ATL1-GFP Marker-mCherry/RFP Merge B C D
|
|
|
- Nathaniel Harris
- 5 years ago
- Views:
Transcription
1 Input IP:α-H EDR1-H stedr1-h EV EDR1-H stedr1-h EV α-h α-mcherry TL1-GFP Marker-mCherry/RFP Merge C D GmMan49-mCherry mcherry-syp21 VH-a1-RFP E F G H I J EDR1-nYFP+TL1-cYFP ra6-mcherry Merge K L M Supplemental Figure 1. TL1 Co-Immunoprecipitates with EDR1 and Localizes to Endomembrane Structures. () Co-immunoprecipitation of TL1 with EDR1. was transiently co-expressed with wild-type EDR1-H, the substrate trap form of EDR1-H or empty vector in rabidopsis protoplasts. Proteins were immunoprecipitated with anti-h affinity matrix (IP). portion of each sample was taken prior to immunoprecipitation as the input control. Immunoblotting with the indicated antibodies was used to detect the epitope-tagged proteins. () to (D) TL1-eGFP partially co-localizes with the TGN/EE marker VH-a1-RFP (arrows). (E) to (G) The majority of TL1-eGFP co-localizes with the multivesicular body/late endosome (MV/LE) marker mcherry-syp21. (H) to (J) TL1-GFP localization is distinct from that of cis-golgi cisternae marker GmManI49-mCherry. (K) to (M) EDR1 and TL1 ifc signal (green) does not overlap with the MV/LE marker R6-mCherry (magenta). ll images were obtained from transiently transformed epidermal cells of N. benthamiana. Scale bars = 1 μm. 1
2 No DEX +DEX C 5 +EDR1-Myc+No DEX +stedr1-myc+dex +EDR1-Myc+DEX Empty vector Conductivity (µs/cm) EDR1-Myc +EDR1-Myc +stedr1-myc D kd EDR1-sYFP + stedr1-syfp FL-EDR1 kd E + EDR1-sYFP + stedr1-syfp + Empty Vector Empty Vector h 12 h 24 h 36 h 48 h Hours 5 27 free mcherry α-syfp α-mcherry F G RPS5(D266E)-Myc+EDR1-Myc RPS5(D266E)-Myc+Empty vector +ti-1-myc +Empty vector Conductivity (μs/cm) H RPS5(D266E) RPS5(D266E)+EDR1 RPS5(D266E)+Empty Vector I Conductivity (μs/cm) TL1 TL1+tI TL1+Empty vector Hours Hours Supplemental Figure 2. EDR1 Specifically ntagonizes TL1-induced Cell Death in N. benthamiana. () to (C) -induced cell death in N. benthamiana is suppressed by co-expression with EDR1-Myc, but not with the substrate trap mutant version, stedr1-myc, or when EDR1 expression is not induced. (D) and (E) Immunoblots of total protein extracts from leaves co-infiltrated with and EDR1-sYFP or stedr1-syfp. (F) EDR1-Myc does not suppress the cell death induced by an auto-active RPS5 mutant (D266E). (G) ti-1-myc does not suppress the cell death induced by. (H) and (I) Ion leakage measurements for RPS5(D266) and TL1-induced cell death. The and ti-myc constructs were expressed under control of a 35S promoter, while the RPS5(D266E)-Myc and EDR1-Myc constructs were under control of a dexamethasone inducible promoter. Dexamethasone was applied 16 h after infiltration and photographs were taken 48 h after infiltration. Error bars indicate standard deviation, n=3. Experiments were repeated twice with similar results. 2
3 35S:/edr1 C 35S:TL1 C153/H155 -mcherry/edr1 Line2 Line3 Supplemental Figure 3. TL1 Causes Severe Dwarfing When Overexpressed in the Grabidopsis edr1 mutant.. () and () Four-week old plants from two independent 35S:TL1- mcherry lines in an edr1 mutant background. (C) Mutation of the TL1 RING domain blocks TL1-induced dwarfing. Image shows a four-week old transgenic plant expressing 35S:TL1 C153/H155 -mcherry in an edr1 mutant background. Scale bars = 1 cm. 3
