Organelle Atlas APPENDIX TO CHAPTER 4 4A.1

Size: px
Start display at page:

Download "Organelle Atlas APPENDIX TO CHAPTER 4 4A.1"

Transcription

1 APPENDIX TO CHAPTER 4 This atlas contains images of cellular organelles visualized using a wide variety of reagents and techniques and demonstrates the diversity of methods for exploring the cell. The atlas consists of the figures listed in Table 4A.1. Table 4A.1 Figures in a Figure Organelle(s)/structure(s) Visualized using: Fig. 4A.1 Mitotic spindle and chromosomes γ-tubulin-gfp, anti-β-tubulin antibody, Hoechst Fig. 4A.2 DNA and β-tubulin Hoechst 33342, anti-β-tubulin antibody Fig. 4A.3 Nuclear pore complexes POM121-GFP Fig. 4A.4 Nuclear envelope Lamin B receptor GFP Fig. 4A.5 Myosin, actin stress fibers Anti-myosin antibody, rhodamineconjugated phalloidin Fig. 4A.6 Focal adhesions Anti-vinculin antibody Fig. 4A.7 Intermediate filaments Anti-vimentin antibody Fig. 4A.8 Microtubules and Golgi complex Anti-tubulin and antigalactosyltransferase antibodies Fig. 4A.9 Endoplasmic reticulum DiOC 6 Fig. 4A.10 Endoplasmic reticulum Anti-ER-resident protein antibodies Fig. 4A.11 Lysosomes Rhodamine-ovalbumin Fig. 4A.12 Lysosomes Anti-LEP100 antibodies Fig. 4A.13 Lysosomes, endosomes Rhodamine-conjugated wheat germ agglutinin Fig. 4A.14 Golgi complex Anti mannosidase II antibodies, brefeldin A, nocodazole Fig. 4A.15 Mitochondria TMRE, calcium green AM Fig. 4A.16 Endosomes Anti-transferrin antibodies Fig. 4A.17 Trans-Golgi network Anti-TGN38 antibodies Fig. 4A.18 Trans-Golgi network, endosomes Monoclonal anti-ap1 antibodies (100/3) Fig. 4A.19 Trans-Golgi network, endosomes Anti-TGN46 and anti-ap3 antibodies Fig. 4A.20 Plasma membrane clathrin-coated pits, clathrin-coated vesicles Anti-AP2 antibodies Fig. 4A.21 Plasma membrane clathrin-coated pits, trans-golgi network, endosomes, clathrin-coated vesicles Fibronectin (an extracellular matrix protein), nuclei Monoclonal anti-clathrin antibodies (X22) Fig. 4A.22 Rhodamine-conjugated anti-fibronectin antibody, DAPI a Abbreviations: DAPI, 4,6-diamidino-2-phenylindole; DiOC6, dicarbocyanine dye; GFP, green fluorescent protein; TGN, trans-golgi network; TMRE, tetramethylrhodamine ethylester. (1998) 4A.1-4A.12 Copyright 1998 by John Wiley & Sons, Inc. 4A.1

2 Figure 4A.1 Mitotic NRK cell in metaphase. Red, mouse anti-β-tubulin antibody; green, γ-tubulin-gfp; blue, Hoechst Figure provided by Jan Ellenberg, NICHD/NIH. Figure 4A.2 Distribution of DNA (Hoechst 33342, blue) and β- tubulin (anti-β-tubulin antibody, red) in interphase NRK cells. Figure provided by Jan Ellenberg, NICHD/NIH. 4A.2

3 Figure 4A.3 Nuclear pore complexes in PTK 2 cell stained with POM121 tagged with green fluorescent protein (GFP). Figure provided by Jan Ellenberg, NICHD/NIH. 4A.3

4 Figure 4A.4 Nuclear envelope in COS cell labeled with lamin B receptor tagged with green fluorescent protein (GFP). Figure provided by Jan Ellenberg, NICHD/NIH. 4A.4

5 Figure 4A.5 (A) Myosin localization in formaldehyde-fixed NRK cell labeled with mouse antimyosin antibodies. (B) Stress fibers in the same formaldehyde-fixed NRK cell labeled with rhodamine-conjugated phalloidin. Figure provided by Julie Donaldson, NHBLI/NIH. Figure 4A.6 Focal adhesions in formaldehyde-fixed NRK cell labeled with mouse anti-vinculin antibodies. Figure provided by Julie Donaldson, NHBLI/NIH. Figure 4A.8 Microtubules and Golgi complex in HeLa cell stained with anti-tubulin antibodies (green) and antibodies to the Golgi complex enzyme galactosyl transferase (yellow-orange). Figure provided by Jennifer Lippincott-Schwartz, NICHD/NIH. Figure 4A.7 Intermediate filaments in formaldehyde-fixed NRK cell labeled with rabbit anti-vimentin antibodies. Figure provided by Julie Donaldson, NHBLI/NIH. 4A.5

6 Figure 4A.9 Endoplasmic reticulum (ER) in frog skin cell labeled with DiOC 6. Figure provided by Mark Terasaki, University of Connecticut Health Center. 4A.6

7 Figure 4A.10 Endoplasmic reticulum (ER) in NRK cell labeled with antibodies to ER-resident proteins (from D. Louvard). Figure provided by Jennifer Lippincott-Schwartz, NICHD/NIH. Figure 4A.11 Lysosomes in chicken fibroblast labeled with rhodamine-conjugated ovalbumin taken up by the cells over 4 hr. Figure provided by Jennitfer Lippincott- Schwartz, NICHD/NIH. Figure 4A.12 Lysosomes in chicken fibroblast labeled with antibodies to LEP100, a 100-kDa lysosomal membrane protein. Figure provided by Jennifer Lippincott- Schwartz, NICHD/NIH. 4A.7

