Agouti C57BL/6N embryonic stem cells for mouse genetic resources

B6 Albino A ++ Mutant Mice as Embryo Donors for Efficient Germline Transmission of B6 ES Cells. Taconic Webinar Prof. Dr.

B6 Albino A ++ Mutant Mice as Embryo Donors for Efficient Germline Transmission of B6 ES Cells Taconic Webinar 2014-05-14 Prof. Dr. Branko Zevnik A decade of gene targeting in B6 ES cells at TaconicArtemis

(i) A trp1 mutant cell took up a plasmid containing the wild type TRP1 gene, which allowed that cell to multiply and form a colony

1. S. pombe is a distant relative of baker s yeast (which you used in quiz section). Wild type S. pombe can grow on plates lacking tryptophan (-trp plates). A mutant has been isolated that cannot grow

Agouti C57BL/6N embryonic stem cells for mouse genetic resources

Europe PMC Funders Group Author Manuscript Published in final edited form as: Nat Methods. 2009 July ; 6(7): 493 495. doi:10.1038/nmeth.1342. Agouti C57BL/6N embryonic stem cells for mouse genetic resources

GENOME 371, Problem Set 6

GENOME 371, Problem Set 6 1. S. pombe is a distant relative of baker s yeast (which you used in quiz section). Wild type S. pombe can grow on plates lacking tryptophan (-trp plates). A mutant has been

B6 Albino Mouse Models

B6 Albino Mouse Models INTRODUCING TWO NEW B6 ALBINO MODELS ON THE C57BL/6NTac BACKGROUND FOR USE AS BLASTOCYST DONORS FOR B6 ES CELLS AND AS AN IMPROVED BACKGROUND FOR IMAGING OF B6 STRAINS: B6 ALBINO

pass TV Backbone Assay pass Homozygous Loss of WT Allele (LOA) SR- pass 5' Cassette Integrity pass

Gene: Dennd1c Colony prefix: MEKG ESC clone ID: EPD0440_3_A10 Allele: Dennd1c tm1a(eucomm)wtsi Allele type: Knockout First, Reporter-tagged insertion with conditiol potential Allele information: Further

A) (5 points) As the starting step isolate genomic DNA from

GS Final Exam Spring 00 NAME. bub ts is a recessive temperature sensitive mutation in yeast. At º C bub ts cells grow normally, but at º C they die. Use the information below to clone the wild-type BUB

A Low salt diet. C Low salt diet + mf4-31c1 3. D High salt diet + mf4-31c1 3. B High salt diet

A Low salt diet GV [AU]:. [mmhg]: 0..... 09 9 7 B High salt diet GV [AU]:. [mmhg]: 7 8...0. 7.8 8.. 0 8 7 C Low salt diet + mf-c GV [AU]:. [mmhg]:.0.9 8.7.7. 7 8 0 D High salt diet + mf-c E Lymph capillary

Biology 105: Introduction to Genetics PRACTICE FINAL EXAM Part I: Definitions. Homology: Reverse transcriptase. Allostery: cdna library

Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Reverse transcriptase Allostery: cdna library Transformation Part II Short Answer 1. Describe the reasons for

Analysis of gene function

Genome 371, 22 February 2010, Lecture 12 Analysis of gene function Gene knockouts PHASE TWO: INTERPRETATION I THINK I FOUND A CORNER PIECE. 3 BILLION PIECES Analysis of a disease gene Gene knockout or

TRANSGENIC TECHNOLOGIES: Gene-targeting

TRANSGENIC TECHNOLOGIES: Gene-targeting Reverse Genetics Wild-type Bmp7 -/- Forward Genetics Phenotype Gene or Mutations First Molecular Analysis Second Reverse Genetics Gene Phenotype or Molecular Analysis

Map-Based Cloning of Qualitative Plant Genes

Map-Based Cloning of Qualitative Plant Genes Map-based cloning using the genetic relationship between a gene and a marker as the basis for beginning a search for a gene Chromosome walking moving toward

Nature Medicine doi: /nm.2548

Supplementary Table 1: Genotypes of offspring and embryos from matings of Pmm2 WT/F118L mice with Pmm2 WT/R137H mice total events Pmm2 WT/WT Pmm2 WT/R137H Pmm2 WT/F118L Pmm2 R137H/F118L offspring 117 (100%)