4 C TL1-GFP TL16-mCherry Merge D E Conductivity (μs/cm) 3 1 TL16-mChery TL16-mCherry Hours Supplemental Figure 4. TL16 Does Not Induce Cell Death When Overexpressed in N. benthamiana. () to (C) Transient co-expression of TL1-GFP and TL16-mCherry in N. benthamiana. Images were obtained from transiently transformed epidermal cells of N. benthamiana. Scale bars = 1 μm. (D) and (E), but not TL16-mCherry induces cell death upon transient overexpression in N. benthamiana. Genes were expressed using a 35S promoter and leaf photographed 48 hrs after infiltration. Panel E shows electrolyte leakage data. Error bars indicate standard deviation, n=3. This experiment was repeated twice with similar results. 4
5 TL1 C153/H155 - mcherry N Mean Std.Dev t statistic TL1 C153/H155 -mcherry p=.643 TL1 C153/H155 - mcherry N Mean Std.Dev t statistic TL1 C153/H155 -mcherry p=.619 Supplemental Figure 5. Comparison of and TL1 C153/H155 -mcherry Expression Levels Using Fluorescence Quantification. () Single section images of root cells from 35S: line 1 and 35S:TL1 C153/H155 -mcherry line 1 in a Col- wild-type background. Fluorescence quantification was performed using ImageJ software. Eight seedlings from each line were randomly sampled and florescence of each sample was determined by the mean fluorescence of two different areas within the sample. () Single section images of N. benthamiana epidermal cells expressing 35S: and 35S:TL1 C153/H155 -mcherry constructs. Twenty cells expressing each construct were sampled and florescence of each cell was determined by the mean fluorescence of two different areas within the sample. Scale bars = 1 μm. 5
6 C TL1 WT -mcherry TL1 S312 -mcherry TL1 S312D -mcherry D E F TL1 R38 -mcherry TL1 R38/S312 -mcherry TL1 R38/S312D -mcherry G TL1 TL1 R38 TL1 R38/S312 TL1 R38/S312D TL1 S312 TL1 S312D α-mcherry C Supplemental Figure 6. Mutations in the TL1 RxxxS Motif Do Not lter TL1 Localization. () to (F) TL1 and mutated derivatives tagged with mcherry transiently expressed in N. benthamiana. Scale bars = 1 μm. (G) Immunoblot of total protein extracts from leaves transiently expresssing 35S- WT or RxxxS mutants. Protein was isolated 4 h after infiltration of grobacterium. 6
7 EDR1-D stedr1-d TL1-D TL1 38 -D TL1 S312 -D TL1 S312D -D D TL1-D TL1 38 -D TL1 S312 -D TL1 S312D -D D -Leu-Trp -Leu-Trp-His C D EDR1-nYFP+TL1-cYFP EDR1-nYFP+TL1 R38 -cyfp EDR1-nYFP+TL1 S312 -cyfp Supplemental Figure 7. Mutations in the RxxxS Motif of TL1 Do Not lter Its Interaction With EDR1. () EDR1 and TL1 RxxxS mutants interact in a yeast two-hybrid assay. Yeast strains expressing the indicated constructs were plated on double drop out (-Leu-Trp) media to select for the bait and prey plasmids and triple drop out (-Leu-Trp-His) media to select for interaction between the indicated proteins. Empty vectors containing the activating- or the binding-domain were used as negative controls for interaction. () to (D) EDR1 and TL1 RxxxS mutants interact in a ifc assay. EDR1-nYFP and TL1-cYFP were transiently co-expressed in N. benthamiana. Scale bars = 1 μm. 7
8 TL1 TL16 Relative RN level/ubiquitin Col- Col- amirn1 #2-2 Col- amirn1 #3-1 edr1 edr1 amirn1 #31-4 edr1 amirn1 #3-2 Relative RN level/ubiquitin Col- Col- amirn1 #2-2 Col- amirn1 #3-1 edr1 amirn1 #1-4 edr1 amirn1 #3-2 Supplemental Figure 8. TL1 amirni Lines Have Reduced Levels of TL1 mrn. Total RN was isolated from rabidopsis wild-type Col-, edr1 mutant, and two transgenic lines in each background expressing a 35S-TL1-amiRNi construct. qrt-pcr was performed to quantify () TL1 or () TL16 mrn levels. Values were normalized relative to UIQUITIN1 and are graphed relative to wild-type Col-. Error bars indicate standard deviation of three biological replicates. 8
