ONLINE DATA SUPPLEMENT

Transcription

1 ONLINE DATA SUPPLEMENT mir-199a-5p silencing regulates the unfolded protein response in COPD and α1 antitrypsin deficiency Tidi Hassan, Tomás P. Carroll, Patrick G. Buckley, Robert Cummins, Shane J. O Neill, Noel G. McElvaney, Catherine M. Greene. E1

2 METHODS Isolation, culture and treatment of peripheral blood monocytes Mononuclear cells were isolated from heparinized venous peripheral blood. Density gradient centrifugation was carried out using Lymphoprep (Axis Shield). Briefly the mononuclear cell band was aspirated, washed with HBSS (Invitrogen) and purified using the EasySep Human CD14 Selection Cocktail (StemCell Technologies). The cells were cultured in RPMI 1640 containing 10% (v/v) fetal calf serum (Life Technologies) and 1% penicillin/streptomycin (Invitrogen) at 37 o C in a 5% CO 2 atmosphere. MM monocytes were treated with DMSO (vehicle control) or Thapsigargin (TG) (Sigma-Aldrich) at 10, 50 or 100nM for 1 hour. Quantitative assessment of mrna and mirna levels RNA was isolated using TRI reagent (Sigma-Aldrich) according to the manufacturer s instructions. Equal quantities of RNA calculated using a Nanodrop 8000 (ThermoScientific, Welmington) were reverse transcribed into cdna using the Quantitect Reverse Transcription kit (Qiagen). The cdna was used as template for quantitative real-time PCR. Oligonucleotide primers were synthesized (MWG Operon) (Table E1) and quantitative PCR reactions performed in 20µl containing 2µl of template cdna, SYBR Green MasterMix (Roche) and 10 pmol of each primer. mirna expression was measured using Taqman mirna assays (Applied Biosystems) according to manufacturer s instructions. Amplification of both mrna and mirna was performed on the Roche LC480 Lightcycler in triplicate, including no-template controls. Relative expression of mrna and mirna relative to GAPDH and U6 snrna was determined using the 2 - Ct method (26). mirna expression profiling using the ncounter mirna Expression Assay mirnas were profiled commercially from asymptomatic MM and ZZ monocytes (n=3 in each group) with the ncounter mirna Expression Assay (Nanostring Technologies). The samples were prepared with the ncounter mirna Sample Preparation Kit according to manufacturer s instructions. Raw data was normalized based on the relative number of positive and negative control counts and adjusted for probe and background corrections for each mirna as instructed in the ncounter Data Analysis Guidelines. E2