8 Figure 4A.13 HeLa cell stained with rhodamine-conjugated wheat germ agglutinin (WGA), which binds to sialic acid and N-acetylglucosaminyl residues on glycoproteins. Glycoproteins enriched in these residues are found in lysosomes and endosomes. Figure provided by Jennifer Lippincott-Schwartz, NICHD/NIH. Figure 4A.14 Distribution of antibodies to the Golgi enzyme mannosidase II in fixed and permeabilized HeLa cells (A) untreated; (B) treated with brefeldin A; or (C) treated with nocodazole, which depolymerizes microtubules. Figure provided by Jennifer Lippincott-Schwartz, NICHD/NIH. 4A.8

9 Figure 4A.15 Neuroblastoma cell stained with TMRE to label mitochondria (orange) and with calcium green AM to monitor calcium. Figure provided by Ion Moran, University of Connecticut Health Center. Figure 4A.17 Trans-Golgi network (TGN) in NRK cell labeled with antibodies to TGN-38, a membrane protein. Figure provided by Jennifer Lippincott-Schwartz, NICHD/NIH. Figure 4A.16 Distribution of endosomes in NRK cell incubated in the presence of iron-saturated transferrin and labeled with fluorescent antibodies to transferrin. Figure provided by Jennifer Lippincott-Schwartz, NICHD/NIH. 4A.9

10 Figure 4A.18 Distribution of the adaptor complex AP1 in human fibroblasts stained with monoclonal 100/3 in the trans-golgi network and endosomal structures. Figure provided by Juan Bonifacino, NICHD/NIH. Figure 4A.19 Distribution of the trans-golgi network and the adaptor complex AP3 in human fibroblasts labeled with antibodies to TGN46 (green) and AP3 (red). Figure provided by Juan Bonifacino, NICHD/NIH. Figure 4A.20 Localization of adaptor complex AP2 to plasma membrane clathrin-coated pits and clathrin-coated vesicles in HeLa cells labeled with anti-ap2 antibodies. Figure provided by Juan Bonifacino, NICHD/NIH. 4A.10

11 Figure 4A.21 Clathrin distribution in human fibroblasts labeled with monoclonal antibody X22 (Affinity Bioreagents). Figure provided by Juan Bonifacino, NICHD/NIH. 4A.11

12 Figure 4A.22 Distribution of the extracellular matrix protein fibronectin in cells labeled with rhodamineconjugated antibody to fibronectin (red) and DAPI (blue). Figure provided by Kenneth Yamada, NIDR/NIH. 4A.12

Introduction to Botany. Lecture 11

Introduction to Botany. Lecture 11 Introduction to Botany. Lecture 11 Alexey Shipunov Minot State University September 26, 2014 Shipunov (MSU) Introduction to Botany. Lecture 11 September 26, 2014 1 / 21 Outline 1 Questions and answers

More information

Fig. S1. Endocytosis of extracellular cargo does not depend on dia. (A) To visualize endocytosis, fluorescently labelled wheat germ agglutinin

Fig. S1. Endocytosis of extracellular cargo does not depend on dia. (A) To visualize endocytosis, fluorescently labelled wheat germ agglutinin Fig. S1. Endocytosis of extracellular cargo does not depend on dia. (A) To visualize endocytosis, fluorescently labelled wheat germ agglutinin (WGA-Alexa555) was injected into the extracellular perivitteline

More information

CHAPTER 16 THE CYTOSKELETON

CHAPTER 16 THE CYTOSKELETON CHAPTER 16 THE CYTOSKELETON THE SELF-ASSEMBLY AND DYNAMIC STRUCTURE OF CYTOSKELETAL FILAMENTS HOW CELLS REGULATE THEIR CYTOSKELETAL FILAMENTS MOLECULAR MOTORS THE CYTOSKELETON AND CELL BEHAVIOR THE SELF-ASSEMBLY

More information

What to look for in a fluorophore. What to do with a fluorophore. Types of fluorochromes

What to look for in a fluorophore. What to do with a fluorophore. Types of fluorochromes What to do with a fluorophore Intracellular localization (ER, Golgi, PM, nuclear, lysosome, MT, actin,...) Dynamic processes (protein synthesis, trafficking, turnover, DNA replication, cytoskeletal remodeling,

More information

Practice Problems 5. Location of LSA-GFP fluorescence

Practice Problems 5. Location of LSA-GFP fluorescence Life Sciences 1a Practice Problems 5 1. Soluble proteins that are normally secreted from the cell into the extracellular environment must go through a series of steps referred to as the secretory pathway.