9 Supplemental Table 1. List of Primers Used in This Study TL1attb1 GGGGCGTTTGTCGCGGCTTCTGGTCTCGC TL1attb4 GGGGCCTTTGTTGGTTGGGTGGGGTTCCTC TL1attb2 GGGGCCCTTTGTCGGCTGGGTTTGGGTTCCT EDR1attb1 GGGGCGTTTGTCGCGCTGCTGGCTTTTTCG EDR1attb4 GGGGCCTTTGTTGGTTGGGTGTTGTGGTGTGGGTC RI- 1attb1 GGGGCGTTTGTCGCGGCTCGTGGCTTT TTCGC RI- 1attb4 GGGGCCTTTGTTGGTTGGGTGTTTTTCCTTC GGC ti- 1attb1 GGGGCGTTTGTCGCGGCTTGGTGCGTTCTCTTCC ti- 1attb4 GGGGCCTTTGTTGGTTGGGTGGTTCTCCTTTCTTCTT mcherryattb4r GGGGCCTTTTCTTCGTTGCTTGGTGGCGGGCGG mcherryattb2 GGGGCCTTTGTTCGTTGCTCTTGTCGCTCGTCC nyfpattb4r GGCCTTTTCTTCGTTGGTTGGGTGGGGC nyfpattb2 GGCCCTTTGTCGGCTGGGTTTGTCCTCGTGTTGTGGCGGTC cyfpattb4r GGCCTTTTCTTCGTTGGGGCGGCGTGCGCTCGCCGCC cyfpattb2 GGCCCTTTGTCGGCTGGGTTTTTTGTTGTTCTCCTGCC FwdTL1- NdeI CGCGCTTGTGGTCTCGCCGT RevTL1- XhoI CGCGCTCGGTTGGGTTCCTC FwdEDR1- XmaI CCCGGGGTGGCTTTTTCGGCT RevEDR1- SmaI GGTCGCCTTTGTGGTGTGGGTC TL1R38- F GTTCGCCCTGCGGTCGTCTCGTGGTTCTCGTGG TL1R38- R CCCTGTGTCCTCGGTCGTCTCGCTTGGGCTGTTTC TL1R38/S312GTTCGCCCTGCGGTCGTCGCGTGGTTCTCGTG TL1R38/S312CCTGTGTCCTCGCGTCGTCTCGCTTGGGCTGTTTC TL1R38/S312DGTTCGCCCTGCGGTCGTCGCTGGTTCTCGTGG TL1R38/S312CCCTGTGTCCTGTCGTCGTCTCGCTTGGGCTGTTTC TL1S312- F GTTCGCCCTGGTCGTCGCGTGGTTCTCGTGG TL1S312- R CCCTGTGTCCTCGCGTCGTCTTCTTTGGGCTGTTTC TL1S312D- F GTTCGCCCTGGTCGTCGCTGGTTCTCGTGG TL1S312D- R CCCTGTGTCCTGTCGTCGTCTTCTTTGGGCTGTTTC amirn1- attb1 GGGGCGTTTGTCGCGGCTCGCTGCGGCGTTGTTGGGTC amirn1- attb4 GGGGCCCTTTGTCGGCTGGGTGCGGTCTTTCCCGGG TL1- amirn1i GTTCTTGGCTCCGTCTCTCTTTTGTTTCC TL1- amirn1ii GCGGGCTTTTCTTTGTTTCGGTCTG TL1- amirn1iii GCGGCTTTTCTTTGTTTTCCGGTCGTGTTG TL1- amirn1iv GTCTTTGGCTTCGTCTCTTTTTCCT Ubq1fw GTCCGGCGGGGTTTC Ubq1rv CGCGGCCGTGGGTG TL1RTF CCGCCCTTTTCCCCG TL1RTR GTGCGCGTGGCTG TL16RTF CGTTCTCGTTTCTCGGG TL16RTR GCCGTCGTTTTGGTCGTT
Figure S1. Immunoblotting showing proper expression of tagged R and AVR proteins in N. benthamiana.
SUPPLEMENTARY FIGURES Figure S1. Immunoblotting showing proper expression of tagged R and AVR proteins in N. benthamiana. YFP:, :CFP, HA: and (A) and HA, CFP and YFPtagged and AVR1-CO39 (B) were expressed
Supplementary Figures 1-12
Supplementary Figures 1-12 Supplementary Figure 1. The specificity of anti-abi1 antibody. Total Proteins extracted from the wild type seedlings or abi1-3 null mutant seedlings were used for immunoblotting
Supplemental Data. Aung et al. (2011). Plant Cell /tpc
35S pro:pmd1-yfp 10 µm Supplemental Figure 1. -terminal YFP fusion of PMD1 (PMD1-YFP, in green) is localized to the cytosol. grobacterium cells harboring 35S pro :PMD1-YFP were infiltrated into tobacco
Supplemental Data. Sethi et al. (2014). Plant Cell /tpc
Supplemental Data Supplemental Figure 1. MYC2 Binds to the E-box but not the E1-box of the MPK6 Promoter. (A) E1-box and E-box (wild type) containing MPK6 promoter fragment. The region shown in red denotes
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/5/244/ra72/dc1 Supplementary Materials for An Interaction Between BZR1 and DELLAs Mediates Direct Signaling Crosstalk Between Brassinosteroids and Gibberellins
Supplemental Figure 1. Alignment of the NbGAPC amino acid sequences with their Arabidopsis homologues.
Supplemental Figure 1. Alignment of the NbGAPC amino acid sequences with their Arabidopsis homologues. Homologs from N. benthamiana (NbGAPC1, NbGAPC2, NbGAPC3), Arabidopsis (AtGAPC1, AT3G04120; AtGAPC2,
Supplemental Data. Cui et al. (2012). Plant Cell /tpc a b c d. Stem UBC32 ACTIN
A Root Stem Leaf Flower Silique Senescence leaf B a b c d UBC32 ACTIN C * Supplemental Figure 1. Expression Pattern and Protein Sequence of UBC32 Homologues in Yeast, Human, and Arabidopsis. (A) Expression
Supplemental Figure 1. Immunoblot analysis of wild-type and mutant forms of JAZ3
Supplemental Data. Chung and Howe (2009). A Critical Role for the TIFY Motif in Repression of Jasmonate Signaling by a Stabilized Splice Variant of the JASMONATE ZIM-domain protein JAZ10 in Arabidopsis.
