Supplementary Figures, Tables, and Legends:
|
|
|
- Arlene Simpson
- 5 years ago
- Views:
Transcription
1 Supplementary Figures, Tables, and Legends: Supplementary Figure 1. RBPjκ is efficiently knocked down in RBPjk Prx1 mutant compact bones. Western blot analyses for RBPjk in protein extracts from femurs and tibiae of wild-type (WT) controls and RBPjk Prx1 mutants at 2-months of age. Results are representative of three independent experiments. N = 3 mice per genotype.
2 Supplementary Figure 2. During fracture repair, all the cells in the callus are derived from Prx1-expressing cells. X-gal staining of callus sections from Cre- WT control (A) and R26RLacZ Prx1 (B) mice at 14 dpf. 20X magnification of periosteum and bone marrow revealed Prx1-expressing MSCs not only in the periosteum (red arrows) (D) but also in bone marrow (yellow arrows) (F) of R26RLacZ Prx1 fractures, while no LacZ-positive cells were found in WT periosteum (C) or bone marrow (E). 20X magnification of the external and internal callus showed that all the cells in the entire callus area, including both the external callus (H) and internal callus (J), were derived from Prx1-expressing cells in R26RLacZ Prx1 fractures, whereas no blue cells were detected in either the external callus (G) or the internal callus (I) of WT fractures. N = 3 mice per genotype.
3 Supplementary Figure 3. Fracture nonunion observed in RBPjκ Prx1 mutants is not attributed to a disrupted vascular network within fracture gap. ABH/OG (A, D) and IF for PECAM (B, E, C, F) on callus sections of WT and RBPjk Prx1 mutants at 14 dpf. N = 5 mice per genotype. White arrow indicates no PECAM expression in the cartilaginous callus regions. Yellow arrow indicates abundant newly formed blood vessels invading the bony callus regions. Pink arrow indicates abundant PECAM expression across the fracture gap in RBPjk Prx1 mutants.
4 Supplementary Figure 4. Fracture nonunion in RBPjk Prx1 mutants is not due to enhanced osteoclast numbers. (A) TRAP staining on callus sections of WT and RBPjk Prx1 mutant fractures at 28 and 42 dpf. N = 5 mice per genotype per time point. (B) Histomorphometric quantifications of the osteoclast surface per bone surface (Oc. S./BS) on TRAP stained sections revealed comparable (at 28 dpf) or even significantly lower Oc. S./BS (at 42 dpf) in RBPjk Prx1 mutants. N = 5 mice per genotype per time point, *, p<0.05 compared with WT by two-way ANOVA followed by Dunnett s post hoc test. Results are expressed as means ± SD.
5 Supplementary Figure 5. During fracture repair, Col1 (2.3kb)-expressing cells only give rise to the cells in the hard callus regions within the external callus area. X-gal staining of callus sections from Cre- WT control (A) and R26RLacZ Col1 (B) mice at 14 dpf. 20X magnification of periosteum and bone marrow revealed Col1- expressing mature osteoblasts only in the cambium layer of the periosteum (red arrows) (D) but not in bone marrow (F) of R26RLacZ Col1 fractures. By contrast, no LacZ-positive cells were found in WT periosteum (C) or bone marrow (E). 20X magnification of the external and internal callus showed that the cells within hard callus regions of the external callus (H) but not internal callus (J) were derived from Col1-expressing cells in R26RLacZ Col1 fractures, while no blue cells were detected in either the external callus (G) or the internal callus (I) of WT fractures. N = 3 mice per genotype.
6 Supplementary Figure 6. RBPjk is efficiently knocked down in RBPjk Col1 mutant compact bones. Western blot analyses for RBPjk in protein extracts from femurs and tibiae of WT controls and RBPjk Col1 mutants at 2- months of age. Results are representative of three independent experiments. N = 3 mice per genotype.
7 Supplementary Figure 7. BMSCs in RBPjκ Col1 mutants are unaffected by loss of Notch signaling in mature osteoblasts. (A) CFU-F assays on bone marrow stromal cells isolated from WT and RBPjk Col1 mutant fractures at 42 dpf. Representative images for crystal violet staining of CFU-Fs and ALP staining of CFU-OBs are both shown. N = 6 mice per genotype. (B-D) RBPjk Col1 mutant fractures exhibited comparable type 1 colonies (CFU- Fs), ALP-positive colonies (CFU-OBs), and ratio of CFU-OB/CFU-F as compared to WT control ones. N = 6 mice per genotype. *, p<0.05 compared with WT by two-tailed unpaired Student s t test. Results are expressed as means ± SD.
