Nature Methods: doi: /nmeth Supplementary Figure 1. Microfluidic chip layout.
|
|
- Thomas Douglas
- 5 years ago
- Views:
Transcription
1 Supplementary Figure 1 Microfluidic chip layout. Positions where inlet and outlet tubing are connected are marked with. Arrays of pillars filter out debris and dust particles to avoid clogging of the narrow channel. The region of interest of the camera is positioned at the end of the 300 µm long channel during the measurement (measurement region).
2 Supplementary Figure 2 Principle and characterization of the fluorescence detection of RT-FDC. (a) Light sheet excitation and detection of fluorescence results in fluorescence peaks with widths depending on fluorophore localization. (b) Aperture function in focal plane (x-y) of excitation and detection for the three fluorescence channels/lasers. (c) Determination of thickness of the light sheet along the channel axis x yielded values of 3.64 ± 0.03 µm for 488 nm, 3.16 ± 0.02 µm for 561 nm, and 3.41 ± 0.05 µm for 640 nm. Thus, the line width is smaller than most eukaryotic cells and it can be used to identify sub-cellular distribution of fluorescent probes. (d) Measurement of two-color fluorescent agarose beads with heterogeneous sizes. Plotted are the fluorescence peak widths of the green (FL-1: 525/50 nm) and red (FL-3: 700/75 nm) channels. The linear fit indicates that the system determines nearly identical sizes in both channels. Experiments a-c were repeated three times with similar results.
3 Supplementary Figure 3 Calibration bead measurements. Calibration beads with 8 populations were measured with RT-FDC and FCM (BD LSR II) for all three channels. (a-c) Fluorescence intensity histograms from RT-FDC measurements. Small labels in graph denote the peak position. (a) Green FL-1 channel (525/50 nm), (b) red FL-2 channel (593/46 nm), and (c) deep red FL-3 channel (700/75 nm). (d) Normalized sub-population intensities are compared versus peak or population index. (e-g) Histograms from LSR II FCM data for corresponding channels. (e) Green channel (530/30 nm), (f) red channel (575/26 nm), and (g) deep red channel (670/14 nm). Both methods consistently identify eight populations of objects with intensities over a dynamic range of three orders of magnitude. Experiments a-b, e-g were repeated three times with similar results.
4 Supplementary Figure 4 Evaluation of CD34 + subpopulation regarding image-processing-based parameters deformation, size, brightness, and granularity. CD34 - cells are plotted in gray while CD34 + cells are shown in colors that encode density of data points. (a) Deformation of CD34 + HSPCs vs. CD34-APC fluorescence intensity. (b) Projected area vs. CD34-APC fluorescence intensity. (c-d) Image-based brightness evaluation. (c) Brightness inside cell contour plotted over the CD34-APC intensity. Brightness can be used as an additional marker to identify subsets of leukocytes, as recently shown in Toepfner et al. 11. (d) Granularity is characterized by the standard deviation of the pixel brightness values inside the cell contour, and plotted over CD34-APC intensity. There was no correlation of CD34-expression level detectable with either parameter. However, the CD34-positive HSPCs seem to have relatively low spread in the brightness parameters compared to the very heterogeneous CD34-negative cells. Experiments (a-d) were repeated three times independently with similar results.
5 Supplementary Figure 5 Three-color antibody staining of HSPCs. Blood samples from GSF mobilized donors were collected after apheresis and stained with CD3-FITC, CD34-PE, and CD14-APC. (a) Gating strategy for exclusion of RBCs by cell size and brightness. (b) Gate for CD34-positive cells by fluorescence intensity. (c) Gate for CD3 CD14 subpopulation for exclusion by lineage markers. (d) Resulting mechanical fingerprint for CD34 + CD3 CD14 subpopulation. (e) Back-gated subpopulation from (d) in initial representation. (f) CD3 + fraction in mechanical fingerprint. (g) CD14 + fraction. (h) CD34 + fraction with all other cells shown in gray. Experiment was performed once.
6 Supplementary Figure 6 Representative flow cytometry measurement of CD34 APC-stained G-CSF-mobilized blood samples. (a) Forward scatter vs. side scatter plot with gate 1 to separate cell events from debris. (b) Fluorescently labeled CD34 + cells are found in gate 2 in the side scatter vs. APC intensity plot. (c) Histogram of fluorescence peak heights for cells of gate 1 (gate 3 = CD34 + ). Experiment was performed three times independently with similar results.
7 Supplementary Figure 7 The mechanical properties of immature versus mature red blood cells (RBCs). Reticulocytes are the immature fraction of RBCs and represent normally about 5 15 of the total number of RBCs in circulating human blood 12. During the first two days after being released to the blood stream, reticulocytes lose their cytoplasmic RNA as they mature to RBCs. This enabled us to use nucleic acid staining with syto13 to identify RNA-positive reticulocytes by fluorescence. Fluorescence read-out is compared between commercial LSR II FCM (a) and RT-FDC (b) as shown in the histograms. (c) Comparison of reticulocyte fraction determined with RT-FDC and state-of-the-art automatic blood count (XE-5000, Sysmex Deutschland) for three donors. Columns show counts, error bars represent standard error resulting from Poisson statistics. Reticulocyte numbers relative to RBCs were in agreement. (d) Location of RBC and reticulocyte population medians in deformation vs. area plot. (Shaded regions are for illustration purposes) Red blood cells have median size of µm 2 and deformation of while reticulocytes are larger (39.2 µm 2 ) and show smaller deformation (0.240). The difference indicated by arrows was significant as tested with linear mixed model analysis (Supplementary Table 2). (e,f) Representative deformation vs. area plots of reticulocytes and mature RBCs. (g) Deformation vs. syto13 fluorescence, and (h) area vs. syto13 fluorescence. Results are in line with previous reports on reticulocytes 13, which had been restricted to labor-intensive micropipette and micro-pore assays with limited number of cells. We found human reticulocytes in whole blood samples to be slightly larger and less deformed compared to RBCs (d, Supplementary Table 2). Increased reticulocytosis has been linked with increased morbidity in infants with sickle cell anemia 14 and RBC distribution width is also used as a predictor of poor clinical outcome in settings of various diseases including coronary heart disease 15. Adding RT-FDC phenotyping to the reticulocyte indices in clinical use could therefore provide a means of monitoring changes of blood rheology in haematological diseases 11,15. Experiments (a,b) were performed once, (c-h) were performed with samples from three different donors.
8 Supplementary Figure 8 1D-fluorophore localization detection by fluorescence peak width. We used 1D imaging to detect the subcellular, nuclear localization of a fluorescent protein by comparing fluorescence peak widths for cells expressing nuclear localization sequence (nls) tagged and cytoplasmic (cyt) fluorescent proteins. Here, HeLa cells were transfected with plasmids expressing GFP and mrfp with and without nuclear locator sequence (nls). Red dots: cytosolic RFP and nuclear GFP, black dots: both fluorophores cytosolic, green dots cytosolic GFP and nuclear RFP. Cells where GFP and RFP fluorophores co-localize can be found on the diagonal of this plot. Since, in animal cells, cell cycle progression involves changes in nuclear permeability, we were able to exploit this feature to identify mitotic cells in heterogeneous population to identify mitotic cells in the Drosophila RNAi screen (see Fig. 2c). This experiment also serves to show that the green and red channel can be used interchangeably for this kind of analysis. Experiments were performed 3 times independently with similar results.