3 DNA isolation, sodium bisulfite conversion and pyrosequencing analysis Genomic DNA was isolated from the monocytes of asymptomatic and symptomatic MM and ZZ individuals (n=3 from each group) and bisulfite converted using the EZ DNA Methylation Direct kit (ZymoResearch) as per the manufacturer s instructions. Commercialized non-methylated, methylated (Epigen Dx) and bisulfite converted DNA (ZymoResearch) were used as quality controls. PCR amplification was performed on 25ng of the bisulfite-treated DNA using the PyroMark Q24 CpG LINE-1 assay (Qiagen) for amplification of the LINE-1 retrotransposable elements. PCR primers for mir-199a-2 promoter were designed using the Bisulfite Primer Seeker 12S software (ZymoResearch) and were as follows: forward primer, 5 - TGGTTAAGYGGTATTTGGTAAATTTTAATAGATTTAG-3 and biotinylated reverse primer 5 -TAACCTTCCTAATTTCCCTCAACTATTTTAAC-3. The resultant PCR products were analyzed by gel electrophoresis to confirm the size of the product and rule out the formation of primer dimers. PCR products were subjected to quantitative pyrosequencing analysis using the PyroMark Q24 CpG LINE-1 and PyroMark Gold Q24 (Qiagen) assay for LINE-1 elements and mir-199a-2 promoter, respectively according to the manufacturer s protocol. The sequencing primers for mir-199a-2 were; 5 -GATTTGTTAGAAGATTTGA-3 for CpG sites 1 and 2 and 5 -GATGTTTTAAATAAAAATTG-3 for CpG site 3 designed using the PyroMark Assay Design Software 2.0. Pyrosequencing analysis was performed using the PyroMark Q24 Software (Qiagen). Methylation inhibitor studies. Monocytic THP-1 cells (1x10 5 in triplicate) were left untreated or treated with 2 µg/ml of 5-Aza-2 Deoxycytidine (5 AZA) or DMSO vehicle for 48 h. Luciferase reporter plasmid transfection HEK293 cells (1 x 10 5 in triplicate) were transfected with 250 ng of a luciferase reporter vector containing either the full-length wild type (WT) 3 UTR of ATF6 (pmir-atf6 3 UTR, Origene), NFκB1 for p50 (pgl3-p50 3 UTR as a gift from Prof. Gao, Shandong University Medical School) or RELA for p65 (pag23/rela 3 UTR, Addgene), and 100ng of the reference Renilla luciferase reporter plasmid prlsv40 (Promega). The SERPINA1 3 UTR plasmid vector (Origene) was used as a negative control. Negative control reporter plasmids containing the full-length 3 UTR of ATF6, NFκB1 and RELA with mutations in the E3

4 predicted binding sites for mir-199a-5p was constructed by site-directed mutagenesis using the QuikChange Site-Directed Mutagenesis Kit (Agilent). Mutagenic oligonucleotide primers were designed individually according to the desired mutation (highlighted in bold) using the following primers: ATF6 3 UTR, forward primer, 5'- CCCATCTATTTGGAAAGCAAGGGAATTCAGATGCAAGAG-3, reverse primer 5'- CTCTTGCATCTGAATTCCCTTGCTTTCCAAATAGATGGG-3'; NFκB1, forward primer 5'-GTATCTAGCAATCACAACTCGGGCTGAGCGGATGCATCTG-3', reverse primer 5'- CAGATGCATCCGCTCAGCCCGAGTTGTGATTGCTAGATAC-3'; RELA 3 UTR, forward primer 5'-CAGCCCCTGTATGGCTTAGGCATTGTCCCTGTG-3', reverse primer 5'-CACAGGGACAATGCCTAAGCCATACAGGGGCTG-3'. Cells were co-transfected with a total of 30nM synthetic pre-mir-199a-5p or a scrambled control (Applied Biosystems) using Genejuice (Novagene) for plasmid DNA and Ribojuice (Novagen) for mirna in OptimMEM reduced serum media (Life Technologies) as per the recommended conditions. Cell lysates were prepared 24 hours after transfection, and measurement of firefly luciferase was performed using the Luciferase assay system (Promega) and coelenterazine (Marker Gene Technologies). Firefly luciferase activity was normalized to the Renilla luciferase activity. Transfection of pre-mirs and anti-mirs for mirna overexpression/inhibition Isolated monocytes (1x10 5 cells in triplicate) were non-transfected or transfected with 60nM of a scrambled control or synthetic pre- or anti-mir-199a-5p (Applied Biosystems) using siport-neofx (Invitrogen) in OptiMEM-reduced serum media (Life Technologies). A fluorescently labeled non-targeting miridian mirna mimic (Dharmacon) was used to monitor transfection efficiency. After 48h total RNA was extracted with TRI reagent (Sigma- Aldrich) as per manufacturer s protocol. Equal volumes of cell lysates transfected for 48h were prepared for protein analysis using RIPA buffer (50mM Tris, 150mM sodium chloride, 0.1% SDS, 0.5% sodium deoxycholate, 1% Triton X-100). Immediately before use, this buffer was supplemented with complete mini protease inhibitor (Roche). Western blot analyses Equal volumes of cell lysates were separated by NuPage Novex 4-12% Bis-Tris Gels (Life Technologies) in MOPS SDS running buffer (Life Technologies) and transferred onto nitrocellulose membranes (Sigma-Aldrich). Membranes were then probed with primary E4

