Supporting Information
|
|
|
- Georgia Turner
- 5 years ago
- Views:
Transcription
1 Supporting Information Fujii et al /pnas A Human Cen chromosome 4q ART3 NUP54 SCARB2 FAM47E CCDC8 Tel B Bac clones RP11-54D17 RP11-628A4 Exon PCR region a b c d a b c d (Size bp) non- RD non- RD non- RD non- RD 2,000 1, Fig. S1. Generation of transgenic () mice expressing human scavenger receptor class B, member 2 (hscarb2). (A) Schematic diagram of bacterial artificial chromosome (BAC) clones containing the hscarb2 gene used to produce the mice. The open and closed circles show the centromere (Cen) and telomere (Tel) of human chromosome 4, respectively. The white arrows indicate the genes located upstream and downstream of the SCARB2 gene (black arrow). The cloned region in each BAC construct is shown as a black line. (Scale bar, 100 kb.) (B) PCR genotyping of the hscarb2- mouse. The diagram shows the structure of the hscarb2 gene, which consists of 12 exons. The arrowheads indicate the primer sets used for genotype analysis. The results show PCR genotyping for hscarb2-10 animals. 1of8
2 A rabbit goat B Human non- Intestine Spleen Kidney Liver Lung Purkinje Thalamus Hippocampus Cerebral cortex Fig. S2. Immunohistochemical analysis of hscarb2 expression in human and mouse tissues. (A) The human cerebral cortex sample was stained with rabbit anti-human SCARB2 antibody (SIGMA: Left) or goat anti-human SCARB2 antibody (R&D: Right) and counterstained with hematoxylin. (B) Immunohistochemical analysis of hscarb2 expression in human and and non- mouse tissues. The cerebral cortex, hippocampus, thalamus, Purkinje layer, lung, liver, kidney, spleen, and intestine tissues were stained with rabbit anti-human SCARB2 antibody and counterstained with hematoxylin. (Scale bars, 50 and 100 μm in human and mouse tissue images, respectively.) 2of8
3 Cerebellar nucleus Intestine Spinal cord anterior horn Medulla oblongata Pons Cerebral cortex Spleen Kidney Liver Lung Fig. S3. Immunohistochemical analysis of hscarb2 expression in 16 and 22 mouse tissues. The cerebral cortex, pons, medulla oblongata, spinal cord anterior horn, cerebellar nucleus, lung, liver, kidney, spleen, and intestine tissues of 16 and 22 mice were stained with rabbit anti-human SCARB2 antibody and counterstained with hematoxylin. 3of8
4 A B 6-week-old 10-week-old 14-week-old Days post-inoculation C 3-week-old D age (week-old) Days post-inoculation no clinical sign ataxia Days post-inoculation Fig. S4. Neurological signs observed in hscarb2- mice. (A) A 3-wk-old hscarb2-10 mouse inoculated intracerebrally (i.c.) with the enterovirus 71 (EV71) Isehara strain at TCID 50 is shown. The arrowhead indicates the paralyzed left hindlimb. (B) hscarb2-10 mice at the indicated ages were infected i.c. with EV71 Isehara strain at TCID 50. Mice were observed daily for up to 2 wk for clinical signs. (C and D) hscarb2-16, 22, and 49 mice of the indicated age were infected with the EV71 Isehara strain at TCID 50 by the indicated inoculation route. Mice were observed daily for clinical signs for up to 2 wk. 4of8
5 A Brain Cerebral cortex 2.Thalamus 3.Pons * 4.Medulla 5.Cerebellar nuclei * 6. Purkinje layer * Lumbar spinal cord B C Oral mucosa Limbs non- non- Fig. S5. Sites of viral replication in hscarb2-10 mice. (A) Histopathological changes and viral antigens in the CNS of 3-wk-old mice inoculated i.v. with the EV71 Isehara strain (shown in Table 1 and Table S2). The brains and spinal cords are shown in low-magnification sagittal and coronal sections, respectively (Left, H&E staining; Right, immunohistochemistry). The numbers indicate the parts of the brain shown at higher magnification below (Upper, H&E staining; Lower, immunohistochemistry). The images of the pons, medulla, and cerebellar nuclei are the same as those shown in Fig. 2B. The