8 Supplementary Figure 8. Stabilized femur fractures (0.6-mm osteotomy) of RBPjk Prx1 result in delayed unions. (A) A real-time radiographic comparison of 0.6-mm osteotomies in WT and RBPjk Prx1 mutants. N = 2 mice per genotype. (B) Representative microct images of 0.6-mm osteotomies in WT and RBPjk Prx1 mutants at 21 dpf. N = 2 mice per genotype. (C) ABH/OG staining on femur fracture sections (0.66-mm osteotomy) from WT and RBPjk Prx1 mutants at 21 dpf. N = 2 mice per genotype. Red arrow indicates a radiolucent area at the level of the osteotomy in both autoradiographs and microct images of RBPjk Prx1 mutants. Blue arrow indicates nearly no callus formation on one side of the cortical bone in RBPjk Prx1 mutant osteotomy.
9 Supplementary Table 1. Primers sequences used for real-time qpcr analyses. All sequences are reported in 5 to 3 direction.
Matrix IGF-1 regulates bone mass by activation of mtor in. Mesenchymal Stem Cells
Supplemental information Matrix IGF-1 regulates bone mass by activation of mtor in Mesenchymal Stem Cells Lingling Xian, Xiangwei Wu, Lijuan Pang, Michael Lou, Clifford Rosen, Tao Qiu, Janet Crane, Frank
Supplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse
Supplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse tail DNA. Primers were designed to detect Gna13-WT/f (~400bp/470bp)
Supplementary Figure 1. Mouse genetic models used for identification of Axin2-
Supplementary Figure 1. Mouse genetic models used for identification of Axin2- expressing cells and their derivatives. Schematic representations illustrate genetic cell labeling strategies to identify
(a) Scheme depicting the strategy used to generate the ko and conditional alleles. (b) RT-PCR for
Supplementary Figure 1 Generation of Diaph3 ko mice. (a) Scheme depicting the strategy used to generate the ko and conditional alleles. (b) RT-PCR for different regions of Diaph3 mrna from WT, heterozygote
Revised: RG-RV2 by Fukuhara et al.
Supplemental Figure 1 The generation of Spns2 conditional knockout mice. (A) Schematic representation of the wild type Spns2 locus (Spns2 + ), the targeted allele, the floxed allele (Spns2 f ) and the
Supplemental Material: Rev1 promotes replication through UV lesions in conjunction with DNA
Supplemental Material: Rev1 promotes replication through UV lesions in conjunction with DNA polymerases,, and, but not with DNA polymerase Jung-Hoon Yoon, Jeseong Park, Juan Conde, Maki Wakamiya, Louise
(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower
Supplementary Figures S1. (A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: ; lower arrow: KO) and (B) q-pcr analysis with Lin- cells, The white vertical line in panel A indicates that
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3164 Supplementary Figure 1 Validation of effective Gnas deletion and epithelial thickness. a, Representative genotyping in mice treated or not with tamoxifen to show Gnas deletion. To
Supplementary Figure 1. Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings.