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc..4. A B Supplemental Figure. Immunoblot analysis verifies the expression of the AD-PP2C and BD-RGLG proteins in the Y2H assay. Total proteins were extracted
Supplemental Data. Zhang et al. (2013). Plant Cell /tpc
SDLTXgal SDLTH SDLTHA ADSV4 BD BDP53 BD BDP53 BD BDP53 ADAt1g1567(aa36358) ADAt1g844(aa9354) ADAt1g844(aa51354) ADAt1g844(full) Prey ADAt1g844(aa11354) ADAt3g5994(aa48418) BD BDPAL2 BD BDPAL2 BD BDPAL2
AD-FIL AD-YAB2 -2 BD-JAZ3 AD-YAB3 AD-YAB5 AD-FIL -4 3AT BD-JAZ3 AD-YAB3
3 4 9 10 11 12 AD-FIL AD-YAB5 2 B AD-YAB3 1 BD-JAZ 5 6 7 8 AD-FIL A AD-YAB2 Supplemental Data. Boter et al. (2015). Plant Cell 10.1105/tpc.15.00220 BD AD-YAB2-2 -2 BD-JAZ3 AD-YAB3 BD AD-YAB5-4 AD-FIL -4
PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF
YFP-PHF1 CFP-PHT1;2 PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF + CFP-PHT1;2 Negative control!-gfp Supplemental Figure 1: PHT1;2 accumulation is PHF1 dependent. Immunoblot analysis on total protein extract
Supporting Information
Supporting Information Üstün and Börnke, 2015 Figure S1: XopJ does not display acetyltransferase activity. Autoacetylation activity in vitro. Acetylation reactions using MBP, MBP-XopJ, GST and GST-HopZ1a
Supplementary Figure 1 Collision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK2, PPK3 and PPK4 respectively.
Supplementary Figure 1 lision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK, PPK3 and PPK respectively. % of nuclei with signal / field a 5 c ppif3:gus pppk1:gus 0 35 30 5 0 15 10
Supplemental Data. Zhang et al. Plant Cell (2014) /tpc
Supplemental Data. Zhang et al. Plant Cell (214) 1.115/tpc.114.134163 55 - T C N SDIRIP1-GFP 35-25 - Psb 18 - Histone H3 Supplemental Figure 1. Detection of SDIRIP1-GFP in the nuclear fraction by Western
Supplemental Data. Liu et al. (2013). Plant Cell /tpc
Supplemental Figure 1. The GFP Tag Does Not Disturb the Physiological Functions of WDL3. (A) RT-PCR analysis of WDL3 expression in wild-type, WDL3-GFP, and WDL3 (without the GFP tag) transgenic seedlings.
Supplemental Data. Steiner et al. Plant Cell. (2012) /tpc
Supplemental Figure 1. SPY does not interact with free GST. Invitro pull-down assay using E. coli-expressed MBP-SPY and GST, GST-TCP14 and GST-TCP15. MBP-SPY was used as bait and incubated with equal amount
Figure S1. DELLA Proteins Act as Positive Regulators to Mediate GA-Regulated Anthocyanin
Supplemental Information Figure S1. DELLA Proteins Act as Positive Regulators to Mediate GA-Regulated Anthocyanin Biosynthesis. (A) Effect of GA on anthocyanin content in WT and ga1-3 seedlings. Mock,
Supplemental Figure 1 Human REEP family of proteins can be divided into two distinct subfamilies. Residues (single letter amino acid code) identical
Supplemental Figure Human REEP family of proteins can be divided into two distinct subfamilies. Residues (single letter amino acid code) identical in all six REEPs are highlighted in green. Additional
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
Supplemental Data. Hu et al. Plant Cell (2017) /tpc
1 2 3 4 Supplemental Figure 1. DNA gel blot analysis of homozygous transgenic plants. (Supports Figure 1.) 5 6 7 8 Rice genomic DNA was digested with the restriction enzymes EcoRⅠ and BamHⅠ. Lanes in the
Supplementary Data Supplementary Figures
Supplementary Data Supplementary Figures Supplementary Figure 1. Pi04314 is expressed during infection, each GFP-Pi04314 fusion is stable and myr GFP-Pi04314 is removed from the nucleus while NLS GFP-Pi04314
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full//59/ra7/dc1 Supplementary Materials for Dok-7 ctivates the Muscle Receptor Kinase MuSK and Shapes Synapse Formation kane Inoue, Kiyoko Setoguchi, Yosuke Matsubara,
Supplementary Information
Supplementary Information MED18 interaction with distinct transcription factors regulates plant immunity, flowering time and responses to hormones Supplementary Figure 1. Diagram showing T-DNA insertion
SUPPLEMENTARY INFORMATION
DOI:.38/ncb54 sensitivity (+/-) 3 det- WS bri-5 BL (nm) bzr-dbri- bzr-d/ bri- g h i a b c d e f Hypcocotyl length(cm) 5 5 PAC Hypocotyl length (cm)..8..4. 5 5 PPZ - - + + + + - + - + - + PPZ - - + + +
Supplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity.
Supplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity. (A) Amino acid alignment of HDA5, HDA15 and HDA18. The blue line
Supplemental Figure 1. Mutation in NLA Causes Increased Pi Uptake Activity and
Supplemental Figure 1. Mutation in NLA Causes Increased Pi Uptake Activity and PHT1 Protein Amounts. (A) Shoot morphology of 19-day-old nla mutants under Pi-sufficient conditions. (B) [ 33 P]Pi uptake
Supplemental figure 1. Alignment of the 14 putative leucine-rich repeats in tobacco ACIF1
Supplemental Data. van den urg et al. (2008). The F-box protein CRE189/CIF1 regulates cell death and defense responses activated during pathogen recognition in tobacco and tomato. Supplemental figure 1.
