Autophagy induction [h]

Cargo Proteins Facilitate the Formation of Transport Vesicles in the Cytoplasm to Vacuole Targeting Pathway*

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 279, No. 29, Issue of July 16, pp. 29889 29894, 2004 2004 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Cargo Proteins

42 fl organelles = 34.5 fl (1) 3.5X X 0.93 = 78,000 (2)

SUPPLEMENTAL DATA Supplementary Experimental Procedures Fluorescence Microscopy - A Zeiss Axiovert 200M microscope equipped with a Zeiss 100x Plan- Apochromat (1.40 NA) DIC objective and Hamamatsu Orca

Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.

Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying

Coleman et al., Supplementary Figure 1

Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential

GFP CCD2 GFP IP:GFP

D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant

Journal of Cell Science Supplementary Material

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 SUPPLEMENTARY FIGURE LEGENDS Figure S1: Eps8 is localized at focal adhesions and binds directly to FAK (A) Focal

Supplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1.

Supplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1. Percent of original fluorescence was plotted as a function of time following photobleaching

Figure S1. sporulation frequency (%) 80. sme2-5. sme2-3. sme2

Figure S1 N WT -5-3 - DSRless mei4 100 ssm4 MS2loop () (kb) 1.0 0.5 sporulation frequency (%) 80 60 40 20 rrna 1 2 3 4 5 6 7 8 0 WT -5-3 -DSRless Figure S1. The DSR motifs in are crucial for its function.

Materials and Methods: All strains were derivatives of SK1 and are listed in Supplemental Table 1.

Supplemental Online Material: Materials and Methods: All strains were derivatives of SK1 and are listed in Supplemental Table 1. Constructs: pclb2-3ha-cdc5 and pclb2-3ha-cdc2 strains were constructed by

PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF

YFP-PHF1 CFP-PHT1;2 PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF + CFP-PHT1;2 Negative control!-gfp Supplemental Figure 1: PHT1;2 accumulation is PHF1 dependent. Immunoblot analysis on total protein extract

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid

Figure S1. Immunoblotting showing proper expression of tagged R and AVR proteins in N. benthamiana.

SUPPLEMENTARY FIGURES Figure S1. Immunoblotting showing proper expression of tagged R and AVR proteins in N. benthamiana. YFP:, :CFP, HA: and (A) and HA, CFP and YFPtagged and AVR1-CO39 (B) were expressed

Supplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA

Supplemental Data. Wu et al. (2). Plant Cell..5/tpc..4. A B Supplemental Figure. Immunoblot analysis verifies the expression of the AD-PP2C and BD-RGLG proteins in the Y2H assay. Total proteins were extracted

Parthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss

SUPPLEMENTARY INFORMATION Parthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss Yunjong Lee, Senthilkumar S. Karuppagounder, Joo-Ho Shin, Yun-Il Lee, Han Seok Ko, Debbie Swing,

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43

Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous

Preparation and purification of polyclonal antibodies Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous injections of glutathione S-transferase-ARHGAP25-(509-619) (GST-coiled

pgbkt7 Anti- Myc AH109 strain (KDa) 50

pgbkt7 (KDa) 50 37 Anti- Myc AH109 strain Supplementary Figure 1. Protein expression of CRN and TDR in yeast. To analyse the protein expression of CRNKD and TDRKD, total proteins extracted from yeast culture

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary

Different Domains of the UBL-UBA Ubiquitin Receptor, Ddi1/Vsm1, Are Involved in Its Multiple Cellular Roles

Molecular Biology of the Cell Vol. 19, 3625 3637, September 2008 Different Domains of the UBL-UBA Ubiquitin Receptor, Ddi1/Vsm1, Are Involved in Its Multiple Cellular Roles Galina Gabriely, Rachel Kama,

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using

X2-C/X1-Y X2-C/VCAM-Y. FRET efficiency. Ratio YFP/CFP

FRET efficiency.7.6..4.3.2 X2-C/X1-Y X2-C/VCAM-Y.1 1 2 3 Ratio YFP/CFP Supplemental Data 1. Analysis of / heterodimers in live cells using FRET. FRET saturation curves were obtained using cells transiently

Hossain_Supplemental Figure 1

Hossain_Supplemental Figure 1 GFP-PACT GFP-PACT Motif I GFP-PACT Motif II A. MG132 (1µM) GFP Tubulin GFP-PACT Pericentrin GFP-PACT GFP-PACT Pericentrin Fig. S1. Expression and localization of Orc1 PACT