squares correspond to the areas in the lumbar spinal cord that are shown at higher magnification (Fig. 2B). Open arrowheads, closed arrowheads, and asterisks indicate degenerated neurons, neuronophagia, and gliosis, respectively. (B) Histopathological changes and viral antigen expression in the spinal cord of hscarb2-16 (17 wk old), hscarb2-22 (18 wk old), and hscarb2-49 ( wk old) mice inoculated i.c. with the EV71 Isehara strain at TCID 50. (C) Histopathology of the epithelium in neonatal hscarb2-10 or non- mice after s.c. inoculation with the Isehara strain at TCID 50. A number of squamous epithelium cells in terminal regions of the oral mucosa (Left) and the limbs (Right) of hscarb2- mice were positive for the EV71 antigen, whereas those in non- mice did not exhibit EV71 antigen positivity (Lower). There was no inflammation in these sites (Upper). 5of8
6 Table S1. Position and sequences of primers for PCR genotyping Name of primer set Primer name Region Sequence Length of PCR product (bp) a hscarb2-int1-f Intron 1 5 -AGCTCTTCTTGCGTCCCTGT hscarb2-int1-r 5 -GCTCTCCAGCCCAATCATCT-3 b hscarb2-ex2-f Exon 2 5 -AGGAGACTGCAGTTGAATGC hscarb2-ex2-r 5 -AGTCTGCCAACTCAGGAGGA-3 c hscarb2-ex6-f Exon 6 5 -CTGTGGATAGACAGCTCCAG hscarb2-ex6-r 5 -AGTTGATGCTTGACAGAGCA-3 d hscarb2-ex11-f Exon TAACAGGAGGACATTCCCAA hscarb2-ex11-r 5 -GTTAACTCCCAGGGGATACA-3 6of8
7 Table S2. Viral antigen and inflammation in the CNS of mice Spinal cord Ganglion Animal Route Dose log10 TCID50 Clinical sign Killed (day p.i.) Cerebral cortex Hippocampus Cerebellum Brainstem Thalamus Hypothalamus Pons Midbrain Medulla Cervical cord Lumbar cord Trigeminal ganglion Dorsal root ganglion Skin Skeletal muscle Others i.c. 5 Day 7 ataxia 7 / * +/++ +/++ w/++ +/++ +/++ +/++ +/++ w/++ +/+ +/ +/++ / / / i.c. 5 Day 10 ataxia 10 /+ /+ /+ /+ /+ /+ /+ /+ w/+ +/++ +/ +/+ / / / i.c. 3 Day w/+ +/+ /++ +/++ +/++ w/++ +/++ w/++ w/++ +/++ w/+ +/++ / / / i.c. 3 Day 9 ataxia 9 /+ /+ w/++ /w +/+ +/++ +/+ +/++ +/++ +/++ /+ /+ / / / i.v. 6 Day /+ / ++/+ ++/+ ++/+ ++/+ ++/++ ++/++ ++/++ ++/++ +/+ ++/++ / / / i.v. 6 Day 5 5 +/+ / ++/+ ++/+ ++/+ ++/+ ++/+ ++/+ ++/+ ++/++ ++/+ ++/+ / / / Non- i.v. 4 Day 9 i.v. 4 Day 5 i.p. 6 Day 5 9 +/ / +/+ +/w +/w +/+ +/+ +/+ +/+ +/+ +/+ +/+ / / / 5 +/ / +/+ +/+ +/+ +/+ +/+ +/+ +/++ +/+ +/+ +/+ / / / 5 /+ / +/+ /+ +/+ +/+ +/+ +/+ +/+ +/+ +/+ +/+ / / / i.p. 6 Day 7 ataxia 7 +/+ +/ +/+ +/+ +/+ +/+ +/+ +/+ +/+ +/+ +/+ +/+ / / / i.p. 4 Day 8 8 / / +/+ +/+ +/+ +/+ +/+ +/+ +/+ +/+ / +/+ / / / i.p. 4 Day 9 9 +/ / +/+ +/+ +/+ +/+ +/+ +/+ +/+ +/+ /+ +/+ / / / i.c. Mock / / / / / / / / / / / / / / / i.c. Mock / / / / / / / / / / / / / / / After killing the affected mice (i.c.: n = 11; i.v.: n = 13; i.p., n = 7), viral antigen and inflammation were observed. This table shows representative results. +, positive; w, weak positive;, negative; i.c., intracerebral; i.p., intraperitoneal; i.v., intravenous. *Viral antigen/inflammation. Heart, lung, kidney, spleen, pancreas, intestine and lymph node. 7of8
8 Table S3. Detection of viral antigen positive cells in the neonatal mice Animal Animal no. Dose log10 TCID50 Killed (day p.i.) Clinical sign Cerebral cortex Hippocampus Cerebellum Brainstem Thalamus Hypothalamus Pons Midbrain Medulla Spinal cord Skin Oral mucosa Limbs Trunk Skeletal muscle Heart Lung Liver Kidney Spleen Lymph node Gastrointestinal tract Non Day Day Day Day Day Day Day Day Day Day Day Day Day w +w + + +w +w +w + + +w +w +w +w w +w +w w +w + +w w w w + After killing the affected mice, viral antigens were observed. +, positive; +w, a few cells;, negative. 8of8
DRG Pituitary Cerebral Cortex
Liver Spinal cord Pons Atg5 -/- Atg5 +/+ DRG Pituitary Cerebral Cortex WT KO Supplementary Figure S1 Ubiquitin-positive IBs accumulate in Atg5 -/- tissues. Atg5 -/- neonatal tissues were fixed and decalcified.
SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES
SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Generation of inducible BICD2 knock-out mice. A) The mouse BICD2 locus and gene targeting constructs. To generate an inducible Bicd2
Mouse Embryo : 10mM Tris-HCl (ph8.0), 1mM EDTA. : One year from date of receipt under proper storage condition.
1st strand cdna Mouse Embryo 10.5 Product type Catalog No. Species Tissue type : 1st strand cdna : CSR-MDE-02 : Mouse : C57BL/6N CrlCr : Normal, Embryo (10.5-day) Tissue name : - Concentration Volume Size
Table S1. Primers used in the study
Table S1. Primers used in the study Primer name Application Sequence I1F16 Genotyping GGCAAGTGAGTGAGTGCCTA I1R11 Genotyping CCCACTCGTATTGACGCTCT V19 Genotyping GGGTCTCAAAGTCAGGGTCA D18Mit184-F Genotyping
Nature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 Ihh interacts preferentially with its upstream neighboring gene Nhej1. Genes are indicated by gray lines, and Ihh and Nhej1 are highlighted in blue. 4C seq performed in E14.5 limbs
Growth factor, augmenter of liver regeneration
Supplemental Table 1: Human and mouse PC1 sequence equivalencies Human Mouse Domain Clinical significance; Score* PolyPhen prediction; PSIC score difference C210G C210G WSC Highly likely pathogenic; 15
Yellow Fever Vaccine (Live) is a freeze-dried preparation of the 17D strain of yellow fever virus grown in fertilised hen eggs.
YELLOW FEVER VACCINE Yellow Fever Vaccine (Live) is a freeze-dried preparation of the 17D strain of yellow fever virus grown in fertilised hen eggs. Production General provisions The production of vaccine
supplementary information
Figure S1 Distribution of heterokaryons in vermis and hemispheres of the cerebellum. Schematic dorsal view of an adult cerebellum with the vermis in the middle (red) flanked by the two hemispheres (grey).
Supporting Information
Supporting Information Balastik et al. 10.1073/pnas.0802261105 SI Text TRIM2 GT Mice PCR Genotyping. PCR genotyping was based on the known chromosomal localization of Trim2 gene on mouse chromosome 3,
Supplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/8/347/347ra94/d Supplementary Materials for n mirn-mediated therapy for S6 blocks IRES-driven translation of the N second cistron Yu Miyazaki, Xiaofei
Supplementary information
Supplementary information Rho kinase inhibitor enables cell-based therapy for corneal endothelial dysfunction Naoki Okumura 1, Yuji Sakamoto 2, Keita Fujii 1, Junji Kitano 1, Shinichiro Nakano 1, Yuki
Supplementary Figure 1. Phenotype and genotype of cultured and transplanted S1 KCST (A) Brightfield and mcherry fluorescence images of the spheres
Supplementary Figure 1. Phenotype and genotype of cultured and transplanted S1 KCST (A) Brightfield and mcherry fluorescence images of the spheres generated from the CD133-positive cells infected with
SUPPLEMENTARY INFORMATION
doi:1.138/nature9464 C 3 K 3 -d 8 C 3 PK-d 7 MK-4-d 12 C 3 C 3 MK-4-d 7 C 3 Supplementary Figure 1 Chemical structures of PK-d 7, MK-4-d 12, K 3 -d 8 and MK-4-d 7. WWW NATURE.CM/NATURE 1 a Relative ratio
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature12474 Supplementary Figure 1 Analysis of mtdna mutation loads in different types of mtdna mutator mice. a, PCR, cloning, and sequencing analysis of mtdna mutations
SUPPLEMENTARY INFORMATION
doi: 1.138/nature875 a promoter firefly luciferase CNS b Supplementary Figure 1. Dual luciferase assays on enhancer activity of CNS1, 2, and 3. a. promoter sequence was inserted upstream of firefly luciferase
Revised: RG-RV2 by Fukuhara et al.
Supplemental Figure 1 The generation of Spns2 conditional knockout mice. (A) Schematic representation of the wild type Spns2 locus (Spns2 + ), the targeted allele, the floxed allele (Spns2 f ) and the
F4/80, CD11b, Gr-1, NK1.1, CD3, CD4, CD8 and CD19. A-antigen was detected with FITCconjugated
SDC MATERIALS AND METHODS Flow Cytometric Detection of A-Antigen Expression Single cell suspensions were prepared from bone marrow, lymph node and spleen. Peripheral blood was obtained and erythrocytes
Supplementary Figure 1
Supplementary Figure 1 Ex2 promotor region Cre IRES cherry pa Ex4 Ex5 Ex1 untranslated Ex3 Ex5 untranslated EYFP pa Rosa26 STOP loxp loxp Cre recombinase EYFP pa Rosa26 loxp 1 kb Interleukin-9 fate reporter
Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2.
Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2. Construct name ISG12b2 (No tag) HA-ISG12b2 (N-HA) ISG12b2-HA (C-HA; FL-HA) 94-283-HA (FL-GFP) 93-GFP
An assay to image neuronal microtubule dynamics in mice
SUPPLEMENTARY INFORMATION An assay to image neuronal microtubule dynamics in mice Tatjana Kleele 1, Petar Marinković 2,3, Philip R. Williams 1, Sina Stern 4, Emily E. Weigand 5, Peter Engerer 1, Ronald
Supplementary Figure S1. Alterations in Fzr1( / );Nestin-Cre brains. (a) P10 Cdh1-deficient brains display low levels of Myelin basic protein (MBP)
Supplementary Figure S1. Alterations in Fzr1( / );Nestin-Cre brains. (a) P10 Cdh1-deficient brains display low levels of Myelin basic protein (MBP) in the cortex (area 1 as defined in Fig. 2a), and corpus
Robust and Durable Target Silencing in the CNS with sirna Conjugates
Robust and Durable Target Silencing in the CNS with sirna Conjugates Stuart Milstein October 2, 2018 1 2018 Alnylam Pharmaceuticals, Inc. Alnylam Forward Looking Statements This presentation contains forward-looking
Supplemental Material TARGETING THE HUMAN MUC1-C ONCOPROTEIN WITH AN ANTIBODY-DRUG CONJUGATE. Supplemental Tables S1 S3. and
Supplemental Material TARGETING THE HUMAN MUC1-C ONCOPROTEIN WITH AN ANTIBODY-DRUG CONJUGATE Supplemental Tables S1 S3 and Supplemental Figures S1 S10 Supplemental Table S1. PK Parameters for MAb-3D1-MMAE
Temporary and Permanent Modifications to a Single Strain of Mouse Scrapie on Transmission to Rats and Hamsters
J. gen. Virol. (1987), 68, 1875-1881. Printed in Great Britain 1875 Key words: scrapie/pathogenesis/mutation Temporary and Permanent Modifications to a Single Strain of Mouse Scrapie on Transmission to
Mapping PrP Sc Propagation in Experimental and Natural Scrapie in Sheep with Different PrP Genotypes
Vet Pathol 42:258 274 (2005) Mapping PrP Sc Propagation in Experimental and Natural Scrapie in Sheep with Different PrP Genotypes C. ERSDAL, M. J. ULVUND, A. ESPENES, S. L. BENESTAD, P. SARRADIN, AND T.
SUPPLEMENTARY INFORMATION
DOI:.38/ncb327 a b Sequence coverage (%) 4 3 2 IP: -GFP isoform IP: GFP IP: -GFP IP: GFP Sequence coverage (%) 4 3 2 IP: -GFP IP: GFP 33 52 58 isoform 2 33 49 47 IP: Control IP: Peptide Sequence Start
MegaMan Human Transcriptome Library
MegaMan Human Transcriptome Library INSTRUCTION MANUAL Catalog #790000 MegaMan Human Transcriptome Library (20 reactions) #790001 MegaMan Human Transcriptome Library (100 reactions) Revision A.01 For In
Isolation and Characterization of the Porcine Tissue Kallikrein Gene Family
Isolation and Characterization of the Porcine Tissue Kallikrein Gene Family S.C. Fernando, R.D. Geisert, B.A. Roe and U. DeSilva Story in Brief Kallikreins are members of a multigene family of serine proteases
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/3/4/e1602814/dc1 Supplementary Materials for CRISPR-Cpf1 correction of muscular dystrophy mutations in human cardiomyocytes and mice Yu Zhang, Chengzu Long, Hui
C57BL/6N Female. C57BL/6N Male. Prl2 WT Allele. Prl2 Targeted Allele **** **** WT Het KO PRL bp. 230 bp CNX. C57BL/6N Male 30.