More information

Fluorescence Light Microscopy for Cell Biology

Fluorescence Light Microscopy for Cell Biology Fluorescence Light Microscopy for Cell Biology Why use light microscopy? Traditional questions that light microscopy has addressed: Structure within a cell Locations of specific molecules within a cell

More information

For labelling sub-cellular organelles in tissue sections, cell cultures and cell free experiments using our proprietary Red fluorescence probe

For labelling sub-cellular organelles in tissue sections, cell cultures and cell free experiments using our proprietary Red fluorescence probe ab112127 CytoPainter F-actin Staining Kit - Red Fluorescence Instructions for Use For labelling sub-cellular organelles in tissue sections, cell cultures and cell free experiments using our proprietary

More information

Product Datasheet. Vinculin Antibody (hvin-1) NB Unit Size: 0.1 ml

Product Datasheet. Vinculin Antibody (hvin-1) NB Unit Size: 0.1 ml Product Datasheet Vinculin Antibody (hvin-1) NB600-1293 Unit Size: 0.1 ml Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles. Reviews: 1 Publications: 2 Protocols, Publications,

More information

SONOMA STATE UNIVERSITY DEPARTMENT OF BIOLOGY BIOLOGY 344: CELL BIOLOGY Fall 2013

SONOMA STATE UNIVERSITY DEPARTMENT OF BIOLOGY BIOLOGY 344: CELL BIOLOGY Fall 2013 SONOMA STATE UNIVERSITY DEPARTMENT OF BIOLOGY BIOLOGY 344: CELL BIOLOGY Fall 2013 Instructor Murali C. Pillai, PhD Office 214 Darwin Hall Telephone (707) 664-2981 E-mail pillai@sonoma.edu Website www.sonoma.edu/users/p/pillai

More information

Fluorescent Imaging in Cell Biology. Invitrogen Cellular Analysis

Fluorescent Imaging in Cell Biology. Invitrogen Cellular Analysis Fluorescent Imaging in Cell Biology Invitrogen Cellular Analysis Topics Fluorescent Dyes and Dots Cellular Structure. Multicolor Immuno-Labeling. rganelle Stains Cellular Physiology Intracellular Ions

More information

MCBII. Points this page

MCBII. Points this page 1. What makes intermediate filaments (IFs) an inefficient track for motor proteins (4 pts)? A. The outer surface of IFs is hydrophobic. B. IFs are nonpolar structures. C. IFs contain coiled coil domains.

More information

Supplementary Methods

Supplementary Methods Supplementary Methods Antibodies For immunocytochemistry, the following antibodies were used: mouse anti-γ-h2ax (Upstate), rabbit anti-γ-h2ax (Abcam), rabbit anti-53bp1 (Novus), mouse anti-atm-phosphoserine1981

More information

Contents. SCHOOL of FLUORESCENCE. For more information, go to lifetechnologies.com/imagingbasics

Contents. SCHOOL of FLUORESCENCE. For more information, go to lifetechnologies.com/imagingbasics MPSF educator packet This packet contains illustrations and figures from the Molecular Probes School of Fluorescence website. They illustrate concepts from the basic physical properties that underlie fluorescence

More information

Contents. 11 The Use of Epitope Tags in Histochemistry References... 98

Contents. 11 The Use of Epitope Tags in Histochemistry References... 98 Contents 1 Antibodies for Immunohistochemistry... 1 1.1 Structure of Antibodies... 2 1.2 Polyclonal Antibodies... 4 1.3 Mouse Monoclonal Antibodies... 4 1.4 Rabbit Monoclonal Antibodies... 5 1.5 Protein

More information

Supplementary information. Quantitative analysis of receptor-mediated uptake and pro-apoptotic activity of mistletoe lectin-1 by high content imaging

Supplementary information. Quantitative analysis of receptor-mediated uptake and pro-apoptotic activity of mistletoe lectin-1 by high content imaging Supplementary information Quantitative analysis of receptor-mediated uptake and pro-apoptotic activity of mistletoe lectin-1 by high content imaging Beztsinna N. 1, de Matos M.B.C. 1,2, Walther J. 1, Heyder

More information

Microtubules. Forms a sheet of protofilaments that folds to a tube Both tubulins bind GTP

Microtubules. Forms a sheet of protofilaments that folds to a tube Both tubulins bind GTP Microtubules Polymerize from a-tubulin/ß-tubulin dimers Hollow tube of 13 protofilaments In vitro- filament number varies In vivo- always 13 protofilaments Forms a sheet of protofilaments that folds to

More information

Resolving Macromolecular Organization in Cells Using Super Resolution Microscopy Karen Porter-Davis Chamblee Charter High School

Resolving Macromolecular Organization in Cells Using Super Resolution Microscopy Karen Porter-Davis Chamblee Charter High School Resolving Macromolecular Organization in Cells Using Super Resolution Microscopy Karen Porter-Davis Chamblee Charter High School STEP-UP Program 2015 Super Resolution Imaging } Two Projects to Image }

More information

ab CytoPainter Phalloidin-iFluor 488

ab CytoPainter Phalloidin-iFluor 488 Version 3 Last updated 23 May 2017 ab176753 CytoPainter Phalloidin-iFluor 488 Reagent For staining actin filaments (F-actin) in formaldehyde-fixed cells and tissues. This product is for research use only

More information

The best and brightest

The best and brightest Labeling and Detection The best and brightest Alexa Fluor 488 dye Labeling and Detection A superior alternative to FITC Brighter conjugate fluorescence Unequalled photostability Perfect spectral match

More information

namibia UniVERSITY OF SC IEnCE AnD TECHnOLOGY FACULTY OF HEALTH AND APPLIED SCIENCES DEPARTMENT OF HEALTH SCIENCES PAPER: THEORY

namibia UniVERSITY OF SC IEnCE AnD TECHnOLOGY FACULTY OF HEALTH AND APPLIED SCIENCES DEPARTMENT OF HEALTH SCIENCES PAPER: THEORY namibia UniVERSITY OF SC IEnCE AnD TECHnOLOGY FACULTY OF HEALTH AND APPLIED SCIENCES DEPARTMENT OF HEALTH SCIENCES QUALIFICATION: BACHELOR OF BIOMEDICAL SCIENCES QUALIFICATION CODE: SOBBMS LEVEL: 6 COURSE:

More information

Sélection Internationale Ens Ulm 2012, Cell Biology

Sélection Internationale Ens Ulm 2012, Cell Biology Sélection Internationale Ens Ulm 2012, Cell Biology Please read the whole subject before starting. Questions 1-8 and 12-14 are general biology questions. In questions 9, 10, 11 and15, we ask you to interpret

More information

袋 GeneTex. Quality Antibodies Quality Results. Organelle Markers. netex.co m

袋 GeneTex. Quality Antibodies Quality Results. Organelle Markers.   netex.co m Quality Antibodies Quality Results 袋 GeneTex Organelle Markers () () () www.ge netex.co m Cytosol - (~ Citation Support I l~ 心 0/KD Vali 醞叫 t} Orthoqonal Validation I Endoplasmic Reticulum (ER) `, GRP94

More information

Supplemental Data includes Supplemental Experimental Procedures, 4 Figures and 5 Movie Legends.

Supplemental Data includes Supplemental Experimental Procedures, 4 Figures and 5 Movie Legends. SUPPLEMENTAL DATA Supplemental Data includes Supplemental Experimental Procedures, 4 Figures and 5 Movie Legends. Supplemental Experimental Procedures Dominant negative nesprin KASH (DN KASH) plasmid construction-

More information

Supporting Information

Supporting Information Supporting Information Stavru et al. 0.073/pnas.357840 SI Materials and Methods Immunofluorescence. For immunofluorescence, cells were fixed for 0 min in 4% (wt/vol) paraformaldehyde (Electron Microscopy

More information

It is with profound sadness that we report the passing

It is with profound sadness that we report the passing RAYMOND CHIU (1972-2003) It is with profound sadness that we report the passing of Raymond Chiu, an M.D./Ph.D. student in the Department of Developmental and Molecular Biology, who carried out his thesis

More information

1/24/2012. Cell. Plasma Membrane

1/24/2012. Cell. Plasma Membrane Chapter 3 Outline Plasma Membrane Cytoplasm and Its Organelles Cell and Gene Expression Protein Synthesis and Secretion DNA Synthesis and Cell Division Cell Basic unit of structure and function in body

More information

THE BASICS OF IMMUNOHISTOCHEMISTRY

THE BASICS OF IMMUNOHISTOCHEMISTRY THE BASICS OF IMMUNOHISTOCHEMISTRY Introduction Immunohistochemistry (IHC) identifies specific tissue components by means of a specific antigen/antibody reaction tagged with a visible label. IHC makes

More information

More on fluorescence

More on fluorescence More on fluorescence Last class Fluorescence Absorption emission Jablonski diagrams This class More on fluorescence Common fluorophores Jablonski diagrams to spectra Properties of fluorophores Excitation

More information

Ac(n cytoskeleton 12/7/11. The Cytoskeleton. Func0ons of the Cytoskeleton. B Visegrady. Elements of the Cytoskeleton

Ac(n cytoskeleton 12/7/11. The Cytoskeleton. Func0ons of the Cytoskeleton. B Visegrady. Elements of the Cytoskeleton The Cytoskeleton Ac(n cytoskeleton B Visegrady The cytoskeleton is an intricate network of protein filaments that extends throughout the cytoplasm. A skin cell (fibroblast) stained with Coomassie blue.

More information

Visualizing Cells Molecular Biology of the Cell - Chapter 9

Visualizing Cells Molecular Biology of the Cell - Chapter 9 Visualizing Cells Molecular Biology of the Cell - Chapter 9 Resolution, Detection Magnification Interaction of Light with matter: Absorbtion, Refraction, Reflection, Fluorescence Light Microscopy Absorbtion

More information

The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit

The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Cell Reports, Volume 5 Supplemental Information The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Andrey Poleshko, Katelyn M. Mansfield, Caroline

More information

2. Know the parts of a light microscope and general rules for using and focusing a microscope, such as:

2. Know the parts of a light microscope and general rules for using and focusing a microscope, such as: SNC 2DI Exam Review: Biology Unit 1. Understand the meaning of the following terms. Be able to recognize their definitions: Biology Mounting medium Telophase Organelle Cell Theory Cell cycle Cytokinesis

More information

Super-resolution imaging: early days w/ Video-enhanced DIC, TIRF, PALM, STORM, etc.

Super-resolution imaging: early days w/ Video-enhanced DIC, TIRF, PALM, STORM, etc. 15/05/2012 Super-resolution imaging: early days w/ Video-enhanced DIC, TIRF, PALM, STORM, etc. Prof. Dr. Rainer Duden duden@bio.uni-luebeck.de 1 Using conventional light microscopy resolution is limited

More information

2. Know the parts of a light microscope and general rules for using and focusing a microscope, such as:

2. Know the parts of a light microscope and general rules for using and focusing a microscope, such as: SNC 2DI Exam Review: Biology Unit 1. Understand the meaning of the following terms. Be able to recognize their definitions: Biology Mounting medium Telophase Organelle Cell Theory Cell cycle Cytokinesis

More information

ab CytoPainter Phalloidin-iFluor 594

ab CytoPainter Phalloidin-iFluor 594 Version 4 Last updated 23 May 2017 ab176757 CytoPainter Phalloidin-iFluor 594 Reagent For staining actin filaments (F-actin) in formaldehyde-fixed cells and tissues. This product is for research use only

More information

Protein purification prior to proteomics analysis

Protein purification prior to proteomics analysis Protein purification prior to proteomics analysis Stephen Barnes, PhD Department of Pharmacology & Toxicology and Mass Spectrometry Shared Facility, UAB The dynamic range of protein abundances Proteins

More information

Old Exam II Questions. Give your full SID# on this page and the last page of this exam booklet.