Supplementary Figure 1 Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings. (left) Representative bright-field images of wild type (wt), heterozygous (het)
Supplementary Figure 1 Caspase-8 deficient platelets respond normally to agonists and ABT-737 (A) Surface expression of GPIX, GPIb, GPVI and CD41
Supplementary Figure 1 Caspase-8 deficient platelets respond normally to agonists and ABT-737 (A) Surface expression of GPIX, GPIb, GPVI and CD41 were assessed on purified platelets from Casp8 fl/fl and
Nature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 Ihh interacts preferentially with its upstream neighboring gene Nhej1. Genes are indicated by gray lines, and Ihh and Nhej1 are highlighted in blue. 4C seq performed in E14.5 limbs
Supplemental Material
Supplemental Material Figure S1.(A) Immuno-staining of freshly isolated Myf5-Cre:ROSA-YFP fiber (B) Satellite cell enumeration in WT and cko mice from resting hind limb muscles. Bulk hind limb muscles
Supplementary Figure 1. ERK signaling is not activated at early hypertension. a, Western blot analysis for the level of phospho-erk (perk) and total
Supplementary Figure 1. ERK signaling is not activated at early hypertension. a, Western blot analysis for the level of phospho-erk (perk) and total ERK in the aortic tissue from the saline- or AngII-infused
Supplementary Figure 1 Validate the expression of mir-302b after bacterial infection by northern
Supplementary Figure 1 Validate the expression of mir-302b after bacterial infection by northern blot. Northern blot analysis of mir-302b expression following infection with PAO1, PAK and Kp in (A) lung
Supplementary Methods
Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed
Supplementary Data. In Vivo Bone Formation by impcs Materials and methods. Results. Conclusions
Supplementary Data In Vivo Bone Formation by impcs Materials and methods Induced pluripotent stem cell (ipsc)-derived mesenchymal stem cell (MSC)-like progenitor cells (impcs) (1 10 6 M-iMPC-GMs in 10
Supplemental Material
Supplemental Material Disclosing the essentiality of ribose-5-phosphate isomerase B in Trypanosomatids Joana Faria 1,2, Inês Loureiro 1,2, Nuno Santarém 1,2, Pedro Cecílio 1,2, Sandra Macedo-Ribeiro 2,3,
SUPPLEMENTARY INFORMATION
DOI:.38/ncb327 a b Sequence coverage (%) 4 3 2 IP: -GFP isoform IP: GFP IP: -GFP IP: GFP Sequence coverage (%) 4 3 2 IP: -GFP IP: GFP 33 52 58 isoform 2 33 49 47 IP: Control IP: Peptide Sequence Start
Lyset BOOST YOUR CELL CULTURE TODAY FOR THE EXPERIMENTS OF TOMORROW
Lyset BOOST YOUR CELL CULTURE TODAY FOR THE EXPERIMENTS OF TOMORROW Lyset, the human platelet derived supplement for cell culture Among the different alternatives to animal serum, platelet derived preparations
Supplementary Information. Conversion of vascular endothelial cells into multipotent stem-like cells
Supplementary Information Conversion of vascular endothelial cells into multipotent stem-like cells Damian Medici 1, Eileen M. Shore 2,3,4, Vitali Y. Lounev 2,4, Frederick S. Kaplan 2,4,5, Raghu Kalluri
Contribution and Mobilization of Mesenchymal Stem Cells in a mouse model of carbon tetrachloride-induced liver fibrosis
Contribution and Mobilization of Mesenchymal Stem Cells in a mouse model of carbon tetrachloride-induced liver fibrosis Yan Liu 1,*, Zhipeng Han 1,*, Yingying Jing 1,*, Xue Yang 1, Shanshan Zhang 1, Chen
Parthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss
SUPPLEMENTARY INFORMATION Parthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss Yunjong Lee, Senthilkumar S. Karuppagounder, Joo-Ho Shin, Yun-Il Lee, Han Seok Ko, Debbie Swing,
Supplementary Fig. 1
a FL (1-2266) NL (1-1190) CL (1191-2266) HA-ICE1: - HA-ICE1: - - - FLAG-ICE2: + + + + FLAG-ELL: + + + + + + IP: anti-ha FLAG-ICE2 HA-ICE1-FL HA-ICE1-NL HA-ICE1-CL FLAG-ICE2 b IP: anti-ha FL (1-2266) NL
At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in
Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm
Supplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/8/353/353ra113/dc1 Supplementary Materials for Thymidine phosphorylase exerts complex effects on bone resorption and formation in myeloma Huan Liu,
Supplementary Table, Figures and Videos
Supplementary Table, Figures and Videos Table S1. Oligonucleotides used for different approaches. (A) RT-qPCR study. (B) qpcr study after ChIP assay. (C) Probes used for EMSA. Figure S1. Notch activation
Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected
Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected with the sirna against lnc-2, lnc-6, lnc-7, and the
A group A Streptococcus ADP-ribosyltransferase toxin stimulates a protective IL-1β-dependent macrophage immune response
A group A Streptococcus ADP-ribosyltransferase toxin stimulates a protective IL-1β-dependent macrophage immune response Ann E. Lin, Federico C. Beasley, Nadia Keller, Andrew Hollands, Rodolfo Urbano, Emily
Supplementary material
Supplementary material Tracking mesenchymal stem cell contributions to regeneration in an immunocompetent cartilage regeneration model Daniela Zwolanek, María Satué, Verena Proell, Josè R. Godoy, Kathrin
percentage of Nature Immunology: doi: /ni.3728 Supplementary Figure 1
Supplementary Figure 1 4 integrin expression in monocytes and macrophages from Cre + 4 f/f and Cre 4 f/f mice. a) Depicted is a representative histogram of flow cytometry analysis for α4 integrin expression
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature12474 Supplementary Figure 1 Analysis of mtdna mutation loads in different types of mtdna mutator mice. a, PCR, cloning, and sequencing analysis of mtdna mutations
Supplementary Figures and Legends.