* ** ** * IB: p-p90rsk. p90rsk (Ser380) (arbitrary units) (Ser380) p90rsk. IB: p90rsk. Tubulin. IB: Tubulin. Ang II (200 nm) Ang II (200 nm)

I: p-p9rsk I: p9rsk I: C I: p-p9rsk I: p9rsk 5 (ka) 5 5 (min) Ang II ( nm) p-p9rsk (Ser8) p9rsk p-p9rsk (Ser8) p9rsk (h) Mannitol 5 mm -Glucose 5 mm p9rsk (Ser8) (arbitrary units) p-p9rsk (Ser8) (arbitrary

SUPPLEMENTARY INFORMATION FOR SELA ET AL., Neddylation and CAND1 independently stimulate SCF ubiquitin ligase activity in Candida albicans

SUPPLEMENTARY INFORMATION FOR SELA ET AL., Neddylation and CAND1 independently stimulate SCF ubiquitin ligase activity in Candida albicans Supplementary methods Plasmids and strains construction CaRUB1

Supplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana

Cell, Volume 138 Supplemental Data mir156-regulated SPL Transcription Factors Define an Endogenous Flowering Pathway in Arabidopsis thaliana Jia-Wei Wang, Benjamin Czech, and Detlef Weigel Table S1. Interaction

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.

/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG

Supplemental Figure 1. Mutation in NLA Causes Increased Pi Uptake Activity and

Supplemental Figure 1. Mutation in NLA Causes Increased Pi Uptake Activity and PHT1 Protein Amounts. (A) Shoot morphology of 19-day-old nla mutants under Pi-sufficient conditions. (B) [ 33 P]Pi uptake

Supplemental Data. Steiner et al. Plant Cell. (2012) /tpc

Supplemental Figure 1. SPY does not interact with free GST. Invitro pull-down assay using E. coli-expressed MBP-SPY and GST, GST-TCP14 and GST-TCP15. MBP-SPY was used as bait and incubated with equal amount

Supplementary Material. TRIB3 inhibits proliferation and promotes osteogenesis in hbmscs by regulating the. ERK1/2 signaling pathway

Supplementary Material TRIB3 inhibits proliferation and promotes osteogenesis in hbmscs by regulating the ERK1/2 signaling pathway Cui Zhang 1, Fan-Fan Hong 1, Cui-Cui Wang 1, Liang Li 1, Jian-Ling Chen

Figure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA.

Summary of Supplemental Information Figure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA. Figure S2: rrna removal procedure is effective for clearing out

SUPPLEMENTARY INFORMATION

doi:.38/nature899 Supplementary Figure Suzuki et al. a c p7 -/- / WT ratio (+)/(-) p7 -/- / WT ratio Log X 3. Fold change by treatment ( (+)/(-)) Log X.5 3-3. -. b Fold change by treatment ( (+)/(-)) 8

Chemical hijacking of auxin signaling with an engineered auxin-tir1

1 SUPPLEMENTARY INFORMATION Chemical hijacking of auxin signaling with an engineered auxin-tir1 pair Naoyuki Uchida 1,2*, Koji Takahashi 2*, Rie Iwasaki 1, Ryotaro Yamada 2, Masahiko Yoshimura 2, Takaho

Std1 and Mth1 Proteins Interact with the Glucose Sensors To Control Glucose-Regulated Gene Expression in Saccharomyces cerevisiae

MOLECULAR AND CELLULAR BIOLOGY, July 1999, p. 4561 4571 Vol. 19, No. 7 0270-7306/99/$04.00 0 Copyright 1999, American Society for Microbiology. All Rights Reserved. Std1 and Mth1 Proteins Interact with

Tension directly stabilizes reconstituted. kinetochore-microtubule attachments

SUPPLEMENTARY INFORMATION Tension directly stabilizes reconstituted kinetochore-microtubule attachments Bungo Akiyoshi, Krishna K. Sarangapani, Andrew F. Powers, Christian R. Nelson, Steve L. Reichow,

Revision Checklist for Science Signaling Research Manuscripts: Data Requirements and Style Guidelines

Revision Checklist for Science Signaling Research Manuscripts: Data Requirements and Style Guidelines Further information can be found at: http://stke.sciencemag.org/sites/default/files/researcharticlerevmsinstructions_0.pdf.