Old Exam II Questions. Give your full SID# on this page and the last page of this exam booklet. Old Exam II Questions SID#: Give your full SID# on this page and the last page of this exam booklet. Also fill in the grids of your full SID# in the Student Number Section of the computer scan sheet provided

More information

Cytoskeleton. B. Balen

Cytoskeleton. B. Balen Cytoskeleton B. Balen structural backbone of the cell supports the fragile plasma membrane provides mechanical linkages that let the cell bear stresses without being ripped apart Importance and function

More information

Supplemental Table 1 Primers used in study. Human. Mouse

Supplemental Table 1 Primers used in study. Human. Mouse Supplemental Table 1 Primers used in study Human Forward primer region(5-3 ) Reverse primer region(5-3 ) RT-PCR GAPDH gagtcaacggatttggtcgt ttgattttggagggatctcg Raftlin atgggttgcggattgaacaagttaga ctgaggtataacaccaacgaatttcaggc

More information

System of protein filaments in the cytoplasm of. eukaryotic cell that gives the cell shape and capacity for

System of protein filaments in the cytoplasm of. eukaryotic cell that gives the cell shape and capacity for Cytoskeleton System of protein filaments in the cytoplasm of eukaryotic cell that gives the cell shape and capacity for directed movement. The protein filaments are responsible for the shaping, moving,

More information

These molecules make up the ladder of the DNA Bound by weak hydrogen bonds. 4 Different Types (2 specific matches) look at the

These molecules make up the ladder of the DNA Bound by weak hydrogen bonds. 4 Different Types (2 specific matches) look at the B.A.T. Review DNA & Cell Cycle Test is 11/3/16 NAME: PERIOD DNA STRUCTURE VOCABULARY Mitosis Chromosomes Interphase G1,S,G2,M Prophase Metaphase Anaphase Telophase Cytokinesis Cleavage Furrow Spindle Fibers

More information

BIO 315 Exam II. 1. Which of the following molecules forms a fibrous cage around cells that protects them from tearing forces:

BIO 315 Exam II. 1. Which of the following molecules forms a fibrous cage around cells that protects them from tearing forces: BIO 315 Exam II SID#: Give your full SID# on this page and the last page of this exam booklet. Also fill in the grids of your full SID# (w/9) in the Student Number Section of the computer scan sheet provided

More information

Objective Evaluation of Differences in Protein Subcellular Distribution

Objective Evaluation of Differences in Protein Subcellular Distribution Copyright C Munksgaard 2002 Munksgaard International Publishers ISSN 1398-9219 Objective Evaluation of Differences in Protein Subcellular Distribution Edward J. S. Roques and Robert F. Murphy* Department

More information

Actin cap associated focal adhesions and their distinct role in cellular mechanosensing

Actin cap associated focal adhesions and their distinct role in cellular mechanosensing Actin cap associated focal adhesions and their distinct role in cellular mechanosensing Dong-Hwee Kim 1,2, Shyam B. Khatau 1,2, Yunfeng Feng 1,3, Sam Walcott 1,4, Sean X. Sun 1,2,4, Gregory D. Longmore

More information

Figure S1 is related to Figure 1B, showing more details of outer segment of

Figure S1 is related to Figure 1B, showing more details of outer segment of Supplemental Information Supplementary Figure legends and Figures Figure S1. Electron microscopic images in Sema4A +/+ and Sema4A / retinas Figure S1 is related to Figure 1B, showing more details of outer

More information

- ex. polarized epithelial cells: certain organelles are arranged in defined order from apical to basal end of cell

- ex. polarized epithelial cells: certain organelles are arranged in defined order from apical to basal end of cell THE CYTOSKELETON - vertebrates: skeleton ; eukaryotic cells: cytoskeleton (analogous) - consists of hardened elements that support soft tissues of body - mediates bodily movements - 3 elements of cytoskeleton

More information

Human Anatomy & Physiology I Dr. Sullivan Unit IV Cellular Function Chapter 4, Chapter 27 (meiosis only)

Human Anatomy & Physiology I Dr. Sullivan Unit IV Cellular Function Chapter 4, Chapter 27 (meiosis only) Human Anatomy & Physiology I Dr. Sullivan Unit IV Cellular Function Chapter 4, Chapter 27 (meiosis only) I. Protein Synthesis: creation of new proteins a. Much of the cellular machinery is devoted to synthesizing

More information

ab CytoPainter ER Staining Kit Red Fluorescence

ab CytoPainter ER Staining Kit Red Fluorescence ab139482 CytoPainter ER Staining Kit Red Fluorescence Instructions for Use Designed to detect Human endoplasmic reticulum by microscopy. This product is for research use only and is not intended for diagnostic

More information

Supplemental Material

Supplemental Material Supplemental Material 1 Figure S1. Phylogenetic analysis of Cep72 and Lrrc36, comparative localization of Cep72 and Lrrc36 and Cep72 antibody characterization (A) Phylogenetic alignment of Cep72 and Lrrc36

More information

Resolution of Microscopes Visible light is nm Dry lens(0.5na), green(530nm light)=0.65µm=650nm for oil lens (1.4NA) UV light (300nm) = 0.13µm f