Enzyme that uses RNA as a template to synthesize a complementary DNA

Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have

Nature Biotechnology: doi: /nbt.4166

Supplementary Figure 1 Validation of correct targeting at targeted locus. (a) by immunofluorescence staining of 2C-HR-CRISPR microinjected embryos cultured to the blastocyst stage. Embryos were stained

Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms

Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms No. 1 of 10 1. The mouse gene knockout is based on. (A) Homologous recombination (B) Site-specific recombination

Supplementary Information

Supplementary Information MicroRNA-212/132 family is required for epithelial stromal interactions necessary for mouse mammary gland development Ahmet Ucar, Vida Vafaizadeh, Hubertus Jarry, Jan Fiedler,

TRANSGENIC ANIMALS. -transient transfection of cells -stable transfection of cells. - Two methods to produce transgenic animals:

TRANSGENIC ANIMALS -transient transfection of cells -stable transfection of cells - Two methods to produce transgenic animals: 1- DNA microinjection - random insertion 2- embryonic stem cell-mediated gene

Recombinant DNA Libraries and Forensics

MIT Department of Biology 7.014 Introductory Biology, Spring 2005 A. Library construction Recombinant DNA Libraries and Forensics Recitation Section 18 Answer Key April 13-14, 2005 Recall that earlier

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.

!! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which

TITLE: Mammary Specific Expression of Cre Recombinase Under the Control of an Endogenous MMTV LTR: A Conditional Knock-out System

AD Award Number: DAMD17-98-1-8233 TITLE: Mammary Specific Expression of Cre Recombinase Under the Control of an Endogenous MMTV LTR: A Conditional Knock-out System PRINCIPAL INVESTIGATOR: Rama Kudaravalli,

Biology 445K Winter 2007 DNA Fingerprinting

Biology 445K Winter 2007 DNA Fingerprinting For Friday 3/9 lab: in your lab notebook write out (in bullet style NOT paragraph style) the steps for BOTH the check cell DNA prep and the hair follicle DNA

Schematic representation of the endogenous PALB2 locus and gene-disruption constructs

Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying

R1 12 kb R1 4 kb R1. R1 10 kb R1 2 kb R1 4 kb R1

Bcor101 Sample questions Midterm 3 1. The maps of the sites for restriction enzyme EcoR1 (R1) in the wild type and mutated cystic fibrosis genes are shown below: Wild Type R1 12 kb R1 4 kb R1 _ _ CF probe

Supplementary Information

Supplementary Information Super-resolution imaging of fluorescently labeled, endogenous RNA Polymerase II in living cells with CRISPR/Cas9-mediated gene editing Won-Ki Cho 1, Namrata Jayanth 1, Susan Mullen

TRANSGENIC ANIMALS. transient. stable. - Two methods to produce transgenic animals:

Only for teaching purposes - not for reproduction or sale CELL TRANSFECTION transient stable TRANSGENIC ANIMALS - Two methods to produce transgenic animals: 1- DNA microinjection 2- embryonic stem cell-mediated

Supplementary Figure 1. CRISPR/Cas9-induced targeted mutations in TaGASR7, TaDEP1, TaNAC2, TaPIN1, TaLOX2 and TaGW2 genes in wheat protoplasts.

Supplementary Figure 1. CRISPR/Cas9-induced targeted mutations in TaGASR7, TaDEP1, TaNAC2, TaPIN1, TaLOX2 and TaGW2 genes in wheat protoplasts. Lanes 1 and 2: digested CRISPR/Cas9-transformed protoplasts;

Supporting Information

Supporting Information Alenina et al. 10.1073/pnas.0810793106 SI Materials and Methods In Vivo Brain Magnetic Resonance Imaging (MRI). In vivo brain MRI was performed in 6-month-old Tph2 / and control

BENG 183 Trey Ideker. Genotyping. To be covered in one 1.5 hr lecture

BENG 183 Trey Ideker Genotyping To be covered in one 1.5 hr lecture Genetic variation: Some basic definitions Allele Alternative form of a genetic locus inherited separately from each parent Polymorphism

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.

Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid

Inheritance Pattern Complexity

Inheritance Pattern Complexity complexity from how genes transmitted Sex linkage Linkage (coming soon!) complexity from how genes function dominance relationships multiple alleles pleiotropy conditional

T H E J O U R N A L O F C E L L B I O L O G Y

Supplemental material Wang et al., http://www.jcb.org/cgi/content/full/jcb.201405026/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Generation and characterization of unc-40 alleles. (A and

1a. What is the ratio of feathered to unfeathered shanks in the offspring of the above cross?