A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Journal of Plant Research A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana Linna Leng 1 Qianqian Liang

Supplementary Figure 1. Isolation of GFPHigh cells.

Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding

SUMOstar Gene Fusion Technology

Gene Fusion Technology NEW METHODS FOR ENHANCING FUNCTIONAL PROTEIN EXPRESSION AND PURIFICATION IN INSECT CELLS White Paper June 2007 LifeSensors Inc. 271 Great Valley Parkway Malvern, PA 19355 www.lifesensors.com

Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than. SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with

Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with concentration of 800nM) were incubated with 1mM dgtp for the indicated

GTTCGGGTTCC TTTTGAGCAG

Supplementary Figures Splice variants of the SIP1 transcripts play a role in nodule organogenesis in Lotus japonicus. Wang C, Zhu H, Jin L, Chen T, Wang L, Kang H, Hong Z, Zhang Z. 5 UTR CDS 3 UTR TCTCAACCATCCTTTGTCTGCTTCCGCCGCATGGGTGAGGTCATTTTGTCTAGATGACGTGCAATTTACAATGA

Supplementary Figure 1. BES1 specifically inhibits ABA responses in early seedling

Supplementary Figure 1. BES1 specifically inhibits ABA responses in early seedling development. a. Exogenous BR application overcomes the hypersensitivity of bzr1-1d seedlings to ABA. Seed germination

Supplemental Information. A Versatile Tool for Live-Cell Imaging. and Super-Resolution Nanoscopy Studies. of HIV-1 Env Distribution and Mobility

Cell Chemical Biology, Volume 24 Supplemental Information A Versatile Tool for Live-Cell Imaging and Super-Resolution Nanoscopy Studies of HIV-1 Env Distribution and Mobility Volkan Sakin, Janina Hanne,

Supplementary Figure 1. RAD51 and RAD51 paralogs are enriched spontaneously onto

Supplementary Figure legends Supplementary Figure 1. and paralogs are enriched spontaneously onto the S-phase chromatin during DN replication. () Chromatin fractionation was carried out as described in

3. Results. 3.1 Generation of HEK293 cell clones stably expressing ETA and ETB receptors

3. Results 3.1 Generation of HEK293 cell clones stably expressing ETA and ETB receptors To investigate the dimerisation of the endothelin receptor subtypes HEK293 cells were stably transfected with plasmids

SUPPLEMENTAL MATERIALS

SUPPLEMENL MERILS Eh-seq: RISPR epitope tagging hip-seq of DN-binding proteins Daniel Savic, E. hristopher Partridge, Kimberly M. Newberry, Sophia. Smith, Sarah K. Meadows, rian S. Roberts, Mark Mackiewicz,

The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit

Cell Reports, Volume 5 Supplemental Information The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Andrey Poleshko, Katelyn M. Mansfield, Caroline

Table S1. Primer sequences

Table S1. Primer sequences Primers for quantitative PCR Tgf 1 Forward Tgf 1 Reverse Tgf 2Forward Tgf 2Reverse Tgf 3 Forward Tgf 3 Reverse Tgf r1 Forward Tgf r1 Reverse Tgf r2 Forward Tgf r2 Reverse Thbs1

(A) Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site.

SUPPLEMENTRY INFORMTION SUPPLEMENTL FIGURES Figure S1. () Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site. () Western blot of ligated and unligated sciatic

Supplementary Figure 1: Expression of RNF8, HERC2 and NEURL4 in the cerebellum and knockdown of RNF8 by RNAi (a) Lysates of the cerebellum from rat

Supplementary Figure 1: Expression of RNF8, HERC2 and NEURL4 in the cerebellum and knockdown of RNF8 by RNAi (a) Lysates of the cerebellum from rat pups at P6, P14, P22, P30 and adult (A) rats were subjected

The microtubule-associated tau protein has intrinsic acetyltransferase activity. Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and

SUPPLEMENTARY INFORMATION: The microtubule-associated tau protein has intrinsic acetyltransferase activity Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and Virginia M.Y. Lee Cohen

Supplemental Material for Xue et al. List. Supplemental Figure legends. Figure S1. Related to Figure 1. Figure S2. Related to Figure 3

Supplemental Material for Xue et al List Supplemental Figure legends Figure S1. Related to Figure 1 Figure S. Related to Figure 3 Figure S3. Related to Figure 4 Figure S4. Related to Figure 4 Figure S5.

Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh

Developmental Cell, Volume 22 Supplemental Information Control of Seed Germination by Light-Induced Histone Arginine Demethylation Activity Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon

SUPPLEMENTARY INFORMATION

doi:10.1038/nature09732 Supplementary Figure 1: Depletion of Fbw7 results in elevated Mcl-1 abundance. a, Total thymocytes from 8-wk-old Lck-Cre/Fbw7 +/fl (Control) or Lck-Cre/Fbw7 fl/fl (Fbw7 KO) mice

Supplemental Data. Lee et al. Plant Cell. (2010) /tpc Supplemental Figure 1. Protein and Gene Structures of DWA1 and DWA2.

Supplemental Figure 1. Protein and Gene Structures of DWA1 and DWA2. (A) Protein structures of DWA1 and DWA2. WD40 region was determined based on the NCBI conserved domain databases (B, C) Schematic representation

Inhibition of TATA-Binding Protein Function by SAGA Subunits Spt3 and Spt8 at Gcn4-Activated Promoters

MOLECULAR AND CELLULAR BIOLOGY, Jan. 2000, p. 634 647 Vol. 20, No. 2 0270-7306/00/$04.00 0 Copyright 2000, American Society for Microbiology. All Rights Reserved. Inhibition of TATA-Binding Protein Function

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-

#1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals

Supplemental Information. Antagonistic Activities of Sox2. and Brachyury Control the Fate Choice. of Neuro-Mesodermal Progenitors

Developmental Cell, Volume 42 Supplemental Information Antagonistic Activities of Sox2 and Brachyury Control the Fate Choice of Neuro-Mesodermal Progenitors Frederic Koch, Manuela Scholze, Lars Wittler,

Oxidative Stress Function of the Saccharomyces cerevisiae Skn7 Receiver Domain

EUKARYOTIC CELL, May 2009, p. 768 778 Vol. 8, No. 5 1535-9778/09/$08.00 0 doi:10.1128/ec.00021-09 Copyright 2009, American Society for Microbiology. All Rights Reserved. Oxidative Stress Function of the

Fig. S1. Endocytosis of extracellular cargo does not depend on dia. (A) To visualize endocytosis, fluorescently labelled wheat germ agglutinin

Fig. S1. Endocytosis of extracellular cargo does not depend on dia. (A) To visualize endocytosis, fluorescently labelled wheat germ agglutinin (WGA-Alexa555) was injected into the extracellular perivitteline

Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected

Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected with the sirna against lnc-2, lnc-6, lnc-7, and the

Supplemental Data. Aung et al. (2011). Plant Cell /tpc

35S pro:pmd1-yfp 10 µm Supplemental Figure 1. -terminal YFP fusion of PMD1 (PMD1-YFP, in green) is localized to the cytosol. grobacterium cells harboring 35S pro :PMD1-YFP were infiltrated into tobacco

Using Sapphire700 Stain and DRAQ5 Stain for Cell Number Normalization

Using Sapphire700 Stain and DRAQ5 Stain for Cell Number Normalization Developed for: Aerius, Odyssey Classic, Odyssey CLx, and Odyssey Sa Infrared Imaging Systems Please refer to your manual to confirm

Nature Neuroscience: doi: /nn Supplementary Figure 1

Supplementary Figure 1 PCR-genotyping of the three mouse models used in this study and controls for behavioral experiments after semi-chronic Pten inhibition. a-c. DNA from App/Psen1 (a), Pten tg (b) and

A) B) Ladder. Supplementary Figure 1. Recombinant calpain 14 purification analysis. A) The general domain structure of classical

A) B) Ladder C) r4 r4 Nt- -Ct 78 kda Supplementary Figure 1. Recombinant calpain 14 purification analysis. A) The general domain structure of classical calpains is shown. The protease core consists of

The DNA Binding and Activation Domains of Gal4p Are Sufficient for Conveying Its Regulatory Signals

MOLECULAR AND CELLULAR BIOLOGY, May 1997, p. 2538 2549 Vol. 17, No. 5 0270-7306/97/$04.00 0 Copyright 1997, American Society for Microbiology The DNA Binding and Activation Domains of Gal4p Are Sufficient

Immunofluorescence images of different core histones and different histone exchange assay.