SUPPLEMENTARY INFORMATION
DOI:.38/ncb327 a b Sequence coverage (%) 4 3 2 IP: -GFP isoform IP: GFP IP: -GFP IP: GFP Sequence coverage (%) 4 3 2 IP: -GFP IP: GFP 33 52 58 isoform 2 33 49 47 IP: Control IP: Peptide Sequence Start
GFP CCD2 GFP IP:GFP
D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant
Supplemental Data. Wang et al. (2016). Plant Cell /tpc
Supplemental Figure 1. Time-Course Analysis of Storage Proteins during Endosperm Development of the Wild-type 9311 and the gpa4-1 Mutant. (A) SDS-PAGE analyses of seed storage proteins during wild-type
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Han et al., http://www.jcb.org/cgi/content/full/jcb.201311007/dc1 Figure S1. SIVA1 interacts with PCNA. (A) HEK293T cells were transiently
Nature Genetics: doi: /ng Supplementary Figure 1. ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets.
Supplementary Figure 1 ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets. Gene structures are shown underneath each panel. Supplementary Figure 2 pref6::ref6-gfp complements
Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.
Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying
Supplemental Data. Seo et al. (2014). Plant Cell /tpc
Supplemental Figure 1. Protein alignment of ABD1 from other model organisms. The alignment was performed with H. sapiens DCAF8, M. musculus DCAF8 and O. sativa Os10g0544500. The WD40 domains are underlined.
Supplementary Table S1 qrt-pcr primers for the genes related to the flavonoid, lignin and starch metabolism pathways
Altered Phenylpropanoid Metabolism in the Maize Lc-Expressed Sweet Potato (Ipomoea batatas) Affects Storage Root Development. Hongxia Wang, JunYang, Min Zhang, Weijuan Fan, Nurit Firon, Sitakanta Pattanaik,
Supplemental Data. Li et al. (2015). Plant Cell /tpc
Supplemental Data Supplemental Figure 1: Characterization of asr3 T-DNA knockout lines and complementation transgenic lines. (A) The scheme of At2G33550 (ASR3) with gray boxes indicating exons and dash
Supplemental Data. Peng et al. (2015). Plant Cell /tpc
A (petal area) 8 8 (petal cell area) 8 C (leaf area) 8 Supplemental Figure. DA, DAR and DAR act redundantly to affect organ growth. Petal area (A), petal cell area () and fifth leaf area (C) of Col-, da-ko,
Nature Genetics: doi: /ng Supplementary Figure 1. High-confidence PRC2 targets and candidate PREs.
Supplementary Figure 1 High-confidence PRC2 targets and candidate PREs. (a) Flowchart for identification of candidate Arabidopsis PREs. We identified 1504 genomic regions marked by at least 3 of the following:
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material JCB Tanaka et al., http://www.jcb.org/cgi/content/full/jcb.201402128/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Nonselective autophagy is normal in Hrr25-depleted
Supplemental Data. Wang et al. (2017). Plant Cell /tpc NIP1;2 NIP7;1
Supplemental Data. Wang et al. (217). Plant Cell 1.115/tpc.16.825 NIP1;1 NIP1;2 NIP2;1 NIP3;1 NIP4;1 NIP5;1 NIP6;1 NIP7;1 Supplemental Figure 1. Distinct Localization of NIPs in Root Epidermal Cells. (Supports
Supplemental Figure S1. Nucleotide and deduced amino acid sequences of pepper CaHSP70a (Capsicum annuum heat shock protein 70a) cdna.
Supplemental Figure S1. Nucleotide and deduced amino acid sequences of pepper (Capsicum annuum heat shock protein 70a) cdna. Translation initiation codon is shown in bold typeface; termination codon is
Supplemental Data. Jing et al. (2013). Plant Cell /tpc
Supplemental Figure 1. Characterization of epp1 Mutants. (A) Cotyledon angles of 5-d-old Col wild-type (gray bars) and epp1-1 (black bars) seedlings under red (R), far-red (FR) and blue (BL) light conditions,
Supplementary Figure S1. Growth patterns of WT and siz1-2 plants and the effect of different nitrogen sources on their growth. After germination on
Supplementary Figure S1. Growth patterns of WT and siz1-2 plants and the effect of different nitrogen sources on their growth. After germination on MS media, seedlings were transferred to soil and treated
Supplementary Figure S1. N-terminal fragments of LRRK1 bind to Grb2.
Myc- HA-Grb2 Mr(K) 105 IP HA 75 25 105 1-1163 1-595 - + - + - + 1164-1989 Blot Myc HA total lysate 75 25 Myc HA Supplementary Figure S1. N-terminal fragments of bind to Grb2. COS7 cells were cotransfected
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43
Supplemental data. Zhao et al. (2009). The Wuschel-related homeobox gene WOX11 is required to activate shoot-borne crown root development in rice.