Supplementary Figures and Legends. Supplementary Figure 1: Impact of injury on Rb1 and PPARϒ expression. Following ipsilateral axotomy injury, adult DRG expression of Rb1 mrna declined (*p
3 Department of Advanced Therapy for
Elevation of pro-inflammatory cytokine levels following anti-resorptive drug treatment is required for osteonecrosis development in infectious osteomyelitis Mayu Morita 1, Ryotaro Iwasaki 1, Yuiko Sato
Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and
Supplementary Figure Legend: Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and ATRIP protein peptides identified from our mass spectrum analysis were shown. Supplementary
Supplementary Figure 1. TSA (10 nmol/l), non-class-selective HDAC inhibitor, potentiates
Supplementary Figure 1. TSA (10 nmol/l), non-class-selective HDAC inhibitor, potentiates vascular calcification (VC). (a) Von Kossa staining shows that TSA potentiated the Pi-induced VC. Scale bar, 100
Supplementary Figure 1. Wnt10a mutation causes aberrant molar tooth development and formation of an ectopic M4 molar. (a,b) Smaller molar teeth with
Supplementary Figure 1. Wnt10a mutation causes aberrant molar tooth development and formation of an ectopic M4 molar. (a,b) Smaller molar teeth with blunted cusp formation, and presence of an ectopic molar
Supplementary Figure 1 Muscle dystrophic phenotype is absent at P6 in PKO mice. (a) Size
Supplementary Figure 1 Muscle dystrophic phenotype is absent at P6 in PKO mice. (a) Size comparison of the P6 control and PKO mice. (b) H&E staining of hind-limb muscles from control and PKO mice at P6.
Supplementary Figures and supplementary figure legends
Supplementary Figures and supplementary figure legends Figure S1. Effect of different percentage of FGF signaling knockdown on TGF signaling and EndMT marker gene expression. HUVECs were subjected to different
Preparation of Mouse Bone Marrow Stromal Cells
Preparation of Mouse Bone Marrow Stromal Cells A single-step stem cell purification method using adhesion to cell culture plastic was employed as described in the Reference. Briefly, neonatal and adult
embryos. Asterisk represents loss of or reduced expression. Brackets represent
Supplemental Figures Supplemental Figure 1. tfec expression is highly enriched in tail endothelial cells (A- B) ISH of tfec at 15 and 16hpf in WT embryos. (C- D) ISH of tfec at 36 and 38hpf in WT embryos.
Supplemental Data. Sethi et al. (2014). Plant Cell /tpc
Supplemental Data Supplemental Figure 1. MYC2 Binds to the E-box but not the E1-box of the MPK6 Promoter. (A) E1-box and E-box (wild type) containing MPK6 promoter fragment. The region shown in red denotes
Supplementary Fig. 1: Characterization of Asxl2 -/- mouse model. (a) HSCs and their
Supplementary Fig. 1: Characterization of Asxl2 -/- mouse model. (a) HSCs and their differentiated cell populations were sorted from the BM of WT mice using respective surface markers, and Asxl2 mrna expression
Fig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector.
Fig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector. (a) Western blotting analysis and (b) qpcr analysis of eif6 expression in HEK293 T cells transfected with either
Nature Immunology: doi: /ni Supplementary Figure 1. Time course of OT-II T reg cell development in thymic slices.