A Prl Allele Prl Targeted Allele 631 bp 1 3 4 5 6 bp 1 SA β-geo pa 3 4 5 6 Het B Het 631 bp bp PRL CNX C 1 C57BL/6N Male (14) Het (7) (1) 1 C57BL/6N Female (19) Het (31) (1) % survival 5 % survival 5 ****
Department of Molecular and Structural Biology, University of Aarhus, Bldg. 130, DK- 8000/Y~rhus C, Denmark
Vol. 43, No. 4, November 17 BOCEMSTRY and MOLECULAR BOLOGY NTERNATONAL Poges 781-786 CARACTERSATON OF BOVNE STRUCTURE-SPECFC RECOGNTON PROTEN 1 (SSRP1) edna Peter Kresten Nielsen, Jesper aaning, and Lars
LRBA is Essential for Allogeneic Responses in Bone Marrow Transplantation
LRBA is Essential for Allogeneic Responses in Bone Marrow Transplantation Mi Young Park, 1# Raki Sudan, 1# Neetu Srivastava, 1 Sudha Neelam, 1 Christie Youngs, 1 Jia- Wang Wang, 4 Robert W. Engelman, 5,6,7
Banking Human Neural Stem Cells for Clinical Applications. Lisa Fox Director, Cell Process Development & Operations
Banking Human Neural Stem Cells for Clinical Applications Lisa Fox Director, Cell Process Development & Operations 7 th Annual Somatic Cell Therapy Symposium September 27, 2007 Stem Cells Inc. Approach
The genetic code of gene regulatory elements
The genetic code of gene regulatory elements Ivan Ovcharenko Computational Biology Branch National Center for Biotechnology Information National Institutes of Health October 23, 2008 Outline Gene deserts
SUPPLEMENTAL MATERIAL
SUPPLEMENTAL MATERIAL MATERIALS AND METHODS Generation of TSPOΔ/Δ murine embryonic fibroblasts Embryos were harvested from 13.5-day pregnant TSPOfl/fl mice. After dissection to eviscerate and remove the
Figure S Relative MUC4 transcript level* CD18/HPAF CD18/HPAF-Scr CD18/HPAF-siMUC4
Figure S1 Relative MUC4 transcript level* 1.4 1.2 1 0.8 0.6 0.4 0.2 0 CD18/HPAF CD18/HPAF-Scr CD18/HPAF-siMUC4 Figure S2 * * CD18/HPAF-Scr CD18/HPAF-siMUC4 CD18/HPAF-Scr CD18/HPAF-siMUC4 Figure S3 CD18/HPAF-Scr
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11094 Supplementary Figures Supplementary Figure 1: Analysis of GFP expression in P0 wild type and mutant ( E1-4) Fezf2-Gfp BAC transgenic mice. Epifluorescent images of sagittal forebrain
Two classes of silencing RNAs move between Caenorhabditis elegans tissues.
Two classes of silencing RNAs move between Caenorhabditis elegans tissues. Antony M Jose, Giancarlo A Garcia, and Craig P Hunter. Supplementary Figures, Figure Legends, and Tables. Supplementary Figure
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full//59/ra7/dc1 Supplementary Materials for Dok-7 ctivates the Muscle Receptor Kinase MuSK and Shapes Synapse Formation kane Inoue, Kiyoko Setoguchi, Yosuke Matsubara,
Cloning genes into animals. Transgenic animal carries foreign gene inserted into its genome.
Cloning genes into animals Transgenic animal carries foreign gene inserted into its genome. Transgenic goats Ch. 10 pg. 281 Produce human protein (drug) in milk Pharming Transgenic animals to produce human
International standards for rabies diagnosis more than the book
International standards for rabies diagnosis more than the book Changchun Tu (Ph.D & DVM) Email: changchun_tu@hotmail.com http://cvrirabies.bmi.ac.cn 1. Diagnostic Laboratory on Rabies and Wildlife Associated
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature06293 SUPPLEMENTARY INFORMATION a Testing the incompatibility of Lox2272 and LoxP Construct Expected Lox2272 promoter (CMV) c Testing the incompatibility of LoxN with Lox2272 and LoxP
Supplementary Figure 1. Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings.
Supplementary Figure 1 Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings. (left) Representative bright-field images of wild type (wt), heterozygous (het)
A Low salt diet. C Low salt diet + mf4-31c1 3. D High salt diet + mf4-31c1 3. B High salt diet
A Low salt diet GV [AU]:. [mmhg]: 0..... 09 9 7 B High salt diet GV [AU]:. [mmhg]: 7 8...0. 7.8 8.. 0 8 7 C Low salt diet + mf-c GV [AU]:. [mmhg]:.0.9 8.7.7. 7 8 0 D High salt diet + mf-c E Lymph capillary
Input. Pulldown GST. GST-Ahi1
A kd 250 150 100 75 50 37 25 -GST-Ahi1 +GST-Ahi1 kd 148 98 64 50 37 22 GST GST-Ahi1 C kd 250 148 98 64 50 Control Input Hap1A Hap1 Pulldown GST GST-Ahi1 Hap1A Hap1 Hap1A Hap1 Figure S1. (A) Ahi1 western
Supplementary Figure 1. Characterization of the POP2 transcriptional and post-transcriptional regulatory elements. (A) POP2 nucleotide sequence
1 5 6 7 8 9 10 11 1 1 1 Supplementary Figure 1. Characterization of the POP transcriptional and post-transcriptional regulatory elements. (A) POP nucleotide sequence depicting the consensus sequence for
Supporting Information