5 antibodies for either mouse anti-atf6 (Imgenex, 1:500 dilution), rabbit anti-p50 (Santa Cruz, 1:1000 dilution) or mouse anti-p65 (Santa Cruz, 1:1000 dilution). Signal detection was determined using the Immobilon Western HRP Substrate (Milipore) on the Syngene G:Box chemi XL gel documentation system. Densitometry was performed using GeneTools software on the same system. Analysis of XBP-1 mrna splicing XBP-1 mrna splicing was analyzed using an assay described by Calfon et al. (27). RNA was isolated using TRI reagent (Sigma-Aldrich) and cdna synthesized using the method described above. The following primers were used to amplify XBP-1 cdna: forward primer 5 -AAACAGAGTAGCAGCTCAGACTGC-3 ; reverse primer 5 - TCCTTCTGGGTAGACCTCTGGGA-3. The amplified products were resolved on a 2.5% agarose gel to reveal a product of 480 bp and 454 bp for unspliced and spliced XBP-1, respectively. Statistical analysis All analyses were performed using GraphPad PRISM 4.0 (San Diego, CA). Results are expressed as the mean ± SEM and were compared by Student t test or ANOVA as appropriate. Differences were considered significant at p E5

6 FIGURES Figure E1. 43 differentially expressed mirnas in asymptomatic ZZ compared to asymptomatic MM monocytes were enriched in the protein processing in ER pathway. Data is presented using y-logarithmic axis of p-values generated from DIANA mirpath. E6

7 Figure E2. Relative expression of mir-199a-5p in THP-1 cells (1x10 5 in triplicate) treated with 20 µg/ml of 5-Aza-2 Deoxycytidine (5 AZA) for 48 hours Data are represented as mean ± SEM and were compared by student t-test versus both untreated and DMSO (nonparametric, one-tailed) (***p<0.001). E7

8 Figure E3. MiR-199a-5p targeting ATF6, NF-κB1 (p50) and RELA (p54) mrna 3 UTR predicted by microrna.org. Highly conserved mirna recognition elements (MRE) for mir- 199a-5p are shown with the site of each MRE indicated before the base sequence labeled 5-3. MiRSVR scores, a regression method for predicting the likelihood of target mrna downregulation from sequence and structure features in mirna/mrna predicted target sites are indicated above the MREs. E8

9 TABLE Table E1. Primers used in this study. Gene Primers (5-3 ) GRP78 ATF6 NFκB1 (p50) RELA (p65) ATF4 CHOP GADD34 GRP58 GRP94 sxbp1 GAPDH F- CATCACGCCGTCCTATGTCG R- CGTCAAAGACCGTGTTCTCG F- TGAACTTCGAGGATGGGTTC R- TCACTCCCTGAGTTCCTGCT F-TCAGACGCCATCTATGACAGTAAAG R-CTGGATGTCATCTTTCTGAACTTTG F-GCAGAAAGAGGACATTGAGGTG R-CTGCATGGAGACACGCACAGGAG F-AAGCCTAGGTCTCTTAGATG R-TTCCAGGTCATCTATACCCA F-ATGAGGACCTGCAAGAGGTCC R-TCCTCCTCAGTCAGCCAAGC F-AAGCTCACAGAACCTCTAC R-GATGTCCACAGAAGAACTTC F-TATGATGGGCCTAGGACTGC R-GATTCAACGTTGGTGTGTGC F- TCTATGTGCGCCGTGTATTCA R- GCGGGAAACATTCAAGGGGA F- CCGCAGCAGGTGCAGG R GAGTCAATACCGCCAGAATCCA F GAGTCAACGGATTTGGTCGT R TGGGATTTCCATTGATGACA E9