Resolution of Microscopes Visible light is nm Dry lens(0.5na), green(530nm light)=0.65µm=650nm for oil lens (1.4NA) UV light (300nm) = 0.13µm f Microscopes and Microscopy MCB 380 Good information sources: Alberts-Molecular Biology of the Cell http://micro.magnet.fsu.edu/primer/ http://www.microscopyu.com/ Approaches to Problems in Cell Biology

More information

Supplementary Figure 1 Pfn1, but not other Pfn isoforms are expressed in

Supplementary Figure 1 Pfn1, but not other Pfn isoforms are expressed in Supplementary Figure 1 Pfn1, but not other Pfn isoforms are expressed in platelets. (a) RT-PCR of Pfn isoforms in control mouse platelets, Pfn1 -/- platelets and control heart. Expected band size for Pfn1

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Rodríguez-Fraticelli et al., http://www.jcb.org/cgi/content/full/jcb.201203075/dc1 Figure S1. Cell spreading and lumen formation in confined

More information

Practice Exam 3 MCBII

Practice Exam 3 MCBII 1. Which is not a feature of lamin intermediate filaments (IFs)? (4 pts) A. They are protein polymers. B. They are used by motor proteins to traffic cargo. C. They contain coiled coil domains. D. They

More information

Replication-independent chromatin loading of Dnmt1 during G2 and M phases

Replication-independent chromatin loading of Dnmt1 during G2 and M phases Replication-independent chromatin loading of Dnmt1 during G2 and M phases Hariharan P. Easwaran 1, Lothar Schermelleh 2, Heinrich Leonhardt 1,2,* and M. Cristina Cardoso 1,* 1 Max Delbrück Center for Molecular

More information

Lab Module 7: Cell Adhesion

Lab Module 7: Cell Adhesion Lab Module 7: Cell Adhesion Tissues are made of cells and materials secreted by cells that occupy the spaces between the individual cells. This material outside of cells is called the Extracellular Matrix

More information

Three major types of cytoskeleton

Three major types of cytoskeleton The Cytoskeleton Organizes and stabilizes cells Pulls chromosomes apart Drives intracellular traffic Supports plasma membrane and nuclear envelope Enables cellular movement Guides growth of the plant cell

More information

Partha Roy

Partha Roy Fluorescence microscopy http://micro.magnet.fsu.edu/primer/index.html Partha Roy 1 Lecture Outline Definition of fluorescence Common fluorescent reagents Construction ti of a fluorescence microscope Optical

More information

cell and tissue imaging by fluorescence microscopy

cell and tissue imaging by fluorescence microscopy cell and tissue imaging by fluorescence microscopy Steven NEDELLEC Plateforme Micropicell SFR Santé François Bonamy Nantes 1 A matter of size Limit of resolution 0.15mm aims: building the image of an object

More information

Fluorescence Microscopy. Terms and concepts to know: 10/11/2011. Visible spectrum (of light) and energy

Fluorescence Microscopy. Terms and concepts to know: 10/11/2011. Visible spectrum (of light) and energy Fluorescence Microscopy Louisiana Tech University Ruston, Louisiana Microscopy Workshop Dr. Mark DeCoster Associate Professor Biomedical Engineering 1 Terms and concepts to know: Signal to Noise Excitation

More information

Sarker et al. Supplementary Material. Subcellular Fractionation

Sarker et al. Supplementary Material. Subcellular Fractionation Supplementary Material Subcellular Fractionation Transfected 293T cells were harvested with phosphate buffered saline (PBS) and centrifuged at 2000 rpm (500g) for 3 min. The pellet was washed, re-centrifuged

More information

Introduction to Flow Cytometry. -- BD FACSCanto II TM. Daisy Kuo Application Specialist BDBiosciences

Introduction to Flow Cytometry. -- BD FACSCanto II TM. Daisy Kuo Application Specialist   BDBiosciences Introduction to Flow Cytometry -- BD FACSCanto II TM Daisy Kuo Application Specialist E-mail: daisy_kuo@bd.com BDBiosciences Outline Basic Concept of Flow Cytometry FACSCanto II System Introduction Application

More information

Promotion of HDF Cell Attachment and Proliferation

Promotion of HDF Cell Attachment and Proliferation Promotion of HDF Cell Attachment and Proliferation Objectives To qualitatively assess the effect of fibronectin (Fn) on HDF cell attachment Fn Attachment Assay To observe HDF cell proliferation and position

More information

Supplementary Protocol. sirna transfection methodology and performance

Supplementary Protocol. sirna transfection methodology and performance Supplementary Protocol sirna transfection methodology and performance sirna oligonucleotides, DNA construct and cell line. Chemically synthesized 21 nt RNA duplexes were obtained from Ambion Europe, Ltd.

More information

Chapter 15. Cytoskeletal Systems. Lectures by Kathleen Fitzpatrick Simon Fraser University Pearson Education, Inc.