Supporting Information Alenina et al. 10.1073/pnas.0810793106 SI Materials and Methods In Vivo Brain Magnetic Resonance Imaging (MRI). In vivo brain MRI was performed in 6-month-old Tph2 / and control
Supplementary Information
Supplementary Information MicroRNA-212/132 family is required for epithelial stromal interactions necessary for mouse mammary gland development Ahmet Ucar, Vida Vafaizadeh, Hubertus Jarry, Jan Fiedler,
Improved adeno-associated virus (AAV) serotype 1 and 5 vectors for gene therapy
Improved adeno-associated virus (AAV) serotype 1 and 5 vectors for gene therapy Dwaipayan Sen 1, Balaji Balakrishnan 1, Nishanth Gabriel 1, Prachi Agrawal 2, Vaani Roshini 1, Alok Srivastava 1,2, Giridhara
Stem Cells & Neurological Disorders. Said Ismail Faculty of Medicine University of Jordan
Stem Cells & Neurological Disorders Said Ismail Faculty of Medicine University of Jordan Outline: - Introduction - Types & Potency of Stem Cells - Embryonic Stem Cells - Adult Stem Cells - ipscs -Tissue
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10772 Supplementary Figures: Supplementary Figure 1. Location of CNS1 within of the Foxp3 locus highlighting CNS1 and indicating transcription factor binding motifs downstream of TCR,
A population of Nestin expressing progenitors in the cerebellum exhibits increased tumorigenicity
A population of Nestin expressing progenitors in the cerebellum exhibits increased tumorigenicity Peng Li 1,2, Fang Du 1, Larra W. Yuelling 1, Tiffany Lin 3, Renata E. Muradimova 1, Rossella Tricarico
Supplementary Figure 1. Generation of B2M -/- ESCs. Nature Biotechnology: doi: /nbt.3860
Supplementary Figure 1 Generation of B2M -/- ESCs. (a) Maps of the B2M alleles in cells with the indicated B2M genotypes. Probes and restriction enzymes used in Southern blots are indicated (H, Hind III;
Primary mouse cortical cultures were derived from cortices of E15 wild-type and
Supplemental Data Cell Host & Microbe, Volume 5 Junctional Adhesion Molecule-A Is Required for Hematogenous Dissemination of Reovirus Annukka A.R. Antar, Jennifer L. Konopka, Jacquelyn A. Campbell, Rachel
Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
Role of the Lymphoreticular System in Prion Neuroinvasion from the Oral and Nasal Mucosa
JOURNAL OF VIROLOGY, July 2009, p. 6435 6445 Vol. 83, No. 13 0022-538X/09/$08.00 0 doi:10.1128/jvi.00018-09 Copyright 2009, American Society for Microbiology. All Rights Reserved. Role of the Lymphoreticular
Supplementary Information. Isl2b regulates anterior second heart field development in zebrafish
Supplementary Information Isl2b regulates anterior second heart field development in zebrafish Hagen R. Witzel 1, Sirisha Cheedipudi 1, Rui Gao 1, Didier Y.R. Stainier 2 and Gergana D. Dobreva 1,3* 1 Origin
Generation of App knock-in mice reveals deletion mutations protective against Alzheimer s. disease-like pathology. Nagata et al.
Generation of App knock-in mice reveals deletion mutations protective against Alzheimer s disease-like pathology Nagata et al. Supplementary Fig 1. Previous App knock-in model did not show Aβ accumulation
DIFFERENT BRAIN REGIONS ARE INFECTED WITH FUNGI IN ALZHEIMER S DISEASE
DIFFERENT BRAIN REGIONS ARE INFECTED WITH FUNGI IN ALZHEIMER S DISEASE Diana Pisa 1, Ruth Alonso 1, Alberto Rábano 2, Izaskun Rodal 2 and Luis Carrasco 1* 1 Centro de Biología Molecular Severo Ochoa. c/nicolás
bronchial epithelial cells (I). Bronchi are outlined with dashed line. Scale bars = 25 µm, if not
Supplemental Figure S1: ronchial epithelial cell polarity and integrity is maintained in bronchi. (A-E) Staining for selected markers of bronchial cell differentiation and intracellular compartments is
Pei et al. Supplementary Figure S1
Pei et al. Supplementary Figure S1 C H-CUL9: + + + + + Myc-ROC1: - - + + + U2OS/pcDN3 U2OS/H-CUL9 U2OS/ + H-CUL9 IP: -H -myc input -H -myc 1 2 3 4 5 H-CUL9 Myc-ROC1 -H -H -H -H H-CUL9: wt RR myc-roc1:
1. Which process decreases when the human body temperature decreases? D. Shivering (Total 1 mark) D. Liver (Total 1 mark)
1. Which process decreases when the human body temperature decreases? A. Blood flow to the internal organs B. Secretion of sweat C. Secretion of insulin D. Shivering 2. Which organ secretes enzymes that
Thomas Wollert, Bastian Pasche, Maike Rochon, Stefanie Deppenmeier, Joop van den
Cell, Volume 129 Supplemental Data Extending the Host Range of Listeria monocytogenes by Rational Protein Design Thomas Wollert, Bastian Pasche, Maike Rochon, Stefanie Deppenmeier, Joop van den Heuvel,
Supplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity.
Supplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity. (A) Amino acid alignment of HDA5, HDA15 and HDA18. The blue line
Nature Immunology: doi: /ni.3101
Supplementary Figure 1 Generation of Plvap / mice. (a) Schematic presentation of the targeting construct as well as the wild-type and targeted Plvap alleles]. PuroR, puromycin resistance. The location
TheraLin. Universal Tissue Fixative Enabling Molecular Pathology
TheraLin Universal Tissue Fixative Enabling Molecular Pathology TheraLin Universal Tissue Fixative Enabling Molecular Pathology Contents Page # TheraLin Universal Tissue Fixative 3 Introduction 5 Easy
Expectations for Biodistribution (BD) Assessments for Gene Therapy (GT) Products
Expectations for Biodistribution (BD) Assessments for Gene Therapy (GT) Products Approved by the IPRP Management Committee on 3 June 2018 12 April 2018 Table of Contents 1. Position Statement... 3 2. Executive
PIE1 ARP6 SWC6 KU70 ARP6 PIE1. HSA SNF2_N HELICc SANT. pie1-3 A1,A2 K1,K2 K1,K3 K3,LB2 A3, A4 A3,LB1 A1,A2 K1,K2 K1,K3. swc6-1 A3,A4.
A B N-terminal SWC2 H2A.Z SWC6 ARP6 PIE1 HSA SNF2_N HELICc SANT C pie1-3 D PIE1 ARP6 5 Kb A1 200 bp A3 A2 LB1 arp6-3 A4 E A1,A2 A3, A4 A3,LB1 K1,K2 K1,K3 K3,LB2 SWC6 swc6-1 A1,A2 A3,A4 K1,K2 K1,K3 100
Nature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 Sox2 localizes in neutrophils of mouse spleen. (a) Microscopy analysis of Sox2 and MPO in wild-type mouse spleen. Nucl, nucleus. (b) Immunohistochemistry staining of Sox2 and MPO
Supplementary Information
Supplementary Information Supplementary Figure 1. ZBTB20 expression in the developing DRG. ZBTB20 expression in the developing DRG was detected by immunohistochemistry using anti-zbtb20 antibody 9A10 on
Supplemental Figure 1.
Supplemental Data. Charron et al. Dynamic landscapes of four histone modifications during de-etiolation in Arabidopsis. Plant Cell (2009). 10.1105/tpc.109.066845 Supplemental Figure 1. Immunodetection
SUPPLEMENTARY INFORMATION
6 Relative levels of ma3 RNA 5 4 3 2 1 LN MG SG PG Spl Thy ma3 ß actin Lymph node Mammary gland Prostate gland Salivary gland Spleen Thymus MMTV target tissues Fig. S1: MMTV target tissues express ma3.
Contract Research Offering
Contract Research Offering Helping you understand the therapeutic in vivo effects of your Alzheimer drug candidates the partner you can trust to help you understand as fast as possible the therapeutic
(a) Scheme depicting the strategy used to generate the ko and conditional alleles. (b) RT-PCR for
Supplementary Figure 1 Generation of Diaph3 ko mice. (a) Scheme depicting the strategy used to generate the ko and conditional alleles. (b) RT-PCR for different regions of Diaph3 mrna from WT, heterozygote
Supporting Information
Supporting Information Chakrabarty et al. 10.1073/pnas.1018001108 SI Materials and Methods Cell Lines. All cell lines were purchased from the American Type Culture Collection. Media and FBS were purchased
Chapter 8 Cell Diversity
Chapter 8 Cell Diversity Mr. C. Biology 1 Future? Chapter 8 Cell Diversity Cells, Tissues, Organs and Systems Cells have different shapes because they have different jobs to do. A nerve cell is very different
Supporting Information
Supporting Information Tomura et al. 1.173/pnas.8227815 WT CFSE Con A stimulation Before After 2 3 1 CFSE Kaede- Tg No photoconversion Photoconversion Kaede Red Fig. S1. Dilution of photoconverted Kaede
Regulation of axonal and dendritic growth by the extracellular calcium-sensing
Regulation of axonal and dendritic growth by the extracellular calcium-sensing receptor (CaSR). Thomas N. Vizard, Gerard W. O Keeffe, Humberto Gutierrez, Claudine H. Kos, Daniela Riccardi, Alun M. Davies
Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice
Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice Supplementary Material Supplementary Methods Materials Spironolactone, aldosterone and β-glycerophosphate were
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Wang et al., http://www.jcb.org/cgi/content/full/jcb.201405026/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Generation and characterization of unc-40 alleles. (A and
Supplementary Figures
Supplementary Figures Fig. S1. Specificity of perilipin antibody in SAT compared to various organs. (A) Images of SAT at E18.5 stained with perilipin and CD31 antibody. Scale bars: 100 μm. SAT stained
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified by primers used for mrna expression analysis. Gray
Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various
Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various GST-tagged N-terminal truncated APP fragments including GST-APP full-length (FL), APP (123-695), APP (189-695), or
amplify the conditional allele (2-lox) and recombined allele (1-lox) following tamoxifen
Supplementary data Supplementary Table 1. Real-time PCR primer sequences Supplementary Fig. 1. (A) Genomic map of the Vhl (2-lox) conditional allele. Numbered boxes represent exon 1, which is targeted
Supplementary Information
Supplementary Information MED18 interaction with distinct transcription factors regulates plant immunity, flowering time and responses to hormones Supplementary Figure 1. Diagram showing T-DNA insertion
Supplementary Figure 1.