1. Whether or not the shanks of chickens contains feathers is due to two independently assorting genes. Individuals have unfeathered shanks when they are homozygous for recessive genes at two loci; the

Comparative assessment of vaccine vectors encoding ten. malaria antigens identifies two protective liver-stage

Supplementary Information Comparative assessment of vaccine vectors encoding ten malaria antigens identifies two protective liver-stage candidates Rhea J. Longley 1,,,*, Ahmed M. Salman 1,2,, Matthew G.

1

1 2 3 4 5 Cosmids are plasmid vectors that contain cos sites. The cos site is the only requirement for DNA to be packaged into a phage particle 6 7 8 9 10 11 12 13 14 15 16 For de novo sequencing using

BSCI410-Liu/Spring 06 Exam #1 Feb. 23, 06

Your Name: Your UID# 1. (20 points) Match following mutations with corresponding mutagens (X-RAY, Ds transposon excision, UV, EMS, Proflavin) a) Thymidine dimmers b) Breakage of DNA backbone c) Frameshift

IDN1 and IDN2: two proteins required for de novo DNA methylation in Arabidopsis thaliana.

IDN1 and IDN2: two proteins required for de novo DNA methylation in Arabidopsis thaliana. Israel Ausin, Todd C. Mockler, Joanne Chory, and Steven E. Jacobsen Col Ler nrpd1a rdr2 dcl3-1 ago4-1 idn1-1 idn2-1

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature09937 a Name Position Primersets 1a 1b 2 3 4 b2 Phenotype Genotype b Primerset 1a D T C R I E 10000 8000 6000 5000 4000 3000 2500 2000 1500 1000 800 Donor (D)

Supplementary Figure 1 Activities of ABEs using extended sgrnas in HEK293T cells.

Supplementary Figure 1 Activities of ABEs using extended sgrnas in HEK293T cells. Base editing efficiencies of ABEs with extended sgrnas at Site 18 (a), Site 19 (b), the HBB-E2 site (c), and the HBB-E3

SUPPLEMENTARY INFORMATION

doi:10.1038/nature10163 Supplementary Table 1 Efficiency of vector construction. Process wells recovered efficiency (%) Recombineering* 480 461 96 Intermediate plasmids 461 381 83 Recombineering efficiency

Introduction to some aspects of molecular genetics

Introduction to some aspects of molecular genetics Julius van der Werf (partly based on notes from Margaret Katz) University of New England, Armidale, Australia Genetic and Physical maps of the genome...

Supplementary Information. Optimization of the production of knock-in alleles by CRISPR/Cas9 microinjection into the mouse zygote

Supplementary Information Supplementary Figures S1 to S5 and Tables S1 to S3. Optimization of the production of knock-in alleles by CRISPR/Cas9 microinjection into the mouse zygote Aurélien Raveux, Sandrine

Ultra-dense SNP genetic map construction and identification of SiDt gene controlling the

Ultra-dense SNP genetic map construction and identification of SiDt gene controlling the determinate growth habit in Sesamum indicum L. Haiyang Zhang*, Hongmei Miao, Chun Li, Libin Wei, Yinghui Duan, Qin

Bart Williams, PhD Van Andel Research Center

A History of Genome Editing in the Laboratory Implications for Translational Applications Bart Williams, PhD Van Andel Research Center Introduction by Matthew Denenberg, MD DeVos Childrens Hospital Disclosures:

Lecture 15: Functional Genomics II

Lecture 15: Functional Genomics II High-throughput RNAi screens High-throughput insertional/chemical screens Homologous recombination (yeast and mouse) - Other methods in discerning gene function Activation

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.

/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG

Erhard et al. (2013). Plant Cell /tpc

Supplemental Figure 1. c1-hbr allele structure. Diagram of the c1-hbr allele found in stocks segregating 1:1 for rpd1-1 and rpd1-2 homozygous mutants showing the presence of a 363 base pair (bp) Heartbreaker

Percent survival. Supplementary fig. S3 A.

Supplementary fig. S3 A. B. 100 Percent survival 80 60 40 20 Ml 0 0 100 C. Fig. S3 Comparison of leukaemia incidence rate in the triple targeted chimaeric mice and germline-transmission translocator mice

GENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size.