Chapter 15. Cytoskeletal Systems. Lectures by Kathleen Fitzpatrick Simon Fraser University Pearson Education, Inc. Chapter 15 Cytoskeletal Systems Lectures by Kathleen Fitzpatrick Simon Fraser University Table 15-1 - Microtubules Table 15-1 - Microfilaments Table 15-1 Intermediate Filaments Table 15-3 Microtubules

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Thompson et al., http://www.jcb.org/cgi/content/full/jcb.200909067/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Modification-specific antibodies do not detect unmodified

More information

supplementary information

supplementary information DOI: 10.1038/ncb1977 Figure S1 a. Immunofluorescence analysis of IFT20 localization in PBL costained with anti-β-tubulin antibodies. b. Immunofluorescence analysis of IFT20 localization in Jurkat cells,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2386 Figure 1 Src-containing puncta are not focal adhesions, podosomes or endosomes. (a) FAK-/- were stained with anti-py416 Src (green) and either (in red) the focal adhesion protein paxillin,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid

More information

Eukaryotic cells internalize material from the external

Eukaryotic cells internalize material from the external ADP-Ribosylation Factor 6 Regulates a Novel Plasma Membrane Recycling Pathway Harish Radhakrishna and Julie G. Donaldson Laboratory of Cell Biology, National Heart, Lung, and Blood Institute, National

More information

Cells and Their Housekeeping Functions Nucleus and Other Organelles

Cells and Their Housekeeping Functions Nucleus and Other Organelles Cells and Their Housekeeping Functions Nucleus and Other Organelles Shu-Ping Lin, Ph.D. Institute of Biomedical Engineering E-mail: splin@dragon.nchu.edu.tw Website: http://web.nchu.edu.tw/pweb/users/splin/

More information

Five steps for publication-quality cell imaging the first time

Five steps for publication-quality cell imaging the first time Five steps for publication-quality cell imaging the first time Follow this proven guide to capture the best possible fixed-cell images Introduction We are all driven by great scientific innovation and

More information

Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section B and ONE question from Section C.

Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section B and ONE question from Section C. UNIVERSITY OF EAST ANGLIA School of Biological Sciences Main Series UG Examination 2013-2014 CELL BIOLOGY BIO-2B06 Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in

More information

Supplementary Table-1: List of genes that were identically matched between the ST2 and

Supplementary Table-1: List of genes that were identically matched between the ST2 and Supplementary data Supplementary Table-1: List of genes that were identically matched between the ST2 and ST3. Supplementary Table-2: List of genes that were differentially expressed in GD2 + cells compared

More information

SUPPLEMENTARY INFORMATION FIGURE LEGENDS

SUPPLEMENTARY INFORMATION FIGURE LEGENDS SUPPLEMENTARY INFORMATION FIGURE LEGENDS Fig. S1. Radiation-induced phosphorylation of Rad50 at a specific site. A. Rad50 is an in vitro substrate for ATM. A series of Rad50-GSTs covering the entire molecule

More information

Description: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto

Description: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tables Title of file for HTML: Supplementary Movie 1 Description: Nuclear morphology and dynamics

More information

Old Exam II Questions. Give your full SID# on this page and the last page of this exam booklet.

Old Exam II Questions. Give your full SID# on this page and the last page of this exam booklet. Old Exam II Questions SID#: Give your full SID# on this page and the last page of this exam booklet. Also fill in the grids of your full SID# in the Student Number Section of the computer scan sheet provided

More information

Imaging of Cells using fluorescents dyes. By: Josué A. Benjamín Rivera September 27, 2018

Imaging of Cells using fluorescents dyes. By: Josué A. Benjamín Rivera September 27, 2018 Imaging of Cells using fluorescents dyes By: Josué A. Benjamín Rivera September 27, 2018 1 History Sir William Henry Perkin BRITISH CHEMIST In 1856, at the age of 18, William Henry Perkin set out with

More information

ab CytoPainter ER Staining Kit Red Fluorescence

ab CytoPainter ER Staining Kit Red Fluorescence ab139482 CytoPainter ER Staining Kit Red Fluorescence Instructions for Use Designed to detect Human endoplasmic reticulum by microscopy. This product is for research use only and is not intended for diagnostic

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION WWW.NATURE.COM/NATURECELLBIOLOGY 1 SUPPLEMENTARY INFORMATION 2 WWW.NATURE.COM/NATURECELLBIOLOGY SUPPLEMENTARY INFORMATION WWW.NATURE.COM/NATURECELLBIOLOGY 3 SUPPLEMENTARY INFORMATION

More information

The cytoskeletal system

The cytoskeletal system The cytoskeletal system Types, polymerization, characteristics and mechanical properties of cytoskeletal filaments. Associated protein. 24.09.2013. Cytoskeleton The cellular "scaffold" or "skeleton" within

More information

Xfect Protein Transfection Reagent

Xfect Protein Transfection Reagent Xfect Protein Transfection Reagent Mammalian Expression Systems Rapid, high-efficiency, low-toxicity protein transfection Transfect a large amount of active protein Virtually no cytotoxicity, unlike lipofection

More information

Chapter 4 - The nucleus controls the functions of life

Chapter 4 - The nucleus controls the functions of life Chapter 4 - The nucleus controls the functions of life 4.1 The Function of the Nucleus within the Cell Cell Parts and Organelles Animal Cells Animal cells are equipped with many structures that allow the

More information

Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand

Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand SUPPLEMENTAL FIGURES Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand C. Ravelli et al. FIGURE S. I Figure S. I: Gremlin

More information

Introduction to Flow Cytometry. -- BD FACSCanto II TM. Daisy Kuo Assistant Product Manager BDBiosciences

Introduction to Flow Cytometry. -- BD FACSCanto II TM. Daisy Kuo Assistant Product Manager   BDBiosciences Introduction to Flow Cytometry -- BD FACSCanto II TM Daisy Kuo Assistant Product Manager E-mail: daisy_kuo@bd.com BDBiosciences Outline Basic Concept of Flow Cytometry FACSCanto II System Introduction

More information

PLEASE MAKE SURE THAT ALL PAGES ARE NUMBERED and IDENTIFIED!!!!!.