Supplementary Figure 1 Time course of OT-II T reg cell development in thymic slices. Time course of T reg cell development following addition of OT-II TCR transgenic Rag2 -/- mice (OT-II) thymocytes to
Rorα is essential for nuocyte development
Rorα is essential for nuocyte development See Heng Wong,,, Jennifer A. Walker,, Helen E. Jolin,, Lesley F. Drynan, Emily Hams 3, Ana Camelo, Jillian L. Barlow, Daniel R. Neill,6, Veera Panova, Ute Koch,
Supplemental figure 1. Dys-regulated signal pathways in MSCs from TNF-Tg. mice. 965 dys-regulated genes were uploaded to IPA and David bioinformatics
Supplemental figure 1. Dys-regulated signal pathways in MSCs from TN-Tg mice. 965 dys-regulated genes were uploaded to IPA and David bioinformatics esources software. The top 53 and top 11 dys-regulated
monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal antibody was examined in
Supplementary information Supplementary figures Supplementary Figure 1 Determination of the s pecificity of in-house anti-rhbdd1 mouse monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal
Pei et al. Supplementary Figure S1
Pei et al. Supplementary Figure S1 C H-CUL9: + + + + + Myc-ROC1: - - + + + U2OS/pcDN3 U2OS/H-CUL9 U2OS/ + H-CUL9 IP: -H -myc input -H -myc 1 2 3 4 5 H-CUL9 Myc-ROC1 -H -H -H -H H-CUL9: wt RR myc-roc1:
b number of motif occurrences
supplementary information DOI: 1.138/ncb194 a b number of motif occurrences number of motif occurrences number of motif occurrences I II III IV V X TTGGTCAGTGCA 3 8 23 4 13 239 TTGGTCAGTGCT 7 5 8 1 3 83
Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated
Supplementary Figure Legends Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated with either vehicle (left; n=3) or CCl 4 (right; n=3) were co-immunostained for NRP-1 (green)
Supplementary Figure 1. Adipogenic protein expression in WT and KO MEFs after 7 days of adipogenic differentiation.
Merkestein et al. Supplementary Figure 1 A PLIN WT FTO KO 72 kda FABP4 17 kda HSC70 72 kda B Supplementary Figure 1. Adipogenic protein expression in WT and KO MEFs after 7 days of adipogenic differentiation.
Supplemental Figure 1. VLN5 retains conserved residues at both type 1 and type 2 Ca 2+ -binding
Supplemental Figure 1. VLN5 retains conserved residues at both type 1 and type 2 Ca 2+ -binding sites in the G1 domain. Multiple sequence alignment was performed with DNAMAN6.0.40. Secondary structural
Supplementary Figure 1. Generation of B2M -/- ESCs. Nature Biotechnology: doi: /nbt.3860
Supplementary Figure 1 Generation of B2M -/- ESCs. (a) Maps of the B2M alleles in cells with the indicated B2M genotypes. Probes and restriction enzymes used in Southern blots are indicated (H, Hind III;
Supplementary Figure 1. Characterization of the POP2 transcriptional and post-transcriptional regulatory elements. (A) POP2 nucleotide sequence
1 5 6 7 8 9 10 11 1 1 1 Supplementary Figure 1. Characterization of the POP transcriptional and post-transcriptional regulatory elements. (A) POP nucleotide sequence depicting the consensus sequence for
Functional conservation and diversification of the soybean maturity gene E1 and its homologs in legumes
Functional conservation and diversification of the soybean maturity gene E1 and its homologs in legumes Xingzheng Zhang 1,2#, Hong Zhai 1#, Yaying Wang 1,2, Xiaojie Tian 1,2, Yupeng Zhang 1,2, Hongyan
S156AT168AY175A (AAA) were purified as GST-fusion proteins and incubated with GSTfused
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 Supplemental Materials Supplemental Figure S1 (a) Phenotype of the wild type and grik1-2 grik2-1 plants after 8 days in darkness.