Molecular Cell, Volume 51 Supplemental Information Enhanced Chromatin Dynamics by FACT Promotes Transcriptional Restart after UV-Induced DNA Damage Christoffel Dinant, Giannis Ampatziadis-Michailidis,

UC San Diego UC San Diego Electronic Theses and Dissertations

UC San Diego UC San Diego Electronic Theses and Dissertations Title Phosphorylation of PUMA at Serine Residues -96 and -106 is Involved in Regulation of Autophagy but not Apoptosis / Permalink https://escholarship.org/uc/item/4ck325gs

of Medicine, Zhejiang University, Hangzhou, Zhejiang , China Michigan, 4424B MS-1, 1301 Catherine Street, Ann Arbor, MI 48109, USA.

Supplemental figure legends: Neddylation inhibitor MLN4924 suppresses growth and migration of human gastric cancer cells Huiyin Lan 1,2#, Zaiming Tang 1#, Hongchuan Jin 2, and Yi Sun 1,3,4* 1 Institute

Supplemental Information. Loss of MicroRNA-7 Regulation Leads. to a-synuclein Accumulation and. Dopaminergic Neuronal Loss In Vivo

YMTHE, Volume 25 Supplemental Information Loss of MicroRNA-7 Regulation Leads to a-synuclein Accumulation and Dopaminergic Neuronal Loss In Vivo Kirsty J. McMillan, Tracey K. Murray, Nora Bengoa-Vergniory,

Yeast GFP Clone Collection

Yeast GFP Clone Collection Catalog nos. 95700, 95701, 95702 Version B 30 September 2008 25-0730 IMPORTANT! Beginning in 2009, all Invitrogen clone manuals will only be available online at www.invitrogen.com

GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts

Current Biology, Volume 24 Supplemental Information GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts Wei Zhou, Jin Chang, Xin Wang, Masha G. Savelieff, Yinyin Zhao, Shanshan

Supplementary Table 1: List of CH3 domain interface residues in the first chain (A) and

Supplementary Tables Supplementary Table 1: List of CH3 domain interface residues in the first chain (A) and their side chain contacting residues in the second chain (B) a Interface Res. in Contacting

Figure 1. Schematic of Ats1p expression plasmid.

Abstract: Anita Corbett page 2 The goal of my rotation project was to express, purify, and examine the exchange activity of a putative guanine nucleotide exchange factor, Ats1p. The S. cerevisiae ATS1

Received 23 May 1995/Returned for modification 25 July 1995/Accepted 11 August 1995

MOLECULAR AND CELLULAR BIOLOGY, Nov. 1995, p. 6351 6363 Vol. 15, No. 11 0270-7306/95/$04.00 0 Copyright 1995, American Society for Microbiology Modulation of trna i, eif-2, and eif-2b Expression Shows

FRAUNHOFER IME SCREENINGPORT

FRAUNHOFER IME SCREENINGPORT Detection technologies used in drug discovery Introduction Detection technologies in drug discovery is unlimited only a biased snapshot can be presented Differences can presented

In-Cell Western Kits I and II

Odyssey and Aerius Infrared Imaging Systems In-Cell Western Assay Kits I and II Published November, 2006. The most recent version of this protocol is posted at http://biosupport.licor.com/protocols.jsp

TECHNICAL BULLETIN. In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits

In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits Catalog Numbers APPA001 In Vitro Bacterial Split GFP "Fold 'n' Glow" Solubility Assay Kit (Green) APPA008 In Vitro Bacterial

Online Supplementary Information

Online Supplementary Information NLRP4 negatively regulates type I interferon signaling by targeting TBK1 for degradation via E3 ubiquitin ligase DTX4 Jun Cui 1,4,6,7, Yinyin Li 1,5,6,7, Liang Zhu 1, Dan

SUPPLEMENTAL MATERIAL

SUPPLEMENTAL MATERIAL Materials and Methods Primers for ChIP/qPCR (Fig. 3): CG7939 (RpL32) Rp49+10F Rp49+110R Rp49+241F Rp49+341R Rp49+549F Rp49+613R TCTGGTTTCCGGCAAGGTATGT GCAGTTCAACTCGAAACCGCCAAA ATACTGCCCAAGAAGCTAGCCCAA

Supplementary material

Supplementary material Tracking mesenchymal stem cell contributions to regeneration in an immunocompetent cartilage regeneration model Daniela Zwolanek, María Satué, Verena Proell, Josè R. Godoy, Kathrin

Western-GUARANTEED Antibody Service FAQ

Western-GUARANTEED Antibody Service FAQ Content Q 1: When do I need a Western GUARANTEED Peptide Antibody Package?...2 Q 2: Can GenScript provide a Western blot guaranteed antibody?...2 Q 3: Does GenScript

