara R. deboer 1, Noreen Wauford 1, Jing-Yi Chung, Miguel Salvador Torres Perez, and Niren Murthy* University
More informationSupplementary Information
Journal : Nature Biotechnology Supplementary Information Targeted genome engineering in human cells with RNA-guided endonucleases Seung Woo Cho, Sojung Kim, Jong Min Kim, and Jin-Soo Kim* National Creative
More informationAn improved quantitative real-time PCR protocol for precisely measuring D-amino acid oxidase mrna in rat tissues
An improved quantitative real-time PCR protocol for precisely measuring D-amino acid oxidase mrna in rat tissues Yoshikazu Nishiguchi 1*, Koichi Kitamura 1, Naoko Watanabe 2, Anna Kozaki 3, Hayato Otani
More informationEPIGENTEK. EpiQuik Chromatin Immunoprecipitation Kit. Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiQuik Chromatin Immunoprecipitation Kit Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Chromatin Immunoprecipitation Kit is suitable for combining the specificity of
More informationSupplemental Information
Supplemental Information Genetic and Functional Studies Implicate HIF1α as a 14q Kidney Cancer Suppressor Gene Chuan Shen, Rameen Beroukhim, Steven E. Schumacher, Jing Zhou, Michelle Chang, Sabina Signoretti,
More informationAdd 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH).
Bisulfite Treatment of DNA Dilute DNA sample to 2µg DNA in 50µl ddh 2 O. Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Incubate in a 37ºC water bath for 30 minutes. To 55µl samples
More informationSupplementary Figure 1. Characterization of the POP2 transcriptional and post-transcriptional regulatory elements. (A) POP2 nucleotide sequence
1 5 6 7 8 9 10 11 1 1 1 Supplementary Figure 1. Characterization of the POP transcriptional and post-transcriptional regulatory elements. (A) POP nucleotide sequence depicting the consensus sequence for
More informationyields an amplicon between 80 and 200bp, spans exon-exon junctions, and has a melting point from 59-
Supplemental Materials and Methods RTqPCR. All primers are listed in Supplemental Table 1 and were designed ensuring that each primer set yields an amplicon between 80 and 200bp, spans exon-exon junctions,
More informationAll-in-One qpcr Mix. User Manual. For universal quantitative real-time PCR
All-in-One qpcr Mix For universal quantitative real-time PCR Cat. No. AOPR-0200 (200 qpcr reactions) Cat. No. AOPR-0600 (600 qpcr reactions) Cat. No. AOPR-1000 (1000 qpcr reactions) Cat. No. AOPR-1200
More informationSupporting Information
Supporting Information Powell and Xu 10.1073/pnas.0807274105 SI Methods Design of Estrogen Receptor (ER) Fusion Constructs for Use in Bioluminescence Resonance Energy Transfer (BRET) Assay. Because the
More informationSUPPLEMENTARY INFORMATION. LIN-28 co-transcriptionally binds primary let-7 to regulate mirna maturation in C. elegans
SUPPLEMENTARY INFORMATION LIN-28 co-transcriptionally binds primary let-7 to regulate mirna maturation in C. elegans Priscilla M. Van Wynsberghe 1, Zoya S. Kai 1, Katlin B. Massirer 2-4, Victoria H. Burton
More informationSupplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1
Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1 a His-ORMDL3 ~ 17 His-ORMDL3 GST-ORMDL3 - + - + IPTG GST-ORMDL3 ~ b Integrated Density (ORMDL3/ -actin) 0.4 0.3 0.2 0.1
More informationSupplemental Figure 1. Study flow chart.
Supplemental Figure 1. Study flow chart. 1 Supplemental Figure 2. Histograms represent fold changes of mir-22 in HL-1 cells. Vehicle-treated (gray) or sildenafil-treated (black b) cells. Results are expressed
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12119 SUPPLEMENTARY FIGURES AND LEGENDS pre-let-7a- 1 +14U pre-let-7a- 1 Ddx3x Dhx30 Dis3l2 Elavl1 Ggt5 Hnrnph 2 Osbpl5 Puf60 Rnpc3 Rpl7 Sf3b3 Sf3b4 Tia1 Triobp U2af1 U2af2 1 6 2 4 3
More informationGenomic DNA was extracted from 3 to 5 ml of blood collected in EDTA blood collection tubes
Supplementary information Methods DNA and RNA extraction Genomic DNA was extracted from to ml of blood collected in EDTA blood collection tubes using the Gentra Puregene Blood kit (Qiagen, California,
More informationProtein and transcriptome quantitation using BD AbSeq Antibody-Oligonucleotide
Protein and transcriptome quantitation using BD AbSeq Antibody-Oligonucleotide technology and the 10X Genomics Chromium Single Cell Gene Expression Solution Jocelyn G. Olvera, Brigid S. Boland, John T.
More informationb alternative classical none
Supplementary Figure. 1: Related to Figure.1 a d e b alternative classical none NIK P-IkBa Total IkBa Tubulin P52 (Lighter) P52 (Darker) RelB (Lighter) RelB (Darker) HDAC1 Control-Sh RelB-Sh NF-kB2-Sh
More informationRealHelix TM qrt-pcr Kit [Intercalator type]
RealHelix TM qrt-pcr Kit [Intercalator type] CERTIFICATE OF ANALYSIS (1603-V01R03) Kit contents RealHelix TM qrt-pcr Kit [Intercalator type] Cat. No. QRT-S100 (100 rxns) QRT-S500 (500 rxns) qrt-pcr Enzyme
More informationCell extracts and western blotting RNA isolation and real-time PCR Chromatin immunoprecipitation (ChIP)
Cell extracts and western blotting Cells were washed with ice-cold phosphate-buffered saline (PBS) and lysed with lysis buffer. 1 Total cell extracts were separated by SDS-PAGE and transferred to nitrocellulose
More informationSupplemental Table 1: Sequences of real time PCR primers. Primers were intronspanning
Symbol Accession Number Sense-primer (5-3 ) Antisense-primer (5-3 ) T a C ACTB NM_001101.3 CCAGAGGCGTACAGGGATAG CCAACCGCGAGAAGATGA 57 HSD3B2 NM_000198.3 CTTGGACAAGGCCTTCAGAC TCAAGTACAGTCAGCTTGGTCCT 60
More informationDesign. Construction. Characterization
Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication
More informationTHUNDERBIRD SYBR qpcr Mix
Instruction manual THUNDERBIRD SYBR qpcr Mix 1304 A4251K THUNDERBIRD SYBR qpcr Mix QPS-201T 1 ml x 1 QPS-201 1.67 ml x 3 Contents [1] Introduction [2] Components [3] Primer design [4] Template DNA [5]
More informationEpiQuik Methyl-CpG Binding Domain Protein 2 ChIP Kit
EpiQuik Methyl-CpG Binding Domain Protein 2 ChIP Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Methyl-CpG Binding Domain Protein 2 ChIP Kit is suitable for combining the
More information