Supplementary Figure 1. (A) UCSC Genome Browser view of region immediately downstream of the NEUROG3 start codon. All candidate grna target sites which meet the G(N 19 )NGG constraint are aligned to illustrate
Supplementary Methods
Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed
Histone H3 Methylation Antibody Panel Pack I - Active Genes Base Catalog # C Component Size Shipping Temperature
Histone H3 Methylation Antibody Panel Pack I - Active Genes Base Catalog # PACK CONTENTS Component Size Shipping Temperature Upon Receipt Checklist 3K4D Histone H3K4me2 (H3K4 Dimethyl) Polyclonal Antibody
Supplemental Figure S1. PGRN Binding to Sortilin.
1 Neuron, volume 68 Supplemental Data Sortilin-Mediated Endocytosis Determines Levels of the Frontotemporal Dementia Protein, Progranulin Fenghua Hu, Thihan Padukkavidana, Christian B. Vægter, Owen A.
To generate the luciferase fusion to the human 3 UTRs, we sub-cloned the 3 UTR
Plasmids To generate the luciferase fusion to the human 3 UTRs, we sub-cloned the 3 UTR fragments downstream of firefly luciferase (luc) in pgl3 control (Promega). pgl3- CDK6 was made by amplifying a 2,886
Expanded View Figures
Vasco Meneghini et al Effective lentiviral GT in NHP brains EMO Molecular Medicine Expanded View Figures Figure EV1. VN and GFP distribution in LV.GFPinjected NHPs. Vector copy number (VN) cartography
Supplementary Figures and supplementary figure legends
Supplementary Figures and supplementary figure legends Figure S1. Effect of different percentage of FGF signaling knockdown on TGF signaling and EndMT marker gene expression. HUVECs were subjected to different
Supporting Information
Supporting Information Zorde Khvalevsky et al..73/pnas.337.9 mm sikrsg Molecule PG Matrix ± mm right sc left retained in OER E T= days T= days (iver) T= days (PS) Fig. S. OER characteristics. () iagram
Supplemental figure 1
Supplemental figure 1 0.3 Copy number ratio relative to beta actin 0.25 0.2 0.15 0.1 0.05 0 Series1 Series2 Series3 0 1 PC3 BP 2 DU145 BP 3 PC3 CMV 4 DU145 CMV Supplemental figure 1. qpcr to quantify the
Unrestricted Hepatocyte Transduction with Adeno-Associated Virus Serotype 8 Vectors in Mice
JOURNAL OF VIROLOGY, Jan. 2005, p. 214 224 Vol. 79, No. 1 0022-538X/05/$08.00 0 doi:10.1128/jvi.79.1.214 224.2005 Copyright 2005, American Society for Microbiology. All Rights Reserved. Unrestricted Hepatocyte
PETER PAZMANY CATHOLIC UNIVERSITY Consortium members SEMMELWEIS UNIVERSITY, DIALOG CAMPUS PUBLISHER
PETER PAZMANY CATHOLIC UNIVERSITY SEMMELWEIS UNIVERSITY Development of Complex Curricula for Molecular Bionics and Infobionics Programs within a consortial* framework** Consortium leader PETER PAZMANY
Accelerating skin wound healing by M-CSF through generating SSEA-1 and -3 stem cells. in the injured sites
Accelerating skin wound healing by M-CSF through generating SSEA-1 and -3 stem cells in the injured sites Yunyuan Li, Reza Baradar Jalili, Aziz Ghahary Department of Surgery, University of British Columbia,
Supplementary Figure 1. Effect of FRC-specific ablation of Myd88 on PP and mln organization.
Supplementary Figure 1 Effect of FRC-specific ablation of Myd88 on PP and mln organization. (a) PP numbers in 8 10 week old Cre-negative littermate (Ctrl) and Myd88-cKO mice (n = 11 mice; each dot represents
MicroRNAs Modulate Hematopoietic Lineage Differentiation
Chen et al., page 1 MicroRNAs Modulate Hematopoietic Lineage Differentiation Chang-Zheng Chen, Ling Li, Harvey F. Lodish, David. Bartel Supplemental Online Material Methods Cell isolation Murine bone marrow
Product Datasheet. MBP Antibody NBP Unit Size: 0.1 ml. Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles.
Product Datasheet MBP Antibody NBP2-33555 Unit Size: 0.1 ml Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles. Protocols, Publications, Related Products, Reviews, Research