Supplementary Fig S1: Bone marrow macrophages and liver Kupffer cells increase IL-1 in response to adenosine signaling. (a) Murine bone marrow
Supplementary Fig S1: Bone marrow macrophages and liver Kupffer cells increase IL-1 in response to adenosine signaling. (a) Murine bone marrow derived macrophages (BMDM) were primed with LPS for 16 hrs,
HEK293T. Fig. 1 in the
Supplementary Information Supplementary Figure 1 Zinc uptake assay of hzip4 and hzip4-δecd transiently expressed in HEK293T cells. The results of one representative e experiment are shown in Fig. 1 in
Supplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/7/275/275ra20/dc1 Supplementary Materials for Targeted nanoparticles containing the proresolving peptide Ac2-26 protect against advanced atherosclerosis
SUPPLEMENTARY INFORMATION
doi:10.1038/nature09861 & &' -(' ()*+ ')(+,,(','-*+,&,,+ ',+' ' 23,45/0*6787*9:./09 ;78?4?@*+A786?B- &' )*+*(,-* -(' ()*+ ')(+,,(','-*+,&,,+ ',+'./)*+*(,-*..)*+*(,-*./)*+*(,-*.0)*+*(,-*..)*+*(,-*
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tables
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tables Title of file for HTML: Supplementary Data 1 Description: Complete mass isotopomer distribution
Supplementary Materials for
www.sciencemag.org/cgi/content/full/science.1245533/dc1 Supplementary Materials for A Mechanism for Reorientation of Cortical Microtubule Arrays Driven by Microtubule Severing Jelmer J. Lindeboom, Masayoshi
SUPPLEMENTARY INFORMATION
Ca 2+ /calmodulin Regulates Salicylic Acid-mediated Plant Immunity Liqun Du, Gul S. Ali, Kayla A. Simons, Jingguo Hou, Tianbao Yang, A.S.N. Reddy and B. W. Poovaiah * *To whom correspondence should be
Supplementary Figure 1. Effects of STOML3-modulating molecules on other stomatin-domain proteins
Supplementary Figure 1 Effects of STOML3-modulating molecules on other stomatin-domain proteins (a) BiFC signal development observed when cells were transfected with stomatin VC/-VN, STOML1-VC/- VN, STOML2-VC/-VN,
PDIP46 (DNA polymerase δ interacting protein 46) is an activating factor for human DNA polymerase δ
PDIP46 (DNA polymerase δ interacting protein 46) is an activating factor for human DNA polymerase δ Supplementary Material Figure S1. PDIP46 is associated with Pol isolated by immunoaffinity chromatography.
Gene Sequence Fragment size ΔEGFR F 5' GGGCTCTGGAGGAAAAGAAAG GT 3' 116 bp R 5' CTTCTTACACTTGCGGACGC 3'
Supplementary Table 1: Real-time PCR primer sequences for ΔEGFR, wtegfr, IL-6, LIF and GAPDH. Gene Sequence Fragment size ΔEGFR F 5' GGGCTCTGGAGGAAAAGAAAG GT 3' 116 bp R 5' CTTCTTACACTTGCGGACGC 3' wtegfr
SUPPLEMENTARY INFORMATION
AS-NMD modulates FLM-dependent thermosensory flowering response in Arabidopsis NATURE PLANTS www.nature.com/natureplants 1 Supplementary Figure 1. Genomic sequence of FLM along with the splice sites. Sequencing
Supplemental Figure 1: Podocyte specific knockdown of Klf4 in Podocin-Cre Klf4 flox/flox mice was confirmed. (A) Primary glomerular epithelial cells
Supplemental Figure 1: Podocyte specific knockdown of Klf4 in Podocin-Cre Klf4 flox/flox mice was confirmed. (A) Primary glomerular epithelial cells were isolated from 10-week old Podocin-Cre Klf4 flox/flox
TRIM31 is recruited to mitochondria after infection with SeV.
Supplementary Figure 1 TRIM31 is recruited to mitochondria after infection with SeV. (a) Confocal microscopy of TRIM31-GFP transfected into HEK293T cells for 24 h followed with SeV infection for 6 h. MitoTracker
WT Day 90 after injections
Supplementary Figure 1 a Day 1 after injections Day 9 after injections Klf5 +/- Day 1 after injections Klf5 +/- Day 9 after injections BLM PBS b Day 1 after injections Dermal thickness (μm) 3 1 Day 9 after
Electrophoretic Mobility Shift Assay (EMSA). Nuclear extracts were. oligonucleotide spanning the NF-kB site (5 -GATCC-
SUPPLEMENTARY MATERIALS AND METHODS Electrophoretic Mobility Shift Assay (EMSA). Nuclear extracts were prepared as previously described. (1) A [ 32 P] datp-labeled doublestranded oligonucleotide spanning
Supplementary Fig. 1 (Li et al.)