9 Supplementary Figure 9 Effect of colchicine treatment on fraction of mitotic Kc167 cells. Fluorescence peak width plots (tdtomato vs. nls-gfp) for (a) non-treated or (b) colchicine treated cells show that colchicine treatment increases the number of cells with cytosolic nls-gfp (fraction of cells with even peak widths, localized along diagonal). During mitotic entry, the nuclear envelope breaks down releasing the nls-gfp protein to the cytosol, which affects the measured peak width in the GFP channel. This is exploited to identify mitotic cells in RT-FDC measurements. Mitotic cells represented by colored dots, interphase cells shown in gray. (c) Comparison with manually inspected confocal microscopy images of Hoechst33342 stained cells. Bar graphs show percentages obtained from counting, error bars indicate standard error resulting from Poisson statistics. For microcopy non-sync. 49/1063 (mitotic/total) cells were analyzed, for microscopy sync. 156/928 cells, and for RT-FDC non-sync. 388/6871 and 1078/6120 cells were analyzed. Experiments (a,b,c) were performed once.
10 Supplementary Figure 10 Data processing of Kc167 RNAi screen. For each gene, experiments with two dsrna variants were performed, each repeated on three different days and two different flowrates. Exemplary graphs for gene 10 (Rok) at 0.04 µl/s flow-rate are shown. The statistical analysis for this and all other sets of
11 measurements is available in Supplementary Table 3. Mitotic cells are represented by colored dots while limited number of interphase cells is shown in gray. All experiments (center column) were compared against a mock control (left column) from the same day. See right column for comparison of the scatter plots. Dashed contour lines are drawn at 50 % of the maximum density of data points, and solid contour lines at 95 %. Data from mock and treatment were transformed into elastic modulus values for comparison by the linear mixed model analysis (Supplementary Fig. 10 and Supplementary Table 3).
12 Supplementary Figure 11 Results of the screen for genes regulating mitotic cell mechanics in Kc167 cells. For each gene two dsrna constructs were used and each dsrna treatment was repeated three times on separate days. The size and deformation data was transformed into E modulus using Shapeout software and statistical analysis was performed using a linear mixed model. Genes with consistent results for both flowrates and both p-values <0.05 were considered as hits. ( * : p<0.05, ** : p<0.01)
13 Supplementary Figure 12 Two-color fluorescence detection of FUCCI cell-cycle marker 16. (a) Two color fluorescence scatter plot with gates for G1, S and G2/M phase. (b) A pulse width evaluation enables detection of mitotic cells because of GFP localization inside the nucleus during interphase and in the cytosol during mitosis, resulting in wider pulses. (c-f) Cell cycle specific mechanical fingerprints for the mixed sample for G1, S, G2 and mitosis. Experiments were performed 10 times independently with similar results.
14 Supplementary Figure 13 Effect of suspension on RPE1 cells. (a) Cell cycle phase-specific mechanical fingerprint of RPE1 cells directly after being detached from plate using trypsin (cyan), and after 30 minutes in suspension (magenta). Contours show 95 % density iso-lines, dashed contours 50 % iso-lines. (b) Comparison of deformation medians of N=10 replicates. In interphase the cells show a significant change in deformability due to being kept in suspension for 30 min. The mitotic subpopulation on the other hand, does not change significantly based on t-test (two-sided, Welch corrected) with **: p<0.01 and n.s.: p Box plot whiskers range from 5 th to 95 th percentiles, box from 25 th to 75 th percentile, horizontal line denotes the median, and mean is symbolized by a small square. N=10 replicates with samples from the same cell culture but treated and measured independently on different days, were analyzed.
15 Supplementary Figure 14 Technical details of the alignment light path. For (a) excitation and (b) emission light paths of the RT-FDC setup. For an explanation of the various parts, see Online Methods, section Experimental Setup.
16 Supplementary Material Real-time fluorescence and deformability cytometry Supplementary discussion of RNAi screening results The combined advantage of detecting the 1D-spatial distribution of specific fluorescent molecular markers and high throughput mechanical phenotyping of RT-FDC opens up the new possibility of conducting large-scale screens for regulators of cell mechanics involved in particular cellular functions. Here we exemplarily used RT-FDC to identify regulators of cell mechanics of mitotic cells in the Drosophila cell line Kc167. These are ideal for such an analysis because I) they grow at room temperature, II) they have low genetic redundancy relative to human cells, III) RNAi is highly efficient in these cells, IV) they can grow in suspension 1. However, despite the utility of the system for screening cell phenotypes, using existing technology such as RT-DC and AFM, it has not been possible to screen large numbers of cells and specifically identify cells of rare populations (as mitotic cells). Thus, in order to carry out such a screen, we needed a way of identifying the small percentage of cells that are present in mitosis. To do so, we generated a novel Kc167 cell line expressing nls-gfp and cytoplasmic tdtomato. This enables the identification of mitotic cells on the basis of having similar nls-gfp and cytoplasmic tdtomato fluorescence peak widths (see Fig. 2a), something only apparent after permeabilization of the nuclear envelope which happens at the mitotic entry. Using this cell line, we then characterized mechanical changes in this subpopulation with knockdown of 42 selected genes (see Supplementary Tables 3,5). The set of genes was chosen to test the impact of silencing genes that represent positive and negative regulators of the Rho pathway, which has been implicated in the control of mitotic cell cortex mechanics 2. Each knock-down line was measured in three independent repeats and data for two flowrates was collected (see Online Methods). A linear mixed model 3 was then used to compare treatment and control samples, because it allows for disentangling the effects of the treatment from effects of random variation (Supplementary Fig. 10) present in measurements of biological repeats of the sample. Causes for this variation include differences in knock down efficiency between the repeats but also between the different dsrnas used. Day-to-day variations, such as the experimental room temperature might also affect the deformation that we measure. These day-to-day variations were considered by comparing each sample to a control measured on the same day, while random experimental influences are considered by the linear mixed model analysis. Higher flow rates cause higher stresses on the cells. So, as an additional precaution, only effects consistently appearing for a higher and a lower flow rate (0.04 µl/s and 0.06 µl/s) and so for two different stresses were considered in the analysis. Cells were synchronized in prometaphase with colchicine treatment, which enriched the mitotic population (Supplementary Fig. 9), without changing the mechanical phenotype of mitotic cells (Supplementary Table 4). To compensate for potential cell size changes due to gene depletions, we utilized a numerical model 4 for calculating elastic modulus for cells deformed in RT-FDC. A linear mixed model 3 was then used to compare treatment
17 and control samples. The analysis pipeline and all results are shown in Supplementary Fig. 10 and Table 3 respectively, and the summary of the results for elastic modulus changes are shown in Supplementary Fig. 11. Here we discuss the results in some detail. Consistent with known functions of Rho in mitosis 5, we observed a drastic decrease in elastic modulus of mitotic cells after depletion of Rho1. This was the only small GTPase of the Rho family whose depletion significantly altered mitotic cell mechanics (Supplementary Fig. 11). Activation of Rho depends on the activity of Guanine nucleotide Exchange Factors (GEFs) while the protein is deactivated by GTPase Activating Proteins (GAPs). Thus, depletion of Rho GEFs responsible for activating Rho1 would be expected to mimic the rho1-kd phenotype, while depletion of Rho GAPs would be expected to have the opposite effect to that of Rho1 depletion. We observed that knock-down of the pebble gene resulted in highly compliant mitotic cells which is in line with existing data 6. On the other hand, depletion of other GEF proteins (namely RhoGEF2, RhoGEF3 and RhoGEF4) did not reproduce the phenotype of Rho1 depletion. We also found that depletion of six different GAP proteins showed a statistically significant increase in cells elastic modulus. This may suggest a redundant role for the GAP proteins in regulating Rho signaling in mitotic Drosophila cells. We note that a RhoGAP protein which is believed to regulate mitotic cells contractility in human cell lines and in C. elegans has no homologue in flies 7. Downstream of Rho1 activation, a molecular signaling cascade was identified that appears to mediate its impact on the cytoskeleton 2,8 10. In our screen, the elastic modulus of mitotic cells was significantly lower than of control cells after the depletion of Rho Associated Kinase (drok), Myosin Light Chain protein, and Myosin II Heavy Chain protein. Moesin which was shown to also regulate properties of mitotic cells 8 in our screen had an impact, but only visible in one flowrate, while the change was less significant in second flowrate (p>0.05). When actin regulators were considered, we detected changes in mitotic cell mechanics upon depletion of Cofilin and Diaphanous proteins, both previously implicated in regulating mitotic cells mechanics 9,10. Interestingly we noted a clear change in the phenotype of cells depleted of Cofilin protein, however the cells appeared stiffer than the control cells, which is in contrary to results published by Chugh P and coworkers 10. This may be due to the presence of unusual cell protrusions and shapes present in strains depleted of Cofilin protein. We detected no significant changes following depletion of other actin regulators (Supplementary Fig. 11), which is consistent with the results published recently where actin cytoskeleton regulators were investigated for their ability to change thickness of the mitotic cells cortex 10. All together the data collected for this screen is in good agreement with data obtained by other methods for measuring cell mechanics of mitotic cells. We were able to detect changes that are a result of disrupting Rho signaling, in both positive and negative directions through changes to both actin and/or myosin II, and were able to demonstrate a novel role for the RhoGAP proteins to the negative regulation of mitotic cell mechanics.