Supplemental data. Zhao et al. (2009). The Wuschel-related homeobox gene WOX11 is required to activate shoot-borne crown root development in rice. A B Supplemental Figure 1. Expression of WOX11p-GUS WOX11-GFP
Supplemental Data. Hachez et al. Plant Cell (2014) /tpc Suppl. Figure 1A
Suppl. Figure 1A Suppl. Figure 1B Supplemental Figure 1: Results of the commercial screening of interactants using split ubiquitin technique. (A) Isolated preys (192) using the bait construct pbt3-n- as
Supplemental Data. Farmer et al. (2010) Plant Cell /tpc
Supplemental Figure 1. Amino acid sequence comparison of RAD23 proteins. Identical and similar residues are shown in the black and gray boxes, respectively. Dots denote gaps. The sequence of plant Ub is
Expanded View Figures
Expanded View Figures Figure EV1. AM3-CLE45 control experiments and bam3 alleles. A Relative primary root length of indicated genotypes at 9 dag, in response to increasing amounts of CLE45 in the media.
Figure S1. USP-46 is expressed in several tissues including the nervous system
Supplemental Figure legends Figure S1. USP-46 is expressed in several tissues including the nervous system Transgenic animals expressing a transcriptional reporter (P::GFP) were imaged using epifluorescence
Supplemental materials
Supplemental materials Materials and methods for supplemental figures Yeast two-hybrid assays TAP46-PP2Ac interactions I. The TAP46 was used as the bait and the full-length cdnas of the five C subunits
ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
AD BD TOC1. Supplementary Figure 1: Yeast two-hybrid assays showing the interaction between
AD X BD TOC1 AD BD X PIFΔAD PIF TOC1 TOC1 PIFΔAD PIF N TOC1 TOC1 C1 PIFΔAD PIF C1 TOC1 TOC1 C PIFΔAD PIF C TOC1 Supplementary Figure 1: Yeast two-hybrid assays showing the interaction between PIF and TOC1
SUPPLEMENTAL MATERIALS
SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURES Supplemental Figure S1. Analyses of the CRY1-SPA1 interaction (A) An auxotrophy growth assay (left) and a filter-based -galactosidase colorimetric assay (right)
Supplemental Figure 1. HepG2 cells were transfected with GLI luciferase reporter construct
Supplemental Figure 1. HepG2 cells were transfected with GLI luciferase reporter construct (pgl38xgli), EWS-FLI1 luciferase reporter construct (NROB1-Luc) with or without GLI1, EWS- FLI1 and cdnas respectively.
Supplemental Data. Na Xu et al. (2016). Plant Cell /tpc
Supplemental Figure 1. The weak fluorescence phenotype is not caused by the mutation in At3g60240. (A) A mutation mapped to the gene At3g60240. Map-based cloning strategy was used to map the mutated site
Supplemental Information. Pacer Mediates the Function of Class III PI3K. and HOPS Complexes in Autophagosome. Maturation by Engaging Stx17
Molecular Cell, Volume 65 Supplemental Information Pacer Mediates the Function of Class III PI3K and HOPS Complexes in Autophagosome Maturation by Engaging Stx17 Xiawei Cheng, Xiuling Ma, Xianming Ding,
Supplemental Data. Zhang et al. (2010). Plant Cell /tpc
Supplemental Figure 1. uvs90 gene cloning The T-DNA insertion in uvs90 was identified using thermal asymmetric interlaced (TAIL)-PCR. Three rounds of amplification were performed; the second (2 nd ) and
Supplemental Information. A Tyrosine Phosphorylation Cycle. Regulates Fungal Activation of a Plant. Receptor Ser/Thr Kinase
Cell Host & Microbe, Volume 23 Supplemental Information A Tyrosine Phosphorylation Cycle Regulates Fungal Activation of a Plant Receptor Ser/Thr Kinase Jun Liu, Bing Liu, Sufen Chen, Ben-Qiang Gong, Lijuan
The yeast two-hybrid assay
Master program Molecular and Cellular Life Sciences Block 1: Intracellular membrane processes 11th October 2011 The yeast two-hybrid assay Fulvio Reggiori Department of Cell Biology, UMC Utrecht For what
Supplemental Data. Wang et al. Plant Cell. (2013) /tpc
SNL1 SNL Supplemental Figure 1. The Expression Patterns of SNL1 and SNL in Different Tissues of Arabidopsis from Genevestigator Web Site (https://www.genevestigator.com/gv/index.jsp). 1 A 1. 1..8.6.4..