Supplementary Fig. 1 (Li et al.) Fcrg / Supplementary Figure 1 Microcomputed tomography (mct) images of the distal femurs isolated from the indicated bone marrow chimeric mice. indicates the Dap12 -/-
Nature Immunology: doi: /ni.3694
Supplementary Figure 1 Expression of Bhlhe41 and Bhlhe40 in B cell development and mature B cell subsets. (a) Scatter plot showing differential expression of genes between splenic B-1a cells and follicular
Supplementary Figure 1. Nature Structural & Molecular Biology: doi: /nsmb.3494
Supplementary Figure 1 Pol structure-function analysis (a) Inactivating polymerase and helicase mutations do not alter the stability of Pol. Flag epitopes were introduced using CRISPR/Cas9 gene targeting
FIG S1: Calibration curves of standards for HPLC detection of Dopachrome (Dopac), Dopamine (DA) and Homovanillic acid (HVA), showing area of peak vs
FIG S1: Calibration curves of standards for HPLC detection of Dopachrome (Dopac), Dopamine (DA) and Homovanillic acid (HVA), showing area of peak vs amount of standard analysed. Each point represents the
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3363 Supplementary Figure 1 Several WNTs bind to the extracellular domains of PKD1. (a) HEK293T cells were co-transfected with indicated plasmids. Flag-tagged proteins were immunoprecipiated
Flowcytometry-based purity analysis of peritoneal macrophage culture.
Liao et al., KLF4 regulates macrophage polarization Revision of Manuscript 45444-RG- Supplementary Figure Legends Figure S Flowcytometry-based purity analysis of peritoneal macrophage culture. Thioglycollate
Supplementary Figure 1. Xbp1 deficiency does not alter hematopoietic cellularity.
Supplementary Figure 1 Xbp1 deficiency does not alter hematopoietic cellularity. Absolute number of leukocytes obtained from bone marrow (BM, 2 tibias and 2 femurs per mouse) of Xbp1 f/f and Xbp1 Vav1
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature06721 SUPPLEMENTARY INFORMATION. Supplemental Figure Legends Supplemental Figure 1 The distribution of hatx-1[82q] in Cos7 cells. Cos7 cells are co-transfected with hatx-1[82q]-gfp (green)
SAS6-like protein in Plasmodium indicates that conoid-associated apical complex proteins persist in invasive stages within the mosquito vector
SAS6-like protein in Plasmodium indicates that conoid-associated apical complex proteins persist in invasive stages within the mosquito vector Richard J. Wall 1,#, Magali Roques 1,+, Nicholas J. Katris
Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice
Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice Supplementary Material Supplementary Methods Materials Spironolactone, aldosterone and β-glycerophosphate were
Supplementary Figure 1 (A), (B), and (C) Docking of a physiologic ligand of integrin αvβ3, the tenth type III RGD domain of wild-type fibronectin
Supplementary Figure 1 (A), (B), and (C) Docking of a physiologic ligand of integrin αvβ3, the tenth type III RGD domain of wild-type fibronectin (A), D1-CD2 (B), and the D1-CD2 variant 3 (C) to Adomain
Schematic representation of the endogenous PALB2 locus and gene-disruption constructs
Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying
Supplemental Figure 1 (Figure S1), related to Figure 1 Figure S1 provides evidence to demonstrate Nfatc1Cre is a mouse line that directed gene
Developmental Cell, Volume 25 Supplemental Information Brg1 Governs a Positive Feedback Circuit in the Hair Follicle for Tissue Regeneration and Repair Yiqin Xiong, Wei Li, Ching Shang, Richard M. Chen,
i-stop codon positions in the mcherry gene
Supplementary Figure 1 i-stop codon positions in the mcherry gene The grnas (green) that can potentially generate stop codons from Trp (63 th and 98 th aa, upper panel) and Gln (47 th and 114 th aa, bottom
bronchial epithelial cells (I). Bronchi are outlined with dashed line. Scale bars = 25 µm, if not
Supplemental Figure S1: ronchial epithelial cell polarity and integrity is maintained in bronchi. (A-E) Staining for selected markers of bronchial cell differentiation and intracellular compartments is
MLN8237 induces proliferation arrest, expression of differentiation markers and
Supplementary Figure Legends Supplementary Figure 1 827 induces proliferation arrest, expression of differentiation markers and polyploidization of a human erythroleukemia cell line with the activating
BF Fox-3 HLA merge A 3
Supplementary Figure 1 F Fox-3 merge 3 SN TRL L P L TRL SN P Supplementary Figure 1. Series of low magnification brightfield and immunofluorescence images (Fox-3 in green/, and in red). ircles indicate
Supplemental Figure 1.