This article was originally published in a journal published by Elsevier, and the attached copy is provided by Elsevier for the author s benefit and for the benefit of the author s institution, for non-commercial

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6

Pheromone-Induced Degradation of Ste12 Contributes to Signal Attenuation and the Specificity of Developmental Fate

EUKARYOTIC CELL, Dec. 2006, p. 2147 2160 Vol. 5, No. 12 1535-9778/06/$08.00 0 doi:10.1128/ec.00270-06 Copyright 2006, American Society for Microbiology. All Rights Reserved. Pheromone-Induced Degradation

Gene Sequence Fragment size ΔEGFR F 5' GGGCTCTGGAGGAAAAGAAAG GT 3' 116 bp R 5' CTTCTTACACTTGCGGACGC 3'

Supplementary Table 1: Real-time PCR primer sequences for ΔEGFR, wtegfr, IL-6, LIF and GAPDH. Gene Sequence Fragment size ΔEGFR F 5' GGGCTCTGGAGGAAAAGAAAG GT 3' 116 bp R 5' CTTCTTACACTTGCGGACGC 3' wtegfr

Supplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse

Supplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse tail DNA. Primers were designed to detect Gna13-WT/f (~400bp/470bp)

Supplemental Information. Hsp90 Regulates Nongenetic Variation. in Response to Environmental Stress

Molecular Cell, Volume 50 Supplemental Information Hsp90 Regulates Nongenetic Variation in Response to Environmental Stress Yu-Ying Hsieh, Po-Hsiang Hung, and Jun-Yi Leu Figure S1. Low Hsp90 induces morphological

Supplementary Figure Legend

Supplementary Figure Legend Supplementary Figure S1. Effects of MMP-1 silencing on HEp3-hi/diss cell proliferation in 2D and 3D culture conditions. (A) Downregulation of MMP-1 expression in HEp3-hi/diss

mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet

Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet Details

TightRegulation, Modulation, and High-Level Expression byvectors ContainingtheArabinose Promoter

TightRegulation, Modulation, and High-Level Expression byvectors ContainingtheArabinose Promoter L M Guzman et al. (1995) Journal of Bacteriology 177: 4121-4130 Outline 1. Introduction 2. Objective 3.

Interactions of Nucleotide Release Factor Dss4p with Sec4p in the Post-Golgi Secretory Pathway of Yeast*

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 272, No. 29, Issue of July 18, pp. 18281 18289, 1997 1997 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Interactions of

Supplemental Information. Boundary Formation through a Direct. Threshold-Based Readout. of Mobile Small RNA Gradients

Developmental Cell, Volume 43 Supplemental Information Boundary Formation through a Direct Threshold-Based Readout of Mobile Small RNA Gradients Damianos S. Skopelitis, Anna H. Benkovics, Aman Y. Husbands,

MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr.

MIT Department of Biology 7.01: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel iv) Would Xba I be useful for cloning? Why or why not?

Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination.

Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination. Seeds of Col-0 were harvested from plants grown at 16 C, stored for 2 months, imbibed for indicated

Daughter-cell-specific modulation of nuclear pore complexes controls cell cycle entry during asymmetric division

SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0056-9 In the format provided by the authors and unedited. Daughter-cell-specific modulation of nuclear pore complexes controls cell

Susheela Y. Carroll, Peter C. Stirling, Helen E.M. Stimpson, Esther Gießelmann, Manfred J. Schmitt, and David G. Drubin

Developmental Cell 17 Supplemental Data A Yeast Killer Toxin Screen Provides Insights into A/B Toxin Entry, Trafficking, and Killing Mechanisms Susheela Y. Carroll, Peter C. Stirling, Helen E.M. Stimpson,

12 Interaction of Genes

12 Interaction of Genes Yeast genetics has been particularly amenable for identifying and characterizing gene products that directly or indirectly interact with each other, especially when two mutations

Supplemental Information. Mitophagy Controls the Activities. of Tumor Suppressor p53. to Regulate Hepatic Cancer Stem Cells

Molecular Cell, Volume 68 Supplemental Information Mitophagy Controls the Activities of Tumor Suppressor to Regulate Hepatic Cancer Stem Cells Kai Liu, Jiyoung Lee, Ja Yeon Kim, Linya Wang, Yongjun Tian,