PLEASE MAKE SURE THAT ALL PAGES ARE NUMBERED and IDENTIFIED!!!!!. Instructions: The following pages contain twelve questions. You must answer ten out of the twelve questions. Any one question may ask for more than one response so please read each question carefully for

More information

Supporting Information

Supporting Information Supporting Information Shao et al. 10.1073/pnas.1504837112 SI Materials and Methods Immunofluorescence and Immunoblotting. For immunofluorescence, cells were fixed with 4% paraformaldehyde and permeabilized

More information

COPYRIGHTED MATERIAL. Tissue Preparation and Microscopy. General Concepts. Chemical Fixation CHAPTER 1

COPYRIGHTED MATERIAL. Tissue Preparation and Microscopy. General Concepts. Chemical Fixation CHAPTER 1 CHAPTER 1 Tissue Preparation and Microscopy General Concepts I. Biological tissues must undergo a series of treatments to be observed with light and electron microscopes. The process begins by stabilization

More information

Biology unit. Big Idea. Cells are derived from cells Part 1 Review, what s in a cell!?

Biology unit. Big Idea. Cells are derived from cells Part 1 Review, what s in a cell!? Biology unit Big Idea Cells are derived from cells Part 1 Review, what s in a cell!? (cell nucleus and DNA-Gr 10 material for next year) http://www.popsci.com/science/article/2013-03/watch-absolutely-beautiful-animatedexplainer-dna

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/NCHEM.1805 Visualization and Selective Chemical Targeting of RNA G-quadruplex Structures in the Cytoplasm of Human Cells Giulia Biffi 1, Marco Di Antonio 2, David Tannahill 1 and Shankar Balasubramanian

More information

Fall Tuesdays and Thursdays 11:00am 5:30pm

Fall Tuesdays and Thursdays 11:00am 5:30pm BICD111 - Cell Biology Laboratory Fall 2009 Tuesdays and Thursdays 11:00am 5:30pm Instructor: Colin Jamora (cjamora@biomail.ucsd.edu) TAs: Pedro Lee (pelee@ucsd.edu) Albert Kim (a19kim@ucsd.edu) Office

More information

Assays for studying mitochondrial health and function

Assays for studying mitochondrial health and function APPLICATION NOTE Fluorescence labeling and detection Assays for studying mitochondrial health and function Introduction Mitochondria play a critical role in maintaining normal cellular activities. Mitochondria

More information

NUCLEUS. Fig. 2. Various stages in the condensation of chromatin

NUCLEUS. Fig. 2. Various stages in the condensation of chromatin NUCLEUS Animal cells contain DNA in nucleus (contains ~ 98% of cell DNA) and mitochondrion. Both compartments are surrounded by an envelope (double membrane). Nuclear DNA represents some linear molecules

More information

Description. Lipodin-Pro TM - Protein Transfection Reagent. 1. Kit Benefits

Description. Lipodin-Pro TM - Protein Transfection Reagent. 1. Kit Benefits Description Lipodin-Pro TM - Protein Transfection Reagent The delivery of proteins inside living cells represents an alternative to nucleic acids transfection and a powerful strategy for functional studies

More information

Lecture 13. Motor Proteins I

Lecture 13. Motor Proteins I Lecture 13 Motor Proteins I Introduction: The study of motor proteins has become a major focus in cell and molecular biology. Motor proteins are very interesting because they do what no man-made engines

More information

IRON METABOLISM. Harper s Illustrated Biochemistry chapter 50

IRON METABOLISM. Harper s Illustrated Biochemistry chapter 50 IRON METABOLISM Harper s Illustrated Biochemistry chapter 50 IRON 26th element in the periodic table Chemical Symbol: Fe MW = 55.85 Electron Configuration: 1s 2 2s 2 2p 6 3s 2 3p 6 4s 2 3d 6 Fourth most

More information

Immunohistochemistry: Basics and Methods

Immunohistochemistry: Basics and Methods Immunohistochemistry: Basics and Methods Igor B. Buchwalow l Werner Böcker Immunohistochemistry: Basics and Methods Prof. Dr. Igor B. Buchwalow Prof. Dr. Werner Böcker Gerhard-Domagk-Institut für Pathologie

More information

CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration

CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration /, Supplementary Advance Publications Materials 2016 CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration Supplementary Materials Supplementary Figure S1: In ECs CD93 silencing

More information

SNAP i.d. Protein Detection System. Superior Blots in a Snap!

SNAP i.d. Protein Detection System. Superior Blots in a Snap! SNAP i.d. Protein Detection System Superior Blots in a Snap! SNAP i.d. Protein Detection System Superior Blots in a Snap! The SNAP i.d. Protein Detection System revolutionizes immunodetection every time

More information

Staining Techniques. Staining Techniques. There are many dyes. Histochemical Stains: chemical reactions. Feulgen reaction -DNA

Staining Techniques. Staining Techniques. There are many dyes. Histochemical Stains: chemical reactions. Feulgen reaction -DNA Staining Techniques There are many dyes. http://medinfo.ufl.edu/~dental/denhisto/stains.html Examples: Sudan black -Lipids Myelinated axons- blue ihcworld.com/imagegallery/displayimage.php?al... Weigert

More information

Immunohistochemistry: Basics and Methods

Immunohistochemistry: Basics and Methods Immunohistochemistry: Basics and Methods Bearbeitet von Igor B Buchwalow, Werner Böcker 1st Edition. 2010. Buch. x, 153 S. Hardcover ISBN 978 3 642 04608 7 Format (B x L): 15,5 x 23,5 cm Gewicht: 445 g

More information