Student Name: All questions are worth 5 pts. each. GENETICS EXAM 3 FALL 2004 1. a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. b) Name one of the materials (of the two

DESIGNER GENES SAMPLE TOURNAMENT

DESIGNER GENES SAMPLE TOURNAMENT PART ONE- GENETICS PROBLEMS In dogs, the inheritance of hair color involves a gene (B) for black hair and a gene (b) for brown hair. A dominant (C) is also involved. It

BIO 202 Midterm Exam Winter 2007

BIO 202 Midterm Exam Winter 2007 Mario Chevrette Lectures 10-14 : Question 1 (1 point) Which of the following statements is incorrect. a) In contrast to prokaryotic DNA, eukaryotic DNA contains many repetitive

CFTR-null wt CFTR-null 1.0. Probe: Neo R. Figure S1

A. B. 4.0 3.0 2.0 1.0 4.0 3.0 2.0 1.0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 Probe: Neo R CFTR-null wt CFTR-null Figure S1 A. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 10kb 8kb CFTR-null wt B. Probe: CFTR

Revised: RG-RV2 by Fukuhara et al.

Supplemental Figure 1 The generation of Spns2 conditional knockout mice. (A) Schematic representation of the wild type Spns2 locus (Spns2 + ), the targeted allele, the floxed allele (Spns2 f ) and the

Biotechnology Chapter 20

Biotechnology Chapter 20 DNA Cloning DNA Cloning AKA Plasmid-based transformation or molecular cloning First off-let s sum up what happens. A plasmid is taken from a bacteria A gene is inserted into the

Genome-wide genetic screening with chemically-mutagenized haploid embryonic stem cells

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Supplementary Information Genome-wide genetic screening with chemically-mutagenized haploid embryonic stem cells Josep V. Forment 1,2, Mareike Herzog

Student Learning Outcomes (SLOS) - Advanced Cell Biology

Course objectives The main objective is to develop the ability to critically analyse and interpret the results of the scientific literature and to be able to apply this knowledge to afford new scientific

Table S1. Primers used in the study

Table S1. Primers used in the study Primer name Application Sequence I1F16 Genotyping GGCAAGTGAGTGAGTGCCTA I1R11 Genotyping CCCACTCGTATTGACGCTCT V19 Genotyping GGGTCTCAAAGTCAGGGTCA D18Mit184-F Genotyping

Melanization in albino mice transformed by introducing cloned mouse tyrosinase gene

Development 108, 223-227 (1990) Printed in Great Britain The Company of Biologists Limited 1990 223 Melanization in albino mice transformed by introducing cloned mouse tyrosinase gene SATOSHI TANAKA, HIROAKI

Generation of App knock-in mice reveals deletion mutations protective against Alzheimer s. disease-like pathology. Nagata et al.

Generation of App knock-in mice reveals deletion mutations protective against Alzheimer s disease-like pathology Nagata et al. Supplementary Fig 1. Previous App knock-in model did not show Aβ accumulation

BS 50 Genetics and Genomics Week of Nov 29

BS 50 Genetics and Genomics Week of Nov 29 Additional Practice Problems for Section Problem 1. A linear piece of DNA is digested with restriction enzymes EcoRI and HinDIII, and the products are separated

Applicazioni biotecnologiche

Applicazioni biotecnologiche Analisi forense Sintesi di proteine ricombinanti Restriction Fragment Length Polymorphism (RFLP) Polymorphism (more fully genetic polymorphism) refers to the simultaneous occurrence

Human Molecular Genetics Assignment 3 (Week 3)

Human Molecular Genetics Assignment 3 (Week 3) Q1. Which one of the following is an effect of a genetic mutation? a. Prevent the synthesis of a normal protein. b. Alters the function of the resulting protein

7.012 Problem Set 5. Question 1

Name Section 7.012 Problem Set 5 Question 1 While studying the problem of infertility, you attempt to isolate a hypothetical rabbit gene that accounts for the prolific reproduction of rabbits. After much

Supplementary Fig. 1. Microscopic image of cotyledon adaxial epidermis of 3-dayold Col, epf2-1, ros1-4 and rdd. Scale bar, 100 m.