18 Supplementary Tables Pos (mech.) Neg (mech.) Pos (fl.) 69% (n=422) 31% (n=189) Neg (fl.) 9% (n=10.090) 91% (n= ) Supplementary Table 1 Confusion matrix for identification of CD34 + positive cells using gating by mechanical phenotype. Parameter Unit Intercept Int. Std. Treatment Tr. Std. p-value Area µm² Deformation Supplementary Table 2 Linear mixed model evaluation for properties of red blood cells ( Intercept ) and reticulocytes ( Treatment ). The Intercept of the LMM is an estimate of the mean value of the control group, which has a standard error ( Int. Std. ). The column Treatment shows the difference between control and tested group, its associated error ( Tr. Std. ), and the significance of the difference ( p-value ). The table shows that reticulocytes are significantly larger and less deformable. Samples from three different donors were measured independently. p<0.05 is considered significant. Gene symbol Flowrate (ul/s) Intercept (kpa) Int. Std. (kpa) Treatmen t (kpa) Tr. Std. (kpa) p-value Moe sqh Rok E zip dia pbl scra
19 Rac RhoGAP1a RhoGAP54d RhoGAPp Cdc Rho capt cpb flr SCAR tsr alpha-spec beta-spec Tm conu Rac RhoGEF RhoGEF RhoGEF RhoGAP93B
20 RhoGAP92B RhoGAP71E RhoGAP68F RhoGAP5A RhoGAP19D RhoGAP18B RhoGAP16F RhoGAP15B RhoGAP A RhoGAP100 F RhoL RhoBTB Mtl Miro RhoU Supplementary Table 3 Linear mixed model evaluation of mechanical properties (elastic modulus) of control mitotic Kc167 cells ( Intercept ) and knock down cells ( Treatment ). Column description as in Supplementary Table 2. Results for two flow rates for each of the 42 gene knock-downs are represented in rows. The data is summarized in Fig. 2e. For each gene 2 independent dsrna constructs were used and each dsrna treatment was performed thrice on different day each. The data was
21 analyzed using linear mixed model analysis. Genes with consistent results for both flowrates and both p-values <0.05 were considered as hits.
22 Parameter Unit Intercept Int. Std. Treatment Tr. Std. p-value Area µm² Deformation E-modulus kpa Supplementary Table 4 Linear mixed model evaluation for properties of nonsynchronized mitotic Kc17 cells ( Intercept ) and colchicine treated mitotic Kc167 cells (Treatment). Description of columns as in Supplementary Table 2. While there is a significant change in size and deformation caused by colchicine treatment, the elastic modulus is not affected. This might appear counterintuitive. However, larger cells experience more stress and thus should deform more, even though their mechanical properties are identical. The size change is likely due to the fact that cells continue to grow when they are blocked in cell cycle. For this test two samples from same cell culture treated independently on three different days for each condition (treated/untreated) were measured. p<0.05 was considered significant. Gene symbol RhoA Mtl Rac2 RhoL Miro cdc42 Primer name Primer sequence taatacgactcactatagggagcaaaaatgaagcaggagc taatacgactcactataggggagcaaaaggcatctggtct taatacgactcactataggggacgacgattcgcaagaaattg taatacgactcactatagggctgtttgccatccacctcg taatacgactcactatagggcagtacacagctatcggcaca taatacgactcactatagggcacatattcgccgggaaag taatacgactcactatagggacacaatacaggtctcgctgg taatacgactcactatagggatcgggacagtggtgcttta taatacgactcactatagggcgaagcattcaaaaactgtctg taatacgactcactatagggatgggttcagcagctcgat taatacgactcactataggggagtgtgccgataatcctgg taatacgactcactatagggctccagatacttgaccgcag taatacgactcactataggggcccgctgaaaataaccat taatacgactcactatagggcagtgtcccagagggtcaga taatacgactcactatagggaccaactgcttcctgttgtg taatacgactcactataggggtggtcacgaacttctccga taatacgactcactatagggacatccgcctgcaagaagt taatacgactcactatagggtttttctgtatcacggccttc taatacgactcactatagggggatccgatgtttttggatg taatacgactcactataggggctgccacactaggcgac taatacgactcactataggggagaagctggccaagaacaa taatacgactcactataggggcgtgtgaggaaagcagaat taatacgactcactatagggcgctcctcctcgttgataag
23 taatacgactcactataggggtactccgacgggaacttgt RhoU taatacgactcactatagggccaccaaatgcgaatatgaa taatacgactcactataggggtctctgcgaattgttatacgg taatacgactcactatagggcgatcgtttcgttcgtttg taatacgactcactatagggcacttgcaacgtttgaatttct RhoBTB taatacgactcactataggggagcagccgcatcaagag taatacgactcactatagggatgcgatactggtcaatggc taatacgactcactatagggatgtggtgctgctgtgctt taatacgactcactatagggaacaaaggttcccttctcgc Rac1 taatacgactcactatagggcggtcacactgcagtacaca taatacgactcactatagggtggactggagtgctatgtgc taatacgactcactatagggccaagtggtatccggaggt taatacgactcactatagggtccagatacttgaccgctcc pebble taatacgactcactatagggggccgcatttagagctgat taatacgactcactataggggccttcctatcgacaggtgc taatacgactcactatagggtggaagagttggctgaaacc taatacgactcactataggggacgtatggtggatacgcct RhoGEF 4 taatacgactcactatagggcaacaccgttgtggaaaactc taatacgactcactataggggatgaagcccacccaagtg taatacgactcactatagggagcaacaacagcagtccgat taatacgactcactatagggcgcaggaattctccgttaag RhoGEF 2 taatacgactcactatagggcacatatcaaaacccattggaa taatacgactcactatagggccagtcaccagaagtggttg taatacgactcactataggggacgaacatgaatacgatgagg taatacgactcactatagggaattactggtgactgtggcg RhoGEF 3 taatacgactcactataggggctgaggaagccactgctc taatacgactcactatagggggcaacaaagtccacactgg taatacgactcactatagggcccttatttggcgttcttcc taatacgactcactatagggcgacaccacacgatccatt RhoGA P71E taatacgactcactataggggccgacgatgatgaggac taatacgactcactataggggctgctgttgttggtagtgg taatacgactcactatagggaaaaggcatagcagctccg taatacgactcactatagggctttgaaaagccagctttgatt RhoGA P93B taatacgactcactataggggccaccacagcaaatccta taatacgactcactatagggtccgctcttggttgcat taatacgactcactatagggcagcacatcttcagcgcata taatacgactcactatagggatgacataatgcactggccata RhoGA P18B taatacgactcactatagggggagtgcgccataagttgtc taatacgactcactatagggaggcttagcgtttcatccg taatacgactcactataggggagtgtggaaacccagatcc taatacgactcactataggggtcactggcacaatcctcaa