pmyrsaur78 psosein4+ psosetr1+ psosetr2+
SAUR77 SAUR78 SAUR76 Figure S1 Phylogenetic analysis of Arabidopsis SAUR proteins. The analyses were conducted in MEGA5, using the Neighbor-Joining method. The percentage of replicate trees in which the
Supplementary Information. c d e
Supplementary Information a b c d e f Supplementary Figure 1. atabcg30, atabcg31, and atabcg40 mutant seeds germinate faster than the wild type on ½ MS medium supplemented with ABA (a and d-f) Germination
kda
Relative VENUS/RFP fluorescence Relative fluorescence a min 2 min 4 min 6 min 8 min min Jas9-VENUS d kda 8 3 75 63 48 Jas9-VENUS Col- - + - + COR µm Jas9-VENUS 35 28 H2B-RFP 7 b c Overlay,2,8,6,4,2,6,4,2,8,6,4,2
Supplemental Data. Benstein et al. (2013). Plant Cell /tpc
Supplemental Figure 1. Purification of the heterologously expressed PGDH1, PGDH2 and PGDH3 enzymes by Ni-NTA affinity chromatography. Protein extracts (2 µl) of different fractions (lane 1 = total extract,
SUPPLEMENTAL INFORMATION
SUPPLEMENTL INFORMTION P. syringae Genotype; relevant features a bbreviation Reference pv. tomato DC Wild Type; Rf R DC Cuppels, D.. 98 CUCP ΔhrcC::nptII, TSS -, Km R in hrp inducing media ΔhrcC Peñaloza-
- PDI5. - Actin A 300-UTR5. PDI5 lines WT. Arabidopsis Chromosome 1. PDI5 (At1g21750) SALK_ SALK_ SALK_015253
Supplemental Data. Ondzighi et al. (2008). Arabidopsis Protein Disulfide Isomerase-5 Inhibits ysteine Proteases During Trafficking to Vacuoles Prior to Programmed ell Death of the dothelium in Developing
A RRM1 H2AX DAPI. RRM1 H2AX DAPI Merge. Cont. sirna RRM1
A H2AX DAPI H2AX DAPI Merge Cont sirna Figure S1: Accumulation of RRM1 at DNA damage sites (A) HeLa cells were subjected to in situ detergent extraction without IR irradiation, and immunostained with the
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary figures Supplementary Figure 1: Suv39h1, but not Suv39h2, promotes HP1α sumoylation in vivo. In vivo HP1α sumoylation assay. Top: experimental scheme. Middle: we
SUPPLEMENTAL FIGURES AND TABLES
SUPPLEMENTAL FIGURES AND TABLES A B Flag-ALDH1A1 IP: α-ac HEK293T WT 91R 128R 252Q 367R 41/ 419R 435R 495R 412R C Flag-ALDH1A1 NAM IP: HEK293T + + - + D NAM - + + E Relative ALDH1A1 activity 1..8.6.4.2
α-mannosidase II (HGL1/MANII) β1,2-n-acetyl-glucosaminyltransferase II (GNTII)
Oligosaccharyltransferase (OST) (STT3a, STT3b, DD1, DD2, DGL1) Glucosidase I, Glucosidase II ER-Mannosidase α-mannosidase I (MNI) β1,2-n-acetyl-glucosaminyltransferase I (CGL1/GNTI) α-mannosidase II (HGL1/MNII)
S156AT168AY175A (AAA) were purified as GST-fusion proteins and incubated with GSTfused
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 Supplemental Materials Supplemental Figure S1 (a) Phenotype of the wild type and grik1-2 grik2-1 plants after 8 days in darkness.
Supplemental Data. Guo et al. (2015). Plant Cell /tpc
Supplemental Figure 1. The Mutant exb1-d Displayed Pleiotropic Phenotypes and Produced Branches in the Axils of Cotyledons. (A) Branches were developed in exb1-d but not in wild-type plants. (B) and (C)
Autophagy induction [h]
![Autophagy induction [h]](/thumbs/80/80564099.jpg "Autophagy induction [h]")
A SD-N [h]: SD-N [h]: 1 2 4 1 2 4 1 2 4 -GFP 1 2 4 percentage GFP-Atg8 [%] 1 9 8 7 6 5 4 3 2 1 1 2 4 Autophagy induction [h] -13xmyc SD-N [h]: 1 2 4 -GFP -13xmyc 1 prape1 mape1 - - GFP - 13xmyc mape1 [%]
Supplemental Materials
Supplemental Materials Flores-Pérez et al., Supplemental Materials, page 1 of 5 Supplemental Figure S1. Pull-down and BiFC controls, and quantitative analyses associated with the BiFC studies. (A) Controls
SUPPLEMENTARY INFORMATION
doi:.38/nature899 Supplementary Figure Suzuki et al. a c p7 -/- / WT ratio (+)/(-) p7 -/- / WT ratio Log X 3. Fold change by treatment ( (+)/(-)) Log X.5 3-3. -. b Fold change by treatment ( (+)/(-)) 8
Supplementary Information
Supplementary Information ER-localized auxin transporter PIN8 regulates auxin homeostasis and male gametophyte development in Arabidopsis Supplemental Figures a 8 6 4 2 Absolute Expression b Absolute Expression
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Nakajima and Tanoue, http://www.jcb.org/cgi/content/full/jcb.201104118/dc1 Figure S1. DLD-1 cells exhibit the characteristic morphology
Fig. S1. CrgA intracellular levels in M. tuberculosis. Ten and twenty micrograms of
Supplementary data Fig. S1. CrgA intracellular levels in M. tuberculosis. Ten and twenty micrograms of cell free protein lysates from WT M. tuberculosis (Rv) together with various known concentrations
Experimental Tools and Resources Available in Arabidopsis. Manish Raizada, University of Guelph, Canada
Experimental Tools and Resources Available in Arabidopsis Manish Raizada, University of Guelph, Canada Community website: The Arabidopsis Information Resource (TAIR) at http://www.arabidopsis.org Can order
Supplemental Data. Sun et al. Plant Cell. (2012) /tpc FLS2 -cmyc -GFP FLS2 -HA. FLS2-FLAG FLS2 -HA BAK1-HA flg22 (10mM)
Supplemental Data. Sun et al. Plant ell. ()..5/tpc..9599 A FLS-FLA FLS -HA BAK-HA flg (mm) - B FLS -cmyc -FP FLS -HA IP antibody cmyc FLA FP cmyc IP ; WB: α-ha IP; WB: α-ha IP: α-fla; WB: α-ha IP ; WB:
Supplemental Data. Shimoda et al. (2011). Plant Cell /tpc B C D E
(kda) 80 58 46 30 25 B C D E (0/15) (29/29) (0/29) (0/32) Supplemental Figure 1. Immunodetection of Myc-tagged CCaMK Protein Variants on ccamk-3 Roots. () Immunodetection of myc-tag fusion CCaMK WT, 1-340
Xu et al., Supplementary Figures 1-7
Xu et al., Supplementary Figures 1-7 Supplementary Figure 1. PIPKI is required for ciliogenesis. (a) PIPKI localizes at the basal body of primary cilium. RPE-1 cells treated with two sirnas targeting to
Supplemental Data. Furlan et al. Plant Cell (2017) /tpc
Supplemental Data. Furlan et al. Plant Cell (0) 0.0/tpc..00. Supplemental Data. Furlan et al. Plant Cell (0) 0.0/tpc..00. Supplemental Data. Furlan et al. Plant Cell (0) 0.0/tpc..00. Supplemental Figure.