Supplemental Data. Charron et al. Dynamic landscapes of four histone modifications during de-etiolation in Arabidopsis. Plant Cell (2009). 10.1105/tpc.109.066845 Supplemental Figure 1. Immunodetection
Stargazin regulates AMPA receptor trafficking through adaptor protein. complexes during long term depression
Supplementary Information Stargazin regulates AMPA receptor trafficking through adaptor protein complexes during long term depression Shinji Matsuda, Wataru Kakegawa, Timotheus Budisantoso, Toshihiro Nomura,
Activation of Bacteroides fragilis toxin by a novel bacterial protease contributes to anaerobic sepsis
1 2 3 4 5 6 7 8 Activation of Bacteroides fragilis toxin by a novel bacterial protease contributes to anaerobic sepsis Vivian M. Choi 1,2, Julien Herrou 3, Aaron L. Hecht 1,2, Wei Ping Teoh 1, Jerrold
Nature Biotechnology: doi: /nbt.4166
Supplementary Figure 1 Validation of correct targeting at targeted locus. (a) by immunofluorescence staining of 2C-HR-CRISPR microinjected embryos cultured to the blastocyst stage. Embryos were stained
Developmental Reprogramming in Mesenchymal Stromal Cells of Human Subjects with Idiopathic Pulmonary Fibrosis
Developmental Reprogramming in Mesenchymal Stromal Cells of Human Subjects with Idiopathic Pulmonary Fibrosis Diptiman Chanda 1*, Ashish Kurundkar 1, Sunad Rangarajan 1, Morgan Locy 1, Karen Bernard 1,
Table S1. Oligonucleotide primer sequences
Table S1. Oligonucleotide primer sequences Primer Name DNA Sequence (5 -> 3 ) Description CD19c CD19d Cre7 Sfpi1lox1 Sfpi1lox2 Sfpi1lox3 5 -AACCAGTCAACACCCTTCC-3 5 -CCAGACTAGATACAGACCAG-3 5 -TCAGCTACACCAGAGACGG-3
Supplemental Materials. Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans
Supplemental Materials Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans Madhusudhan Budatha, Shayzreen Roshanravan, Qian Zheng, Cecilia Weislander, Shelby L. Chapman,
Supplementary Information (Aoki, K. et al., "Chromosomal instability by β-catenin/tcf transcription in APC or β-catenin mutant cells")
Supplementary Information (Aoki, K. et al., "Chromosomal instability by β-catenin/tcf transcription in APC or β-catenin mutant cells") Supplementary materials and methods ES cells and Mice The floxed β-catenin
Supplementary Figure 1 PZA inhibits root hair formation as well as cell elongation in the maturation zone of eto1-2 roots. (A) The PI staining of the
Supplementary Figure 1 PZA inhibits root hair formation as well as cell elongation in the maturation zone of eto1-2 roots. (A) The PI staining of the roots of three-day-old etiolated seedlings of Col-0
Nature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Schematic and results of screening the combinatorial antibody library for Sox2 replacement activity. A single batch of MEFs were plated and transduced with doxycycline inducible
STAT3 signaling controls satellite cell expansion and skeletal muscle repair
SUPPLEMENTARY INFORMATION STAT3 signaling controls satellite cell expansion and skeletal muscle repair Matthew Timothy Tierney 1 *, Tufan Aydogdu 2,3 *, David Sala 2, Barbora Malecova 2, Sole Gatto 2,
- Supplementary Information -
TRIM32 dependent transcription in adult neural progenitor cells regulates neuronal differentiation. - Supplementary Information - Anna-Lena Hillje 1, 2#, Maria Angeliki S. Pavlou 1, 2#, Elisabeth Beckmann