24 RhoGA P102A taatacgactcactatagggtggtatccgtcggaacattt taatacgactcactatagggacaatactgagcgaggattctga taatacgactcactatagggttctgttgatacatgcccaca taatacgactcactataggggtcaaatgagtgcttcgcaa RhoGA P92B taatacgactcactataggggtcacacccgcctcacttt taatacgactcactatagggtgacagattttcggctgcta taatacgactcactatagggcgagctggagaagacgatg taatacgactcactatagggctgcgcttcagcgaggtat RhoGA P54d taatacgactcactatagggcactggttaggtagcgtctcg taatacgactcactatagggaataacgactgccaacggat taatacgactcactatagggacaagatgagcgccgataac taatacgactcactatagggggcgacatggttttctttct RhoGA P100F taatacgactcactatagggaaggacccggtgatgctac taatacgactcactatagggccttgttcatcagcttgtgg taatacgactcactatagggatgggtgagcctccaaact taatacgactcactatagggccaggctgtccaggatagaa RhoGA P5A taatacgactcactataggggagttctgcgccaacttctt taatacgactcactatagggggtcagatccgtgccaaatac taatacgactcactatagggctatacggctccgagtacca taatacgactcactatagggcgggcttatagaggagcttg RhoGA P16F taatacgactcactatagggataaccaaggtgccgctg taatacgactcactataggggatcatcagcttgacgcagt taatacgactcactatagggacacttgacgtcactgggaa taatacgactcactataggggctatcgggttgttcgcaa RhoGA P68F taatacgactcactatagggccgcatacattctacatgcc taatacgactcactataggggtaatctcggcgcgaaac taatacgactcactataggggaacttgagcccgaggaag taatacgactcactatagggcacaaatccttccagttggg RhoGA P15B taatacgactcactatagggcctctatccagagctgcgtc taatacgactcactatagggggctcctggacattctcatt taatacgactcactataggggctgatctccgccaagaat taatacgactcactataggggcctcctgattggcatacaa RhoGA P19D taatacgactcactataggggccattatcctccagctcct taatacgactcactataggggtccaggtgcagatgaagc taatacgactcactatagggtaccaagtgaaagcgatgga taatacgactcactatagggatctgcaggacatcgcact rhogap 1a taatacgactcactatagggatcggatcggaaaaggtgag taatacgactcactatagggtcgacatcgttttctagacgc taatacgactcactataggggactggcggagatgtttgac taatacgactcactataggggtttcgcgtagcaaatcgtt conu taatacgactcactatagggctgcttccgcctgaaaataga
25 taatacgactcactatagggcactgagcggccattcttac taatacgactcactatagggtctaaaaaggacttggaaccca taatacgactcactatagggtatcaggtttccgttttggc rhogapp 190 taatacgactcactataggggagggcgtcgagtaccagt taatacgactcactatagggcatcgggcatgactttctg taatacgactcactatagggacttcagcggatccacacat taatacgactcactataggggctgaccagctggaagttct zip taatacgactcactatagggtggaggaagccgaactaaaa taatacgactcactatagggatttcttgcatttgggtggt taatacgactcactataggggtgagcgccgtcctactg taatacgactcactataggggaactccacctgctcctttg sqh taatacgactcactatagggcacacacatcactccagcg taatacgactcactatagggaatctgcgcctgatcgaa taatacgactcactatagggcgactacctcgaattcacgc taatacgactcactatagggctggcaccaacatctcacac Rok taatacgactcactataggggatacacaaggagcatgtggac taatacgactcactataggggatatcttgctgccatcggt taatacgactcactatagggttggcaatgcagatcaatca taatacgactcactataggggaacgatccattcggagttg dia taatacgactcactatagggctggacagtctgttcggaag taatacgactcactatagggcctcttgtccttcggaatgt taatacgactcactataggggacgattgagaagctgctgg taatacgactcactatagggagcagcttgagggcttcac Moe taatacgactcactatagggaaactttagcgtgcattcgc taatacgactcactatagggctgcaggtagaacagacgca taatacgactcactataggggaaacaagatttggcgcagt taatacgactcactatagggcgcactatcgatctctgatctt tsr taatacgactcactataggggctccttcgatgctctcaag taatacgactcactatagggcaaattggcgatctcaacag taatacgactcactatagggtgtgaaagcgaaaaactacagg taatacgactcactataggggatctgccacagtctccaca Tm1 taatacgactcactataggggcagtcgggcaaaacagt taatacgactcactataggggatgacaggcccgaagatt taatacgactcactatagggcgacctcgtcctggagaa taatacgactcactatagggccaaaaatatagctgtgcgga scra taatacgactcactatagggaccctgccaaatacgacaaa taatacgactcactatagggaatgcaaatgcgagttgtga taatacgactcactatagggctcgagaaggcggaacag taatacgactcactatagggggcttgtccgtggttatgtt capt taatacgactcactatagggcaactgcagtacgtgacgct taatacgactcactataggggggaatgctttcgctgatg
26 cpb α-spec β-spec flr SCAR taatacgactcactatagggggcaagaccctgaagactgt taatacgactcactataggggagccaggacagcaatgttt taatacgactcactatagggcccagcagatcgagaagaac taatacgactcactatagggagtccccatcccggttatag taatacgactcactatagggaactggaaatcgaggcgaac taatacgactcactatagggctgtacctcgaccacatgga taatacgactcactatagggagacaagtaaacgaaccagcg taatacgactcactatagggcgagtcctcgagcttttcac taatacgactcactatagggctgcagctggagcagaactt taatacgactcactatagggcgttaatggccttgtcgaag taatacgactcactatagggttctgaaggcaacacattcg taatacgactcactataggggggatctacggtttccacag taatacgactcactatagggaggtgcacaccaaggagaagg taatacgactcactataggggccatctgggtctggataac taatacgactcactatagggcctttggacagtggagtcg taatacgactcactatagggacggtgatgggcttattgtg taatacgactcactatagggaagattcgcatttgggacac taatacgactcactataggggtgccggtttcagacataaag taatacgactcactatagggagtgtacgatacacgtccgc taatacgactcactataggggcatgcgactgatacattcc taatacgactcactatagggtacgatacacgtccgccac taatacgactcactatagggcatgcgactgatacattccg Supplementary Table 5 Primer sequences used to generate dsrna reagents for the Drosophila screen.
27 Supplementary References 1. Baum, B. & Cherbas, L. Drosophila cell lines as model systems and as an experimental tool. Methods Mol. Biol. 420, (2008). 2. Ramanathan, S. P. et al. Cdk1-dependent mitotic enrichment of cortical myosin II promotes cell rounding against confinement. Nat. Cell Biol. 17, (2015). 3. Herbig, M. et al. in Flow Cytometry Protocols (eds. Hawley, R. & Hawley, T.) (Humana Press, 2017). doi: / Mokbel, M. et al. Numerical Simulation of Real-Time Deformability Cytometry To Extract Cell Mechanical Properties. ACS Biomater. Sci. Eng. acsbiomaterials.6b00558 (2017). doi: /acsbiomaterials.6b Maddox, A. S. & Burridge, K. RhoA is required for cortical retraction and rigidity during mitotic cell rounding. J. Cell Biol. 160, (2003). 6. Matthews, H. K. et al. Changes in Ect2 localization couple actomyosin-dependent cell shape changes to mitotic progression. Dev. Cell 23, (2012). 7. Zanin, E. et al. A conserved RhoGAP limits M phase contractility and coordinates with microtubule asters to confine RhoA during Cytokinesis. Dev. Cell 26, (2013). 8. Kunda, P., Pelling, A. E., Liu, T. & Baum, B. Moesin controls cortical rigidity, cell rounding, and spindle morphogenesis during mitosis. Curr. Biol. 18, (2008). 9. Bovellan, M. et al. Cellular Control of Cortical Actin Nucleation. Curr. Biol. 24, (2014). 10. Chugh, P. et al. Actin cortex architecture regulates cell surface tension. Nat. Cell Biol. 19, (2017). 11. Toepfner, N. et al. Detection of human disease conditions by single-cell morphorheological phenotyping of blood. Elife 7, e29213 (2018). 12. d Onofrio, G. et al. Simultaneous Measurement of Reticulocyte and Red Blood Cell Indices in Healthy Subjects and Patients With Microcytic and Macrocytic Anemia. Blood 85, (1995). 13. Waugh, R. E. Reticulocyte rigidity and passage through endothelial-like pores. Blood 78, (1991). 14. Meier, E. R. et al. Increased Reticulocytosis during Infancy Is Associated with Increased Hospitalizations in Sickle Cell Anemia Patients during the First Three Years of Life. PLoS One 8, (2013). 15. Felker, G. M. et al. Red Cell Distribution Width as a Novel Prognostic Marker in Heart Failure: Data From the CHARM Program and the Duke Databank. J. Am. Coll. Cardiol. 50, (2007). 16. Sakaue-Sawano, A. et al. Visualizing Spatiotemporal Dynamics of Multicellular Cell-Cycle Progression. Cell 132, (2008).
Nature Methods: doi: /nmeth Supplementary Figure 1. Real-time deformability cytometry: contour detection and theoretical modeling.
Supplementary Figure 1 Real-time deformability cytometry: contour detection and theoretical modeling. (a) Image of cell deformed in constriction; contour (red) according to image analysis algorithm. Scale
More informationab Propidium Iodide Flow Cytometry Kit for Cell Cycle Analysis
ab139418 Propidium Iodide Flow Cytometry Kit for Cell Cycle Analysis Instructions for Use To determine cell cycle status in tissue culture cell lines by measuring DNA content using a flow cytometer. This
More informationab Propidium Iodide Flow Cytometry Kit for Cell Cycle Analysis
ab139418 Propidium Iodide Flow Cytometry Kit for Cell Cycle Analysis Instructions for Use To determine cell cycle status in tissue culture cell lines by measuring DNA content using a flow cytometer. This
More informationFlowcytometry Dirk Pacholsky
Flowcytometry Dirk Pacholsky Flowcytometry: Overview 1 2 Overview Flow Cyto Metry Fluid Cell Measurement measuring cell properties of cells in suspension Most Flow Cytometer have Spatially separated Lasers
More informationSPHERO TM Calibration Particles
SPHERO TM Calibration Particles SPHERO TM Calibration Particles are designed for routine calibration of flow cytometers. They are used extensively by many laboratories for QC and long term performance
More informationHigh-throughput automation with the Attune NxT Autosampler: consistent results across all wells and across plates
APPLICATION NOTE Attune NxT Flow Cytometer with Autosampler High-throughput automation with the Attune NxT Autosampler: consistent results across all wells and across plates Introduction The emerging field
More informationIdentification of red and white blood cells from whole blood samples using the Agilent 2100 bioanalyzer. Application Note
Identification of red and white blood cells from whole blood samples using the Agilent 2100 bioanalyzer Application Note Sylvie Veriac Valérie Perrone Madeleine Avon Abstract Agilent Equipment: 2100 bioanalyzer
More informationSupplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured
Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured in 90-Pa 3D fibrin gels for 5 days in the presence
More informationBest practices in panel design to optimize the isolation of cells of interest
Sort Best practices in panel design to optimize the isolation of cells of interest For Research Use Only. Not for use in diagnostic or therapeutic procedures. Alexa Fluor is a registered trademark of Life
More informationThe Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit
Cell Reports, Volume 5 Supplemental Information The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Andrey Poleshko, Katelyn M. Mansfield, Caroline
More informationinitial single-cell analysis, with a pragmatic focus on surface markers with the highest potential for
Supplementary Figure 1: Summary of the exclusionary approach to surface marker selection for initial single-cell analysis, with a pragmatic focus on surface markers with the highest potential for protein
More informationλ N -GFP: an RNA reporter system for live-cell imaging
λ N -GFP: an RNA reporter system for live-cell imaging Nathalie Daigle & Jan Ellenberg Supplementary Figures and Text: Supplementary Figure 1 localization in the cytoplasm. 4 λ N22-3 megfp-m9 serves as
More informationDOI: 10.1038/ncb3259 A Ismail et al. Supplementary Figure 1 B 60000 45000 SSC 30000 15000 Live cells 0 0 15000 30000 45000 60000 FSC- PARR 60000 45000 PARR Width 30000 FSC- 15000 Single cells 0 0 15000
More informationSupplementary Figure 1. Two activation pathways and four conformations of β 2 integrins. KIM127 (red) can specifically detect
Supplementary Figure 1 Two activation pathways and four conformations of β 2 integrins. KIM127 (red) can specifically detect integrin extension (E + ) and mab24 (green) can specifically detect headpiece-opening
More information11/19/2013. Janine Zankl FACS Core Facility 13. November Cellular Parameters. Cellular Parameters. Monocytes. Granulocytes.
DEPARTEMENT BIOZENTRUM Janine Zankl FACS Core Facility 13. November 2013 Cellular Parameters Granulocytes Monocytes Basophils Neutrophils Lymphocytes Eosinophils Cellular Parameters 1 What Is Flow Cytometry?
More informationDEPArray Technology. Sorting and Recovery of Rare Cells
DEPArray Technology Sorting and Recovery of Rare Cells Delivering pure, single, viable cells The DEPArray system from Silicon Biosystems is the only automated instrument that can identify, quantify, and
More informationSpherotech, Inc. 1. SPHERO TM Technical Note STN-8 Rev C
SPHERO TM Technical Note STN- Rev C. 0070 CALIBRATION AND PERFORMANCE TRACKING OF FLOW CYTOMETERS USING SPHERO TM CALIBRATION PARTICLES Introduction The SPHERO TM Calibration Particles are versatile, stable,
More informationPrinciples of flow cytometry: overview of flow cytometry and its uses for cell analysis and sorting. Shoreline Community College BIOL 288
Principles of flow cytometry: overview of flow cytometry and its uses for cell analysis and sorting Shoreline Community College BIOL 288 Flow Cytometry What is Flow Cytometry? Measurement of cells or particles
More informationApplication Information Bulletin: Set-Up of the CytoFLEX Set-Up of the CytoFLEX* for Extracellular Vesicle Measurement
Application Information Bulletin: Set-Up of the CytoFLEX Set-Up of the CytoFLEX* for Extracellular Vesicle Measurement Andreas Spittler, MD, Associate Professor for Pathophysiology, Medical University
More informationSupporting Information
Supporting Information Jones et al. 10.1073/pnas.0808843106 SI Text Additional Data. Additional detailed supplemental data is available at www.cellprofiler.org/pnas2009.html. Features List shows the cytological
More informationFile name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: Supplementary Figure 1. dcas9-mq1 fusion protein induces de novo
More informationMultiplex Fluorescence Assays for Adherence Cells without Trypsinization
Multiplex Fluorescence Assays for Adherence Cells without Trypsinization The combination of a bright field and three fluorescent channels allows the Celigo to perform many multiplexed assays. A gating
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Rodríguez-Fraticelli et al., http://www.jcb.org/cgi/content/full/jcb.201203075/dc1 Figure S1. Cell spreading and lumen formation in confined
More informationDefinitions. What functions does a flow cytometer be able to do? The build of the Flow cytometry and sorting. Flow cytometry
The build of the Flow cytometry and sorting Flow cytometry Seminar Mónika Tóth 11-12-13.04.2011 Definitions Flow cytometry Process or measurement method can measure discrete properties physical, chemical,
More informationSupplemental Table 1 Primers used in study. Human. Mouse
Supplemental Table 1 Primers used in study Human Forward primer region(5-3 ) Reverse primer region(5-3 ) RT-PCR GAPDH gagtcaacggatttggtcgt ttgattttggagggatctcg Raftlin atgggttgcggattgaacaagttaga ctgaggtataacaccaacgaatttcaggc
More informationCellometer Vision CBA
Features of the Vision CBA Image Cytometry System All-in-One System Basic cell counting, primary cell viability, and cellbased assays. See for Yourself Why the Top Ten Pharmaceutical Companies Trust Cellometer
More informationSupplementary Figure 1. Serial deletion mutants of BLITz.
Supplementary Figure 1 Serial deletion mutants of BLITz. (a) Design of TEVseq insertion into J -helix. C-terminal end of J -helix was serially deleted and replaced by TEVseq. TEV cleavage site is labeled
More informationNo wash 2 Washes 2 Days ** ** IgG-bead phagocytosis (%)
Supplementary Figures Supplementary Figure 1. No wash 2 Washes 2 Days Tat Control ** ** 2 4 6 8 IgG-bead phagocytosis (%) Supplementary Figure 1. Reversibility of phagocytosis inhibition by Tat. Human
More informationSupplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.
Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying
More informationApplication Microfluidic Cell Analysis Devices (I) Date: 2013/05/24. Dr. Yi-Chung Tung
Application Microfluidic Cell Analysis Devices (I) Date: 2013/05/24 Dr. Yi-Chung Tung Mechanotransduction and the Study of Cellular Forces Mechanical forces play a critical role in nearly all aspects of
More informationChallenges for Flow Cytometry in Regulated Bioanalysis
Challenges for Flow Cytometry in Regulated Bioanalysis Minesh Patel Merck Millipore Discovery & Development Solutions. Oxford, UK. Overview Flow cytometry principles Current uses and regulatory environments
More informationdetermine optimum instrument settings for their own instruments and establish their own daily values.
PC7 (770/488) SETUP KIT 6607121 PN 4299504-C FLOW CYTOMETER ALIGNMENT VERIFICATION FLUOROSPHERES FLOW CYTOMETER DETECTOR STANDARDIZATION FLUOROSPHERES INTENDED USE For Research Use Only. Not for use in
More informationFlow Cytometry - The Essentials
Flow Cytometry - The Essentials Pocket Guide to Flow Cytometry: 1. Know your Cytometer 2. Understanding Fluorescence and Fluorophores 3. Gating Process 4. Controls 5. Optimization 6. Panel Building 7.
More informationEach question may have MULTIPLE correct answers. Select all that are correct.
Knowledge Assessment Flow Cytometry Workshop, Part 1 April 20, 2015 Each question may have MULTIPLE correct answers. Select all that are correct. 1. Tandem dyes are a. highly stable fluorophores after
More informationBASICS OF FLOW CYTOMETRY
BASICS OF FLOW CYTOMETRY AUTHOR: Ana Isabel Vieira APPROVAL: Henrique Veiga Fernandes Ana Sílvia Gonçalves SOP.UCF.002 03-09-2015 Pag. 1/9 Overview Flow: Fluid Cyto: Cell Metry: Measurement Flow cytometry
More informationNature Immunology: doi: /ni.3694
Supplementary Figure 1 Expression of Bhlhe41 and Bhlhe40 in B cell development and mature B cell subsets. (a) Scatter plot showing differential expression of genes between splenic B-1a cells and follicular
More informationWVU FLOW CYTOMETRY & SINGLE CELL CORE FACILITY
WVU FLOW CYTOMETRY & SINGLE CELL CORE FACILITY Newsletter Volume 4, issue 2 January 2018 Helpful Hints for Proper Gating of Flow Cytometry Data Inside this Issue 1-2 Helpful Hints for Proper Gating of
More informationTHE JOURNAL OF CELL BIOLOGY
Supplemental Material THE JOURNAL OF CELL BIOLOGY Toso et al., http://www.jcb.org/cgi/content/full/jcb.200809055/dc1 Figure S1. Control experiments for sirna depletions used in Figs. 1 3. The phenotype
More informationActin cap associated focal adhesions and their distinct role in cellular mechanosensing
Actin cap associated focal adhesions and their distinct role in cellular mechanosensing Dong-Hwee Kim 1,2, Shyam B. Khatau 1,2, Yunfeng Feng 1,3, Sam Walcott 1,4, Sean X. Sun 1,2,4, Gregory D. Longmore
More informationUsing Fluorescence Spillover to Advantage
Using Fluorescence Spillover to Advantage Boston June 9, 2011 Compensation: Why and When is it Necessary? Clare Rogers, Marketing and Applications Accuri Cytometers, Inc. Ann Arbor/St.Ives 1 June 11 Summary
More informationseminar
seminar 02.26.-28.2013. Flow cytometry Process or measurement method can measure discrete properties physical, chemical, biochemical, biological parameters of separate particles, e.g. biological cells
More informationAoki et al.,
JCB: SUPPLEMENTAL MATERIAL Aoki et al., http://www.jcb.org/cgi/content/full/jcb.200609017/dc1 Supplemental materials and methods Calculation of the raw number of translocated proteins First, the average
More informationIncorporating New, Bright Fluorochromes into Multicolor Panel Design
Incorporating New, Bright Fluorochromes into Multicolor Panel Design Maria C. Jaimes, MD Senior Staff Scientist BD Biosciences 23-14684-00 Overview Multicolor flow: successful application prerequisites
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Rainero et al., http://www.jcb.org/cgi/content/full/jcb.201109112/dc1 Figure S1. The expression of DGK- is reduced upon transfection
More informationWVU FLOW CYTOMETRY & SINGLE CELL CORE FACILITY
WVU FLOW CYTOMETRY & SINGLE CELL CORE FACILITY Newsletter Volume 5, issue 1 July 2018 Finding and Validating Antibodies Part 1 Inside this Issue 1-2 Finding and Validating Antibodies Part 1 3 4 Flow Cytometers
More informationsupplementary information
DOI: 10.1038/ncb2156 Figure S1 Depletion of p114rhogef with different sirnas. Caco-2 (a) and HCE (b) cells were transfected with individual sirnas, pools of the two sirnas or the On Target (OnT) sirna
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2271 Supplementary Figure a! WM266.4 mock WM266.4 #7 sirna WM266.4 #10 sirna SKMEL28 mock SKMEL28 #7 sirna SKMEL28 #10 sirna WM1361 mock WM1361 #7 sirna WM1361 #10 sirna 9 WM266. WM136
More informationAPPLICATION SPECIFIC PROTOCOL CELL MIGRATION FOR ADHERENT CELLS
APPLICATION SPECIFIC PROTOCOL CELL MIGRATION FOR ADHERENT CELLS AIM 3D Cell Culture Chips are very useful for the study of 3D cell invasion and migration. The chips are not only suitable for endpoint measurement;
More informationINTRODUCTION TO FLOW CYTOMETRY
DEPARTEMENT BIOZENTRUM INTRODUCTION TO FLOW CYTOMETRY F ACS C ore F acility Janine Zankl FACS Core Facility 3. Dezember 2015, 4pm Cellular Parameters Granulocytes Monocytes Basophils Lymphocytes Neutrophils
More informationA previous ICCS Module entitled Instrument optimization - Adjusting PMT voltages and compensation 1 should be read as a prerequisite to this module.
Sponsored and reviewed by ICCS Quality and Standards Committee Title: Compensation Tips for Beckman Coulter 10-Color Navios Platform Written by: Salima Janmohamed-Anastasakis Ph.D., Applications Scientist,
More informationJ. Cell Sci. 128: doi: /jcs : Supplementary Material. Supplemental Figures. Journal of Cell Science Supplementary Material
Supplemental Figures Figure S1. Trio controls endothelial barrier function. (A) TagRFP-shTrio constructs were expressed in ECs. Western blot shows efficient Trio knockdown in TagRFP-expressing ECs. (B)
More informationigem 2018 InterLab Study Protocol Before You Begin
igem 2018 InterLab Study Protocol Before You Begin Read through this entire protocol sheet carefully before you start your experiment and prepare any materials you may need. In order to improve reproducibility,
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationSupplementary Data Supplementary Figure 1. Knockdown of VentX with a different sirna sequence reduces terminal monocyte to macrophage
Supplementary Data Supplementary Figure 1. Knockdown of VentX with a different sirna sequence reduces terminal monocyte to macrophage differentiation. Monocytes were transfected with either a scrambled
More informationSupplementary Figure 1. RAD51 and RAD51 paralogs are enriched spontaneously onto
Supplementary Figure legends Supplementary Figure 1. and paralogs are enriched spontaneously onto the S-phase chromatin during DN replication. () Chromatin fractionation was carried out as described in
More informationCompensation: Fundamental Principles
Flow Cytometry Seminar Series 2017 : Fundamental Principles Spillover correction in multicolor flow cytometry 28.02.2017 http://www.cytometry.uzh.ch Contents Fluorescence and its detection Absorption and
More informationSupplementary Information to: Genome-wide Real-time in vivo Transcriptional Dynamics During Plasmodium falciparum. Blood-stage Development
Supplementary Information to: Genome-wide Real-time in vivo Transcriptional Dynamics During Plasmodium falciparum Blood-stage Development Painter et al. 1 of 8 Supplementary Figure 1: Supplementary Figure
More informationPost-expansion antibody delivery, after epitope-preserving homogenization.
Supplementary Figure 1 Post-expansion antibody delivery, after epitope-preserving homogenization. (a, b) Wide-field fluorescence images of Thy1-YFP-expressing mouse brain hemisphere slice before expansion
More informationPrinciples of Immunophenotyping
Principles of Immunophenotyping % of Cell types? Immune activation? Changes based on health state? Moving from a heterogeneous population of blood cells to identifying the presence and proportion of different
More informationSupplementary Protocol. sirna transfection methodology and performance
Supplementary Protocol sirna transfection methodology and performance sirna oligonucleotides, DNA construct and cell line. Chemically synthesized 21 nt RNA duplexes were obtained from Ambion Europe, Ltd.
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationSupplementary Figure 1. Espn-1 knockout characterization. (a) The predicted recombinant Espn-1 -/- allele was detected by PCR of the left (5 )
Supplementary Figure 1. Espn-1 knockout characterization. (a) The predicted recombinant Espn-1 -/- allele was detected by PCR of the left (5 ) homologous recombination arm (left) and of the right (3 )
More informationAssay Name: HPC proliferation measurement using Ki-67 cellular marker
Assay Name: HPC proliferation measurement using Ki-67 cellular marker Assay ID: Celigo_02_0014 Table of Contents Experiment: HPC proliferation measurement using Ki-67 cellular marker... 2 Celigo Setup...2
More informationMultiplexed 3D FRET imaging in deep tissue of live embryos Ming Zhao, Xiaoyang Wan, Yu Li, Weibin Zhou and Leilei Peng
Scientific Reports Multiplexed 3D FRET imaging in deep tissue of live embryos Ming Zhao, Xiaoyang Wan, Yu Li, Weibin Zhou and Leilei Peng 1 Supplementary figures and notes Supplementary Figure S1 Volumetric
More informationSupplementary Table-1: List of genes that were identically matched between the ST2 and
Supplementary data Supplementary Table-1: List of genes that were identically matched between the ST2 and ST3. Supplementary Table-2: List of genes that were differentially expressed in GD2 + cells compared
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for Integrative Biology. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information Table S1. Definition of quantitative cellular features
More informationi-stop codon positions in the mcherry gene
Supplementary Figure 1 i-stop codon positions in the mcherry gene The grnas (green) that can potentially generate stop codons from Trp (63 th and 98 th aa, upper panel) and Gln (47 th and 114 th aa, bottom
More informationsupplementary information
DOI: 10.1038/ncb2015 Figure S1 Confirmation of Sca-1 CD34 stain specificity using isotypematched control antibodies. Skeletal muscle preparations were stained and gated as described in the text (Hoechst
More informationSupplementary Material
Supplementary Material Supplementary Methods Cell synchronization. For synchronized cell growth, thymidine was added to 30% confluent U2OS cells to a final concentration of 2.5mM. Cells were incubated
More informationSupplementary Information. A superfolding Spinach2 reveals the dynamic nature of. trinucleotide repeat RNA
Supplementary Information A superfolding Spinach2 reveals the dynamic nature of trinucleotide repeat RNA Rita L. Strack 1, Matthew D. Disney 2 & Samie R. Jaffrey 1 1 Department of Pharmacology, Weill Medical
More informationFlow Cytometry SOP: 14 color flow for immune activation, senescence, and exhaustion
Flow Cytometry SOP: 14 color flow for immune activation, senescence, and exhaustion Purpose This SOP standardizes the procedure for measuring immune cells using flow cytometry in ACTG Immunology Laboratories.
More informationQuantum Dot applications in Fluorescence Imaging for Calibration and Molecular Imaging
Quantum Dot applications in Fluorescence Imaging for Calibration and Molecular Imaging Introduction In this application note, we will discuss the application of quantum dots in fluorescence imaging, both
More informationSUPPLEMENTARY INFORMATION
ARTICLE NUMBER: 0 DOI: 0.0/NMICROBIOL.0. The host protein CLUH participates in the subnuclear transport of influenza virus ribonucleoprotein complexes Tomomi Ando,, Seiya Yamayoshi, Yuriko Tomita,, Shinji
More informationPhagocytosis Assay Kit (IgG PE)
Phagocytosis Assay Kit (IgG PE) Item No. 600540 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS GENERAL INFORMATION
More informationSchool of Chemical and Life Sciences, Nanyang Polytechnic, Singapore *Corresponding author
0 Differential Effect of Solar Light in Increasing the Toxicity of Silver and Titanium Dioxide Nanoparticles to a Fish Cell Line and Zebrafish Embryos Saji George # *, Hannah Gardner, Seng Eng Khuan, Hengky
More informationSPHERO TM Fluorescent Particles
The SPHERO TM fluorescent microparticles are prepared by either staining polystyrene particles with a fluorophore solution or by polymerizing a fluorophore in styrene in the presence of polystyrene core
More informationCell Cycle Phase Determination Kit
Cell Cycle Phase Determination Kit Catalog Number KA1301 100 assays Version: 04 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 General
More informationBasic Principles in Flow Cytometry. Flow Cytometry
Basic Principles in Flow Cytometry Flow Cytometry» Flow Cytometry is the technological process that allows for the individual measurements of cell fluorescence and light scattering. This process is performed
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION WWW.NATURE.COM/NATURECELLBIOLOGY 1 SUPPLEMENTARY INFORMATION 2 WWW.NATURE.COM/NATURECELLBIOLOGY SUPPLEMENTARY INFORMATION WWW.NATURE.COM/NATURECELLBIOLOGY 3 SUPPLEMENTARY INFORMATION
More informationCELL CYCLE BASICS. G0/1 = 1X S Phase G2/M = 2X DYE FLUORESCENCE
CELL CYCLE BASICS Analysis of a population of cells replication state can be achieved by fluorescence labeling of the nuclei of cells in suspension and then analyzing the fluorescence properties of each
More informationUnderstanding Flow Cytometry
Understanding Flow Cytometry The Basic Concepts Maree Bagnara Products Sales Specialist/Account Manager Flow Cytometry PN775136 1 Successful Flow Cytometry data is driven by.. Understanding the Biology
More informationBoundary-breaking acoustic focusing cytometry
Boundary-breaking acoustic focusing cytometry Introducing the Attune NxT Acoustic Focusing Cytometer a high-performance system that s flexible enough for any lab One of the main projects in my laboratory
More informationAGGGCTCACTCCAGCCTCCAG AGGGGAGGGATGAAGTGATGGG TGCTGGAGCCCGAGTGGGAA TGCCGCACGAAGCTAGCCAT ATCCAGGGAGCAGCGAGCCAA CCGCCTTGTCATGGGTGTGCT
Electronic Supplementary Material (ESI) for Lab on a Chip. This journal is The Royal Society of Chemistry 2015 Sarvesh Varma, Joel Voldman* Supplemental Information PCR Primers The following table lists
More informationQuantifying biological forces involved in the process of cell-mediated cytolysis
Quantifying biological forces involved in the process of cell-mediated cytolysis Experimentation based on responses of living cells (Cell-based assays) represents an important stratum in biological and
More informationOrflo Application Brief 3 /2017 GFP Transfection Efficiency Monitoring with Orflo s Moxi GO Next Generation Flow Cytometer. Introduction/Background
Introduction/Background Cell transfection and transduction refer to an array of techniques used to introduce foreign genetic material, or cloning vectors, into cell genomes. The application of these methods
More informationBefore You Begin. Calibration Protocols
Before You Begin Read through this entire protocol sheet carefully before you start your experiment and prepare any materials you may need. Calibration Protocols 1. OD 600 Reference point You will use
More informationDURACLONE IM ACCELERATE YOUR PACE IN IMMUNE SYSTEM RESEARCH. For Reseach Use Only - Not for use in Diagnostic procedures
DURACLONE IM ACCELERATE YOUR PACE IN IMMUNE SYSTEM RESEARCH Your clinical research trial companion For Reseach Use Only - Not for use in Diagnostic procedures ACCELERATE YOUR PACE IN IMMUNE SYSTEM RESEARCH
More informationSUPPLEMENTARY INFORMATION FILE
SUPPLEMENTARY INFORMATION FILE Existence of a microrna pathway in anucleate platelets Patricia Landry, Isabelle Plante, Dominique L. Ouellet, Marjorie P. Perron, Guy Rousseau & Patrick Provost 1. SUPPLEMENTARY
More informationImmunophenotyping of Peripheral Blood and Bone Marrow Cells by Flow Cytometry *Akanni EO and # Palini A.
Immunophenotyping of Peripheral Blood and Bone Marrow Cells by Flow Cytometry *Akanni EO and # Palini A. * Department of Haematology & Blood Transfusion,College of Health Science, Ladoke Akintola University
More informationRaftNote. Imaging and Sorting Living Cells Stained with Vital Dyes on Cell Microsystems CytoSort Array and Automated CellRaft AIR System
RaftNote Applications and protocols for use with CellRaft Technology Imaging and Sorting Living Cells Stained with Vital Dyes on Cell Microsystems CytoSort Array and Automated CellRaft AIR System Jacquelyn
More informationTable S1. Nucleotide sequences of synthesized oligonucleotides for quantitative
Table S1. Nucleotide sequences of synthesized oligonucleotides for quantitative RT-PCR For CD8-1 transcript, forward primer CD8-1F 5 -TAGTAACCAGAGGCCGCAAGA-3 reverse primer CD8-1R 5 -TCTACTAAGGTGTCCCATAGCATGAT-3
More informationFigure S1, related to Figure 1. Characterization of biosensor behavior in vivo.
Developmental Cell, Volume 23 Supplemental Information Separase Biosensor Reveals that Cohesin Cleavage Timing Depends on Phosphatase PP2A Cdc55 Regulation Gilad Yaakov, Kurt Thorn, and David O. Morgan
More informationSupplementary Materials for
www.advances.sciencemag.org/cgi/content/full/1/7/e1500454/dc1 Supplementary Materials for CRISPR-Cas9 delivery to hard-to-transfect cells via membrane deformation Xin Han, Zongbin Liu, Myeong chan Jo,
More informationThermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles
Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles Long-term gene silencing shrna-specific design algorithm High titer, purified particles Thermo Scientific Dharmacon SMARTvector shrna
More informationSupplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days,
Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days, respectively, and their mrnas were quantified by real time
More informationSupplementary Figure 1 Pfn1, but not other Pfn isoforms are expressed in
Supplementary Figure 1 Pfn1, but not other Pfn isoforms are expressed in platelets. (a) RT-PCR of Pfn isoforms in control mouse platelets, Pfn1 -/- platelets and control heart. Expected band size for Pfn1
More informationSUPPLEMENTARY INFORMATION
Supplementary Figure 1. Mechanism for signal-induced opening of the DNA box. a, An atomic model of the DNA box held closed by locks (orange and blue) that are double helices formed by two short strands
More informationApplication Note. Assay Portability on the BD FACSVerse System. Summary. Maria Jaimes, Yibing Wang, Catherine McIntyre, and Dev Mittar
September Assay Portability on the BD FACSVerse System Maria Jaimes, Yibing Wang, Catherine McIntyre, and Dev Mittar Contents Summary Introduction 3 Objective 4 Methods 6 Results Discussion Conclusions
More information