Aminoacid change in chromophore. PIN3::PIN3-GFP GFP S65 (no change) (5.9) (Kneen et al., 1998)
Supplemental Table. Table S1. Fluorophore characteristics of used fluorescent proteins, Related to Figure 2 and 3. Transgenic line Fluprescent marker Aminoacid change in chromophore pk(a) Ref. PIN3::PIN3-GFP
Supplementary methods
Supplementary methods Cell culture, infection, transfection, and RNA interference HEK293 cells and its derivatives were grown in DMEM supplemented with 10% FBS. Various constructs were introduced into
Supplemental Data Supplemental Figure 1.
Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)
Supplementary Figure S1. Np95 interacts with de novo methyltransferases Dnmt3a and 3b. (A) Co-immunoprecipitation of endogenous Dnmt3a2 (left and
Supplementary Figure S1. Np95 interacts with de novo methyltransferases Dnmt3a and 3b. (A) Co-immunoprecipitation of endogenous Dnmt3a2 (left and right), Dnmt3b isoforms (left) and Dnmt1 (right) with GFP-Np95
Supplementary information
Supplementary information Supplementary figures Figure S1 Level of mycdet1 protein in DET1 OE-1, OE-2 and OE-3 transgenic lines. Total protein extract from wild type Col0, det1-1 mutant and DET1 OE lines
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified by primers used for mrna expression analysis. Gray
- 1 - Supplemental Data
- 1-1 Supplemental Data 2 3 4 5 6 7 8 9 Supplemental Figure S1. Differential expression of AtPIP Genes in DC3000-inoculated plants. Gene expression in leaves was analyzed by real-time RT-PCR and expression
(a) Immunoblotting to show the migration position of Flag-tagged MAVS
Supplementary Figure 1 Characterization of six MAVS isoforms. (a) Immunoblotting to show the migration position of Flag-tagged MAVS isoforms. HEK293T Mavs -/- cells were transfected with constructs expressing
Supporting information
Supporting information Construction of strains and plasmids To create ptc67, a PCR product obtained with primers cc2570-162f (gcatgggcaagcttgaggacggcgtcatgt) and cc2570+512f (gaggccgtggtaccatagaggcgggcg),
The RING-type E3 ubiquitin ligase MIEL1 targets the Arabidopsis transcription factor MYB30 for degradation and attenuates plant defense
The RING-type E3 ubiquitin ligase MIEL1 targets the Arabidopsis transcription factor MYB30 for degradation and attenuates plant defense Daniel Marino, Solène Froidure, Joanne Canonne, Sara Ben Khaled,
transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected with the wwp-luc reporter, and FLAG-tagged FHL1,
Supplementary Data Supplementary Figure Legends Supplementary Figure 1 FHL-mediated TGFβ-responsive reporter transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11070 Supplementary Figure 1 Purification of FLAG-tagged proteins. a, Purification of FLAG-RNF12 by FLAG-affinity from nuclear extracts of wild-type (WT) and two FLAG- RNF12 transgenic
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2386 Figure 1 Src-containing puncta are not focal adhesions, podosomes or endosomes. (a) FAK-/- were stained with anti-py416 Src (green) and either (in red) the focal adhesion protein paxillin,
Identification and Characterization of a Plastidic Adenine. Nucleotide Uniporter (OsBT1-3) Required for Chloroplast
Identification and Characterization of a Plastidic Adenine Nucleotide Uniporter (OsBT1-3) Required for Chloroplast Development in the Early Leaf Stage of Rice Authors: Daoheng Hu 1, Yang Li 1, Wenbin Jin
Nature Genetics: doi: /ng.3556 INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE. Supplementary Figure 1
INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE Supplementary Figure 1 REF6 expression in transgenic lines. (a,b) Expression of REF6 in REF6-HA ref6 and REF6ΔZnF-HA ref6 plants detected by RT qpcr (a) and immunoblot