Supplementary Fig. 1. Microscopic image of cotyledon adaxial epidermis of 3-dayold Col, epf2-1, ros1-4 and rdd. Scale bar, 100 m. Supplementary Fig. 2. The small-cell-cluster phenotype of different ros1

Before starting, write your name on the top of each page Make sure you have all pages

Biology 105: Introduction to Genetics Name Student ID Before starting, write your name on the top of each page Make sure you have all pages You can use the back-side of the pages for scratch, but we will

Chapter 5. Structural Genomics

Chapter 5. Structural Genomics Contents 5. Structural Genomics 5.1. DNA Sequencing Strategies 5.1.1. Map-based Strategies 5.1.2. Whole Genome Shotgun Sequencing 5.2. Genome Annotation 5.2.1. Using Bioinformatic

SUPPLEMENTARY INFORMATION

Secondary mutations as a mechanism of cisplatin resistance in BRCA2-mutated cancers Wataru Sakai, Elizabeth M. Swisher, Beth Y. Karlan, Mukesh K. Agarwal, Jake Higgins, Cynthia Friedman, Emily Villegas,

Multiple layers of B cell memory with different effector functions. Ismail Dogan, Barbara Bertocci, Valérie Vilmont, Frédéric Delbos,

Multiple layers of B cell memory with different effector functions Ismail Dogan, Barbara Bertocci, Valérie Vilmont, Frédéric Delbos, Jérome Mégret, Sébastien Storck, Claude-Agnès Reynaud & Jean-Claude

Supplementary Figure 1. Isolation of GFPHigh cells.

Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding

SUPPLEMENTARY INFORMATION

Gene replacements and insertions in rice by intron targeting using CRISPR Cas9 Table of Contents Supplementary Figure 1. sgrna-induced targeted mutations in the OsEPSPS gene in rice protoplasts. Supplementary

Exam 3 4/25/07. Total of 7 questions, 100 points.

Exam 3 4/25/07 BISC 4A P. Sengupta Total of 7 questions, 100 points. QUESTION 1. Circle the correct answer. Total of 40 points 4 points each. 1. Which of the following is typically attacked by the antibody-mediated

Chapter 10 (Part II) Gene Isolation and Manipulation

Biology 234 J. G. Doheny Chapter 10 (Part II) Gene Isolation and Manipulation Practice Questions: Answer the following questions with one or two sentences. 1. What does PCR stand for? 2. What does the

GENOTYPING BY PCR PROTOCOL FORM MUTANT MOUSE REGIONAL RESOURCE CENTER North America, International

Please provide the following information required for genetic analysis of your mutant mice. Please fill in form electronically by tabbing through the text fields. The first 2 pages are protected with gray

Concepts: What are RFLPs and how do they act like genetic marker loci?

Restriction Fragment Length Polymorphisms (RFLPs) -1 Readings: Griffiths et al: 7th Edition: Ch. 12 pp. 384-386; Ch.13 pp404-407 8th Edition: pp. 364-366 Assigned Problems: 8th Ch. 11: 32, 34, 38-39 7th

Supplementary Figure 1. Nature Structural & Molecular Biology: doi: /nsmb.3494

Supplementary Figure 1 Pol structure-function analysis (a) Inactivating polymerase and helicase mutations do not alter the stability of Pol. Flag epitopes were introduced using CRISPR/Cas9 gene targeting

Nature Genetics: doi: /ng Supplementary Figure 1

Supplementary Figure 1 Ihh interacts preferentially with its upstream neighboring gene Nhej1. Genes are indicated by gray lines, and Ihh and Nhej1 are highlighted in blue. 4C seq performed in E14.5 limbs

Figure S1. Generation of HspA4 -/- mice. (A) Structures of the wild-type (Wt) HspA4 -/- allele, targeting vector and targeted allele are shown together with the relevant restriction sites. The filled rectangles

Donor DNA Utilization during Gene Targeting with Zinc- finger Nucleases

Donor DNA Utilization during Gene Targeting with Zinc- finger Nucleases Kelly J. Beumer, Jonathan K. Trautman, Kusumika Mukherjee and Dana Carroll Department of Biochemistry University of Utah School of

GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.

!! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,

Phenotypic SNPs to Aid in Forensic Analyses

Angela van Daal, Ph.D. Phenotypic SNPs to Aid in Forensic Analyses Overview Why type phenotypic SNPs? Phenotypic traits Heritability Pigmentation Hair, skin, eye colour Genetics NIJ project Height Face

Mouse Engineering Technology. Musculoskeletal Research Center 2016 Summer Educational Series David M. Ornitz Department of Developmental Biology

Mouse Engineering Technology Musculoskeletal Research Center 2016 Summer Educational Series David M. Ornitz Department of Developmental Biology Core service and new technologies Mouse ES core Discussions

SUPPLEMENTAL MATERIALS

SUPPLEMENL MERILS Eh-seq: RISPR epitope tagging hip-seq of DN-binding proteins Daniel Savic, E. hristopher Partridge, Kimberly M. Newberry, Sophia. Smith, Sarah K. Meadows, rian S. Roberts, Mark Mackiewicz,

A Naturally Occurring Epiallele associates with Leaf Senescence and Local Climate Adaptation in Arabidopsis accessions He et al.

A Naturally Occurring Epiallele associates with Leaf Senescence and Local Climate Adaptation in Arabidopsis accessions He et al. Supplementary Notes Origin of NMR19 elements Because there are two copies

Chapter 5 Genetic Analysis in Cell Biology. (textbook: Molecular Cell Biology 6 ed, Lodish section: )

Chapter 5 Genetic Analysis in Cell Biology (textbook: Molecular Cell Biology 6 ed, Lodish section: 5.1+5.4-5.5) Understanding gene function: relating function, location, and structure of gene products

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.

Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers

Supplemental Figure 1

Supplemental Figure 1 Supplemental Figure 1 (previous page): Heavy chain gene content of ARS/Igh66 transgenic lines. A. Tail DNA from the indicated transgenic lines was amplified for the indicated gene

1a. What is the ratio of feathered to unfeathered shanks in the offspring of the above cross?

Problem Set 5 answers 1. Whether or not the shanks of chickens contains feathers is due to two independently assorting genes. Individuals have unfeathered shanks when they are homozygous for recessive

Protocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection

Protocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection Written by Dan Dickinson (daniel.dickinson@austin.utexas.edu) and last updated January 2018. A version

BSCI 410-Liu Homework#1 Key Spring 05

1. (8 points) The following is a list of mutational changes. For each of the specific mutations indicate which type of mutation best describes the change. Sometimes, more than one term could be used to

Supplementary Methods

Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed

SUPPLEMENTARY INFORMATION

doi:.38/nature08267 Figure S: Karyotype analysis of ips cell line One hundred individual chromosomal spreads were counted for each of the ips samples. Shown here is an spread at passage 5, predominantly

Supplementary Figure 1 Generation of migg1-yf mice. (A) Targeting strategy. Upper panel: schematic organization of the murine ɣ1 immunoglobulin

Supplementary Figure 1 Generation of migg1-yf mice. (A) Targeting strategy. Upper panel: schematic organization of the murine ɣ1 immunoglobulin locus. The EcoRI restriction site between exons M1 and M2

Chapter 15 Gene Technologies and Human Applications

Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect

Nature Biotechnology: doi: /nbt Supplementary Figure 1. In vitro validation of OTC sgrnas and donor template.

Supplementary Figure 1 In vitro validation of OTC sgrnas and donor template. (a) In vitro validation of sgrnas targeted to OTC in the MC57G mouse cell line by transient transfection followed by 4-day puromycin

Using mutants to clone genes

Using mutants to clone genes Objectives 1. What is positional cloning? 2. What is insertional tagging? 3. How can one confirm that the gene cloned is the same one that is mutated to give the phenotype

Lecture 20: Drosophila melanogaster

Lecture 20: Drosophila melanogaster Model organisms Polytene chromosome Life cycle P elements and transformation Embryogenesis Read textbook: 732-744; Fig. 20.4; 20.10; 20.15-26 www.mhhe.com/hartwell3

BA, BSc, and MSc Degree Examinations

Examination Candidate Number: Desk Number: BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Genetics Time Allowed: 1 hour and 30 minutes Marking Scheme: Total marks available

Supporting Online Material Y. Tang et al., published 1/24/03

Y. Tang SOM, p. 1 Supporting Online Material Y. Tang et al., published 1/24/03 MATERIALS AND METHODS Construction of the Targeting Vector and Generation of Mice Carrying Mutations Targeting vector. Recombinant

SUPPLEMENTARY INFORMATION

Supplementary Figure S1 Colony-forming efficiencies using transposition of inducible mouse factors. (a) Morphologically distinct growth foci appeared from rtta-mefs 6-8 days following PB-TET-mFx cocktail

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright