Supplemental Material
|
|
|
- Madeleine Powers
- 6 years ago
- Views:
Transcription
1 Supplemental Material 1
2 Figure S1. Phylogenetic analysis of Cep72 and Lrrc36, comparative localization of Cep72 and Lrrc36 and Cep72 antibody characterization (A) Phylogenetic alignment of Cep72 and Lrrc36 ortholog protein sequences. Vertebrate Cep72 orthologs are more related to individual Cep72-like orthologs in nonvertebrate organisms as compared to Lrrc36. (abbreviations ta: T. adhaerens; ac:a. carolinensis; sp:s. purpuratus; ci:c. intestinalis; sk:s. kowalevskii; am:a. melanoleuca; mm:m. musculus; hs:h.sapiens; dr:d. rerio; sm:s. mansoni; xt:x. tropicalis). (B) To compare localization of Cep72 and Lrrc36, NIH3T3 cells were cotransfected with tagged cdna expression constructs for each, fixed and immunostained for Cep72-myc (anti-myc), Lrrc36-GFP (anti-gfp) and DNA (DAPI). (C) htert-rpe1 cells were transfected with Lrrc36-GFP, fixed and immunostained for γ-tubulin, PCM1 and Lrrc36-GFP (anti-gfp). Note that Lrrc36-GFP localizes exclusively to the centrosome and does not overlap with PCM1. Images are deconvolved maximum projections of stacks from approximately 2 µm sections. Scale bars, 1 µm. Characterization of Cep72 antibody (D) Inclusion body preparation from control or GST-Cep72 expressing E. coli. Protein was transferred to nitrocellulose and the membrane region containing GST-Cep72 (~100 kda) was excised and used for blocking experiments. (E) Western blot analysis of endogenous Cep72. Hela cell extracts were probed with Cep72 antibody, or γ-tubulin antibody as a loading control. Cep72 antibody detected a band of the predicted molecular weight for Cep72. This band was not detected when antibody was blocked with GST-Cep72. (F) Western blot analysis of LAP Cep72 using Cep72 antibody. LAP Cep72 was immunoprecipitated from LAP Cep72-IMCD3 cell extracts using an anti-gfp antibody. Input lysates (Lys) and immunoprecipitations (IP (GFP)) were probed with Cep72 antibody. Cep72 polyclonal antibody detected a band of the predicted molecular weight for LAP Cep72 in both extracts and immunoprecipitates. These bands were not detected when antibody was blocked with GST-Cep72. (G) Immunofluorescence analysis of endogenous Cep72. Hela cells were fixed and immunostained for Cep72 and γ-tubulin. Cep72 antibody labeled Cep72-positive particles surrounding the centrosome. Cep72 signal was absent when cells were stained with antibody blocked with GST-Cep72. (H) Immunofluorescence analysis of LAP Cep72. LAP Cep72-IMCD3 cells were fixed and stained for LAP Cep72 with Cep72 antibody and GFP antibody. LAP Cep72 was not detected when cells were stained with Cep72 antibody blocked with GST-Cep72, whereas LAP Cep72 was still detected with GFP antibody. DNA was stained with DAPI. Scale bars, 5 µm. (I) Specificity of Cep72 antibody demonstrated by Cep72 RNAi. htert-rpe1 cells were transfected with control or Cep72-targeting sirnas for 48 hours after which time cells were fixed and stained for endogenous Cep72 and γ tubulin 2
3 3
4 Figure S2. Cep72 colocalizes with PCM1 and maintains this colocalization in nocodazole-treated and p-50-dynamitin-expressing cells. (A) Hela cells were transfected with PCM1-myc, fixed and immunostained for Cep72 and PCM1-myc (antimyc). DNA was stained with DAPI (top panel). LAP Cep72-IMCD3 cells were fixed and immunostained for LAP Cep72 (anti-gfp) and PCM1. DNA was stained with DAPI (lower panel). (B) Effects of microtubule depolymerization on distribution of LAP Cep72. LAP Cep72-IMCD3 cells were treated with DMSO (vehicle, top panel) or nocodazole (5 µg/ml, lower panel) for 3 h, fixed and immunostained for LAP Cep72 (anti-gfp) and PCM1. DNA was stained with DAPI. In control cells, LAP Cep72 colocalized with PCM1 in centriolar satellites. In nocodazole-treated cells, LAP Cep72 remained colocalized with PCM1, but was dispersed throughout the cytoplasm. (C) Effects of dynein disruption on distribution of LAP Cep72. LAP Cep72-IMCD3 were transfected with p50-dynamitin-myc, fixed and immunostained for p50-dynamitin-myc (anti-myc) and PCM1. DNA was stained with DAPI. PCM1 signal is dispersed throughout the cytoplasm in the p50- dynamitin-myc expressing cell (labeled with *, top panel). Transfected LAP Cep72-IMCD3 cells were fixed and immunostained for LAP Cep72 (anti-gfp) and PCM1. DNA was stained with DAPI. Both LAP Cep72 and PCM1 are dispersed throughout the cytoplasm, but remain colocalized in the p50-dynamitin-myc expressing cell (labeled with *, bottom panel). 4
5 Figure S3.. Cep72 deletion analysis of PCM1 interaction. (A) Localization of Cep72 deletion constructs. NIH3T3 cells were transfected with GFP or GFP-tagged Cep72 deletion constructs, fixed and immunostained for GFP (anti-gfp) and PCM1. DNA was stained with DAPI. Scale bars, 5 µm. (B) Immunoprecipitation of Cep72 deletion constructs and PCM1. NIH3T3 cells were transfected with GFP or GFP-tagged Cep72 deletion constructs. Extracts from transfected cells were probed with GFP antibody. Major bands detected in each case correspond to a fusion protein of the predicted molecular weight. (B) Interaction of Cep72 deletion constructs with PCM1. Immunoprecipitation of GFP or GFP-tagged Cep72 deletion constructs was performed on extracts from transfected NIH3T3 cells. Major bands detected in anti-gfp probed blots correspond to a Cep72 deletion GFP-fusion proteins of the predicted molecular weight. Inputs and immunoprecipitates were analyzed by western blot, probing for endogenous PCM1. NS, nonspecific band. 5
6 Figure S4. (A) Immunofluorescence analysis of PCM1-depleted cells. IMCD3 cells were infected with control lentivirus expressing a puromycin resistance gene or lentivirus expressing shrna targeting PCM1 and a puromycin resistance gene. Cells were infected overnight, selected for 48 h in puromycin, allowed to recover for 24 h and fixed for immunofluorescence. Cells were immunostained for PCM1 and γ-tubulin. DNA was stained with DAPI. Scale bars, 5 µm. (B) Control or PCM1 RNAi cells were transfected with myc-bbs4, fixed and immunostained for BBS4-myc (anti-myc) and PCM1. DNA was stained with DAPI. Scale bars, 5 µm. (C) Localization of BBS4 and Cep72 in ciliated cells. Stably expressing LAP BBS4-hTERT-RPE1 cells or LAP Cep72-IMCD3 cells were serum-starved for 24 h to induce formation of primary cilia. Cells were fixed and immunostained for LAP BBS4 (anti-gfp, top panel), LAP Cep72 (anti-gfp, bottom panel), AC tubulin (to label primary cilia) and PCM1. Note that in ciliated cells, LAP BBS4 localizes to the primary cilium (top panel), whereas LAP Cep72 remains colocalized with PCM1 in the cytoplasm. Scale bars, 5 µm. 6
7 7
8 Figure S5. Effects of PCM1 depletion on centrosomal redistribution of Cep72. (A) Control or PCM1-depleted LAP Cep72-IMCD3 cells were fixed and immunostained for LAP Cep72 (anti-gfp), PCM1 and γ-tubulin or (B) LAP Cep72 (anti-gfp), pericentrin and DAPI (DNA). Colocalization of LAP Cep72 and centrosomal markers, γ-tubulin and pericentrin was observed only in the absence of PCM1. Scale bars, (A) 1 µm, (B), 5 µm. (C.) Deconvolution analysis of centriolar satellite distribution around the centrosome. Cells were fixed and immunostained for γ-tubulin and endogenous PCM1 (top) or endogenous Cep72 (bottom). Images represent maximum projections of stacks from approximately 2 µm-thick sections. Scale bars, 1 µm. (D) Control or PCM1-depleted LAP Cep72-IMCD3 cells were treated with vehicle or nocodazole for 4 hours. PCM1 and LAP Cep72 remain colocalized in nocodazole-treated cells, but are no longer focused around or localized to the centrosome and are dispersed through the cytoplasm. In vehicle and nocodazole-treated PCM1 depleted cells, LAP Cep72 remains localized to the centrosome indicating that microtubules are not required to maintain this localization. Arrow indicate centrosome in nocodazole-treated cells. Scale bars, 5 µm (E) Mitotic control or PCM1-depleted LAP Cep72-IMCD3 were fixed and immunostained for LAP Cep72 (anti-gfp), PCM1 and γ-tubulin. In contrast to control cells, PCM1-depletion resulted in colocalization of LAP Cep72 and γ-tubulin at spindle poles. Scale bars, 5 µm. (D, upper) 8
9 9
10 Figure S6. Effects of Cep72 or Cep290 depletion. (A) Assessment of colocalization of PCM1-myc and Cep290. Hela cells were transfected with PCM1-myc, fixed and immunostained for PCM1-myc (anti-myc) and Cep290. DNA was stained with DAPI. Scale bars, 5 µm. (A, lower) Assessment of colocalization of Cep72-GFP and Cep290. htert-rpe1 cells were transfected with Cep72-GFP, fixed and immunostained for Cep72-GFP (anti-gfp) and Cep290. DNA was stained with DAPI. Scale bars, 5 µm. (B) Cep290 is not required for localization of Cep72 to centriolar satellites. Control or Cep290 RNAi Hela cells were fixed and immunostained for Cep72 and γ-tubulin. Cep290 was not required for recruitment of Cep72 to centriolar satellites, however Cep290 depletion resulted in a slight accumulation of Cep72-containing centriolar satellites around the centrosome. Scale bars, 5 µm. (C) Cep72 depletion does not alter Cep290 protein levels. Extracts from htert-rpe1 cells transfected with control, Cep72 or Cep290 sirna were prepared and probed for Cep290 and p38, as a loading control. (D) Organization of interphase microtubules is not disrupted in Cep72-depleted cells. Hela cells (top) or htert-rpe1 cells (bottom) were transfected with control sirna or Cep72 sirna for 48 h. Cells were fixed and immunostained for PCM1 and tubulin. DNA was stained with DAPI. Cep72 depletion caused accumulation of PCM1 around centrosomes, but did not affect the organization of interphase microtubule arrays. Scale bars, 5 µm. (E) Effects of Cep72, Cep290, or PCM1 depletion on primary cilium formation. htert-rpe1 cells were transfected with control sirna, Cep72 sirna, Cep290 sirnas or a plasmid expressing a PCM1-targeting shrna for 48 h, serumstarved for 24 h to induce cilium formation and fixed for immunofluorescence. Cells were immunostained for acetylated-tubulin to label primary cilia. DNA was stained with DAPI. Scale bars, 5 µm. 10
11 Figure S7. (A) RNAi-mediated depletion of Lrrc36. htert-rpe1 cells stably expressing Lrrc36-GFP were transfected with control sirna or an sirna pool targeting Lrrc36 for 48 h. Cells were fixed and immunostained for Lrrc36-GFP (anti-gfp) and γ- tubulin. DNA was stained with DAPI. Lrrc36-GFP signal was absent in cells transfected with the Lrrc36 sirna pool (top and bottom panels are separate representative images from each sirna transfection). (B) Codepletion of Cep72 and Lrrc36 does not affect cilium formation. htert-rpe1 cells were transfected with control sirna, Cep72 sirna, Lrrc36 sirnas or both Cep72 and Lrrc36 sirnas for 48 h, serum starved for 24 h and fixed for immunofluorescence. Cells were immunostained for glutamylated tubulin to label primary cilia. DNA was stained with DAPI. Depletion of Cep72, Lrrc36 or both did not affect primary cilium formation. Percentage of ciliated cells was determined for each case (lower left, n=100). Scale bars, 5 µm. (C) htert-rpe1 cells were transfected with Cep72-GFP, fixed and immunostained for Cep72-GFP (anti-gfp) and either ninein, pericentrin or dynein intermediate chain (IC) (top three panels). Stably expressing Rab8-GFP-hTERT-RPE1 cells were transfected with Cep72-myc, fixed and 11
12 immunostained for Cep72-myc (anti-myc) and Rab8-GFP (anti-gfp) (bottom panel). DNA was stained with DAPI. In each case, high Cep72-expressing cells that contained Cep72 aggregates were examined. Scale bars, 5 µm. Movie S1 3-Dimensional distribution of centriolar satellites in control sirna-transfected cells. htert-rpe1 cells were transfected with control sirna for 48 h, fixed and immunostained for PCM1 and γ-tubulin. Movies represent 360 forward and reverse rotations of 2 µm-thick sections centered on the centrosome. Scale bars, 5 µm. Movie S2 3-Dimensional distribution of centriolar satellites in Cep72 sirna-transfected cells. htert-rpe1 cells were transfected with Cep72 sirna for 48 h, fixed and immunostained for PCM1 and γ-tubulin. Movies represent 360 forward and reverse rotations of 2 µm-thick sections centered on the centrosome. In Cep72 RNAi cells, PCM1 clusters tightly around the centrosome, but does not colocalize with γ-tubulin. Scale bars, 5 µm 12
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using
The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit
Cell Reports, Volume 5 Supplemental Information The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Andrey Poleshko, Katelyn M. Mansfield, Caroline
GFP CCD2 GFP IP:GFP
D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43
SUPPLEMENTARY INFORMATION
doi:10.1038/nature09732 Supplementary Figure 1: Depletion of Fbw7 results in elevated Mcl-1 abundance. a, Total thymocytes from 8-wk-old Lck-Cre/Fbw7 +/fl (Control) or Lck-Cre/Fbw7 fl/fl (Fbw7 KO) mice
SANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
Coleman et al., Supplementary Figure 1
Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential
Immunofluorescence images of different core histones and different histone exchange assay.
Molecular Cell, Volume 51 Supplemental Information Enhanced Chromatin Dynamics by FACT Promotes Transcriptional Restart after UV-Induced DNA Damage Christoffel Dinant, Giannis Ampatziadis-Michailidis,
Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
Supporting Information
Supporting Information Su et al. 10.1073/pnas.1211604110 SI Materials and Methods Cell Culture and Plasmids. Tera-1 and Tera-2 cells (ATCC: HTB- 105/106) were maintained in McCoy s 5A medium with 15% FBS
ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
Supplementary Materials
Supplementary Materials Construction of Synthetic Nucleoli in Human Cells Reveals How a Major Functional Nuclear Domain is Formed and Propagated Through Cell Divisision Authors: Alice Grob, Christine Colleran
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
SUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells
SUPPLEMENTARY INFORMATION Small molecule activation of the TRAIL receptor DR5 in human cancer cells Gelin Wang 1*, Xiaoming Wang 2, Hong Yu 1, Shuguang Wei 1, Noelle Williams 1, Daniel L. Holmes 1, Randal
Hossain_Supplemental Figure 1
Hossain_Supplemental Figure 1 GFP-PACT GFP-PACT Motif I GFP-PACT Motif II A. MG132 (1µM) GFP Tubulin GFP-PACT Pericentrin GFP-PACT GFP-PACT Pericentrin Fig. S1. Expression and localization of Orc1 PACT
Fig. S1. Endocytosis of extracellular cargo does not depend on dia. (A) To visualize endocytosis, fluorescently labelled wheat germ agglutinin
Fig. S1. Endocytosis of extracellular cargo does not depend on dia. (A) To visualize endocytosis, fluorescently labelled wheat germ agglutinin (WGA-Alexa555) was injected into the extracellular perivitteline
Journal of Cell Science Supplementary Material
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 SUPPLEMENTARY FIGURE LEGENDS Figure S1: Eps8 is localized at focal adhesions and binds directly to FAK (A) Focal
Description: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tables Title of file for HTML: Supplementary Movie 1 Description: Nuclear morphology and dynamics
Revision Checklist for Science Signaling Research Manuscripts: Data Requirements and Style Guidelines
Revision Checklist for Science Signaling Research Manuscripts: Data Requirements and Style Guidelines Further information can be found at: http://stke.sciencemag.org/sites/default/files/researcharticlerevmsinstructions_0.pdf.
Supplementary Figure 1. RAD51 and RAD51 paralogs are enriched spontaneously onto
Supplementary Figure legends Supplementary Figure 1. and paralogs are enriched spontaneously onto the S-phase chromatin during DN replication. () Chromatin fractionation was carried out as described in
Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/4/157/ra4/dc1 Supplementary Materials for Genome-Wide RNAi Screen Reveals Disease-Associated Genes That Are Common to Hedgehog and Wnt Signaling Leni S. Jacob,
X2-C/X1-Y X2-C/VCAM-Y. FRET efficiency. Ratio YFP/CFP
FRET efficiency.7.6..4.3.2 X2-C/X1-Y X2-C/VCAM-Y.1 1 2 3 Ratio YFP/CFP Supplemental Data 1. Analysis of / heterodimers in live cells using FRET. FRET saturation curves were obtained using cells transiently
Product: Arrest-In TM Transfection Reagent for RNAi
Product: Arrest-In TM Transfection Reagent for RNAi Catalog #: ATR1740, ATR1741, ATR1742, ATR1743 Product Description Arrest-In transfection reagent is a proprietary polymeric formulation, developed and
over time using live cell microscopy. The time post infection is indicated in the lower left corner.
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Supplementary Movie 1 Description: Fusion of NBs. BSR cells were infected
Supplemental Movie Legend.
Supplemental Movie Legend. Transfected T cells were dropped onto SEE superantigen-pulsed Raji B cells (approximate location indicated by circle). Maximum-intensity projections from Z-stacks (17 slices,
Strep-tag detection in Western blots
Strep-tag detection in Western blots General protocol for the detection of Strep-tag fusion proteins Last date of revision April 2012 Version PR07-0010 www.strep-tag.com For research use only Important
Supplementary Material. TRIB3 inhibits proliferation and promotes osteogenesis in hbmscs by regulating the. ERK1/2 signaling pathway
Supplementary Material TRIB3 inhibits proliferation and promotes osteogenesis in hbmscs by regulating the ERK1/2 signaling pathway Cui Zhang 1, Fan-Fan Hong 1, Cui-Cui Wang 1, Liang Li 1, Jian-Ling Chen
PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF
YFP-PHF1 CFP-PHT1;2 PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF + CFP-PHT1;2 Negative control!-gfp Supplemental Figure 1: PHT1;2 accumulation is PHF1 dependent. Immunoblot analysis on total protein extract
Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous
Preparation and purification of polyclonal antibodies Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous injections of glutathione S-transferase-ARHGAP25-(509-619) (GST-coiled
Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated
Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated reporter luciferase constructs, HEK293T cells were stimulated
Coordinate Regulation of the Mother Centriole Component Nlp by Nek2 and Plk1 Protein Kinases
MOLECULAR AND CELLULAR BIOLOGY, Feb. 2005, p. 1309 1324 Vol. 25, No. 4 0270-7306/05/$08.00 0 doi:10.1128/mcb.25.4.1309 1324.2005 Copyright 2005, American Society for Microbiology. All Rights Reserved.
Heme utilization in the Caenorhabditis elegans hypodermal cells is facilitated by hemeresponsive
Supplemental Data Heme utilization in the Caenorhabditis elegans hypodermal cells is facilitated by hemeresponsive gene-2 Caiyong Chen 1, Tamika K. Samuel 1, Michael Krause 2, Harry A. Dailey 3, and Iqbal
To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well
Supplemental Information: Supplemental Methods: Cell culture To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well in 96 well Primaria plates in GNS media and incubated at
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Kanaani et al., http://www.jcb.org/cgi/content/full/jcb.200912101/dc1 Figure S1. The K2 rabbit polyclonal antibody is specific for GAD67,
Parthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss
SUPPLEMENTARY INFORMATION Parthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss Yunjong Lee, Senthilkumar S. Karuppagounder, Joo-Ho Shin, Yun-Il Lee, Han Seok Ko, Debbie Swing,
Supplemental Information
Molecular Cell, Volume 54 Supplemental Information BRD7, a Tumor Suppressor, Interacts with p85 and Regulates PI3K Activity Yu-Hsin Chiu, Jennifer Y. Lee, and Lewis C. Cantley Supplemental Materials Supplemental
supplementary information
DOI: 10.1038/ncb2017 Figure S1 53BP1 sirna results in a heterochromatic DSB repair defect. Panel A: NIH3T3 cells were transfected with murine 53BP1 sirna. 48 hrs later, cells were irradiated with 3 Gy
Jing Guo, Zhenye Yang, Wei Song, Qi Chen, Fubin Wang, Qiangge Zhang, and Xueliang Zhu
Molecular Biology of the Cell Vol. 17, 680 689, February 2006 Nudel Contributes to Microtubule Anchoring at the Mother Centriole and Is Involved in Both Dyneindependent and -independent Centrosomal Protein
Western-GUARANTEED Antibody Service FAQ
Western-GUARANTEED Antibody Service FAQ Content Q 1: When do I need a Western GUARANTEED Peptide Antibody Package?...2 Q 2: Can GenScript provide a Western blot guaranteed antibody?...2 Q 3: Does GenScript
Supplementary Information
Supplementary Information promotes cancer cell invasion and proliferation by receptor-mediated endocytosis-dependent and -independent mechanisms, respectively Kensaku Shojima, Akira Sato, Hideaki Hanaki,
Supplement Figure 1. Plin5 Plin2 Plin1. KDEL-DSRed. Plin-YFP. Merge
Supplement Figure 1 Plin5 Plin2 Plin1 KDEL-DSRed Plin-YFP Merge Supplement Figure 2 A. Plin5-Ab MitoTracker Merge AML12 B. Plin5-YFP Cytochrome c-cfp merge Supplement Figure 3 Ad.GFP Ad.Plin5 Supplement
Online Supplementary Information
Online Supplementary Information NLRP4 negatively regulates type I interferon signaling by targeting TBK1 for degradation via E3 ubiquitin ligase DTX4 Jun Cui 1,4,6,7, Yinyin Li 1,5,6,7, Liang Zhu 1, Dan
Supplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1.
Supplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1. Percent of original fluorescence was plotted as a function of time following photobleaching
SUPPLEMENTARY INFORMATION
a before amputation regeneration regenerated limb DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS developmental origin: lateral plate mesoderm presomitic mesoderm
Supplemental Information. HEXIM1 and NEAT1 Long Non-coding RNA Form. a Multi-subunit Complex that Regulates. DNA-Mediated Innate Immune Response
Molecular Cell, Volume 67 Supplemental Information HEXIM1 and NEAT1 Long Non-coding RNA Form a Multi-subunit Complex that Regulates DNA-Mediated Innate Immune Response Mehdi Morchikh, Alexandra Cribier,
β-arrestin mediated localization of Smoothened to the primary cilium
Published as: Science. 2008 June 27; 320(5884): 1777 1781. β-arrestin mediated localization of Smoothened to the primary cilium Jeffrey J. Kovacs 1,2, Erin J. Whalen 1, Renshui Liu 1, Kunhong Xiao 3, Jihee
(A) Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site.
SUPPLEMENTRY INFORMTION SUPPLEMENTL FIGURES Figure S1. () Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site. () Western blot of ligated and unligated sciatic
Supplementary materials: Spatiotemporal analysis of RhoA/B/C activation in primary human endothelial cells
Supplementary materials: Spatiotemporal analysis of RhoA/B/C activation in primary human endothelial cells Nathalie R. Reinhard 1,2, Suzanne F. van Helden 2, Eloise C. Anthony 2, Taofei Yin 3., Yi Wu 3,
Microtubules. Forms a sheet of protofilaments that folds to a tube Both tubulins bind GTP
Microtubules Polymerize from a-tubulin/ß-tubulin dimers Hollow tube of 13 protofilaments In vitro- filament number varies In vivo- always 13 protofilaments Forms a sheet of protofilaments that folds to
The microtubule-associated tau protein has intrinsic acetyltransferase activity. Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and
SUPPLEMENTARY INFORMATION: The microtubule-associated tau protein has intrinsic acetyltransferase activity Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and Virginia M.Y. Lee Cohen
Materials and Methods: All strains were derivatives of SK1 and are listed in Supplemental Table 1.
Supplemental Online Material: Materials and Methods: All strains were derivatives of SK1 and are listed in Supplemental Table 1. Constructs: pclb2-3ha-cdc5 and pclb2-3ha-cdc2 strains were constructed by
Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.
Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying
SUPPLEMENTAL MATERIAL. Supplemental Methods. Cumate solution was from System Biosciences. Human complement C1q and complement
SUPPLEMENTAL MATERIAL Supplemental Methods Reagents Cumate solution was from System Biosciences. Human complement Cq and complement C-esterase inhibitor (C-INH) were from Calbiochem. C-INH (Berinert) for
The Nek6 and Nek7 Protein Kinases Are Required for Robust Mitotic Spindle Formation and Cytokinesis
MOLECULAR AND CELLULAR BIOLOGY, July 2009, p. 3975 3990 Vol. 29, No. 14 0270-7306/09/$08.00 0 doi:10.1128/mcb.01867-08 Copyright 2009, American Society for Microbiology. All Rights Reserved. The Nek6 and
SAS-1 Is a C2 Domain Protein Critical for Centriole Integrity in C. elegans
SAS-1 Is a C2 Domain Protein Critical for Centriole Integrity in C. elegans Lukas von Tobel 1., Tamara Mikeladze-Dvali 1. a, Marie Delattre 1 b, Fernando R. Balestra 1, Simon Blanchoud 1, Susanne Finger
GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts
Current Biology, Volume 24 Supplemental Information GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts Wei Zhou, Jin Chang, Xin Wang, Masha G. Savelieff, Yinyin Zhao, Shanshan
Title: Production and characterisation of monoclonal antibodies against RAI3 and its expression in human breast cancer
Author's response to reviews Title: Production and characterisation of monoclonal antibodies against RAI3 and its expression in human breast cancer Authors: Hannah Jörißen (hannah.joerissen@molbiotech.rwth-aachen.de)
Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected
Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected with the sirna against lnc-2, lnc-6, lnc-7, and the
CSPP is a ciliary protein interacting with Nephrocystin 8 and required for cilia formation
CSPP is a ciliary protein interacting with Nephrocystin 8 and required for cilia formation Sebastian Patzke *, Sambra Redick, Abdirashid Warsame, Carlos A. Murga-Zamalloa $,#, Hemant Khanna $, Stephen
Plk1-Dependent Recruitment of c-tubulin Complexes to Mitotic Centrosomes Involves Multiple PCM Components
Plk1-Dependent Recruitment of c-tubulin Complexes to Mitotic Centrosomes Involves Multiple PCM Components Laurence Haren 1, Tim Stearns 2 *, Jens Lüders 3 * 1 Institut de Sciences et Technologies du Médicament
* ** ** * IB: p-p90rsk. p90rsk (Ser380) (arbitrary units) (Ser380) p90rsk. IB: p90rsk. Tubulin. IB: Tubulin. Ang II (200 nm) Ang II (200 nm)
I: p-p9rsk I: p9rsk I: C I: p-p9rsk I: p9rsk 5 (ka) 5 5 (min) Ang II ( nm) p-p9rsk (Ser8) p9rsk p-p9rsk (Ser8) p9rsk (h) Mannitol 5 mm -Glucose 5 mm p9rsk (Ser8) (arbitrary units) p-p9rsk (Ser8) (arbitrary
mcherry Polyclonal Antibody Catalog Number PA Product data sheet
Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 mcherry Polyclonal Antibody Catalog Number PA5-34974 Product data sheet Details Size
Correction: The Leukemia-Associated Mllt10/ Af10-Dot1l Are Tcf4/β-Catenin Coactivators Essential for Intestinal Homeostasis
CORRECTION Correction: The Leukemia-Associated Mllt10/ Af10-Dot1l Are Tcf4/β-Catenin Coactivators Essential for Intestinal Homeostasis Tokameh Mahmoudi, Sylvia F. Boj, Pantelis Hatzis, Vivian S. W. Li,
Supplemental Information. Lysine-5 Acetylation Negatively Regulates. Lactate Dehydrogenase A and Is Decreased. in Pancreatic Cancer
Cancer Cell, Volume 23 Supplemental Information Lysine-5 Acetylation Negatively Regulates Lactate Dehydrogenase A and Is Decreased in Pancreatic Cancer Di Zhao, Shao-Wu Zou, Ying Liu, Xin Zhou, Yan Mo,
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc..4. A B Supplemental Figure. Immunoblot analysis verifies the expression of the AD-PP2C and BD-RGLG proteins in the Y2H assay. Total proteins were extracted
Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation
1 2 3 4 5 SUPPLEMENTAL DATA Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation Magalí Nazar, Juan Pablo Nicola, María Laura
Learning Objectives. Define RNA interference. Define basic terminology. Describe molecular mechanism. Define VSP and relevance
Learning Objectives Define RNA interference Define basic terminology Describe molecular mechanism Define VSP and relevance Describe role of RNAi in antigenic variation A Nobel Way to Regulate Gene Expression
3. Results. 3.1 Generation of HEK293 cell clones stably expressing ETA and ETB receptors
3. Results 3.1 Generation of HEK293 cell clones stably expressing ETA and ETB receptors To investigate the dimerisation of the endothelin receptor subtypes HEK293 cells were stably transfected with plasmids
Supplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse
Supplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse tail DNA. Primers were designed to detect Gna13-WT/f (~400bp/470bp)
SUPPLEMENTARY INFORMATION
doi:.38/nature899 Supplementary Figure Suzuki et al. a c p7 -/- / WT ratio (+)/(-) p7 -/- / WT ratio Log X 3. Fold change by treatment ( (+)/(-)) Log X.5 3-3. -. b Fold change by treatment ( (+)/(-)) 8
One-step split GFP staining for sensitive protein detection and localization in mammalian cells
Supplementary Materials For: One-step split GFP staining for sensitive protein detection and localization in mammalian cells Lara Kaddoum 1,3, Eddy Magdeleine 1,3, Geoffrey S. Waldo 4, Etienne Joly 1,3,
Aaron A. Goodarzi, Angela T. Noon, Dorothee Deckbar, Yael Ziv, Yosef Shiloh, Markus Löbrich, and Penny A. Jeggo
Molecular Cell, Volume 31 Supplemental Data ATM Signaling Facilitates Repair of DNA Double-Strand Breaks Associated with Heterochromatin Aaron A. Goodarzi, Angela T. Noon, Dorothee Deckbar, Yael Ziv, Yosef
Molecular Cloning. Joseph Sambrook. David W. Russell A LABORATORY MANUAL COLD SPRING HARBOR LABORATORY PRESS VOLUME.
VOLUME Molecular Cloning A LABORATORY MANUAL THIRD EDITION www.molecularcloning.com Joseph Sambrook PETER MACCALLUM CANCER INSTITUTE AND THE UNIVERSITY OF MELBOURNE, AUSTRALIA David W. Russell UNIVERSITY
Disruption of Microtubule Organization and Centrosome Function by Expression of Tobacco Mosaic Virus Movement Protein
JOURNAL OF VIROLOGY, June 2006, p. 5807 5821 Vol. 80, No. 12 0022-538X/06/$08.00 0 doi:10.1128/jvi.00254-06 Copyright 2006, American Society for Microbiology. All Rights Reserved. Disruption of Microtubule
Post-expansion antibody delivery, after epitope-preserving homogenization.
Supplementary Figure 1 Post-expansion antibody delivery, after epitope-preserving homogenization. (a, b) Wide-field fluorescence images of Thy1-YFP-expressing mouse brain hemisphere slice before expansion
Supplemental Data Supplementary Figure Legends and Scheme Figure S1.
Supplemental Data Supplementary Figure Legends and Scheme Figure S1. UTK1 inhibits the second EGF-induced wave of lamellipodia formation in TT cells. A and B, EGF-induced lamellipodia formation in TT cells,
by Neurobasal medium (supplemented with B27, 0.5mM glutamine, and 100 U/mL
Supplementary Materials and methods Neuronal cultures and transfection The hippocampus was dissected from E8 rat embryos, dissociated, and neurons plated onto glass coverslips coated with poly-ornithine
Supplemental Information for:
Supplemental Information for: Antibody-induced dimerization of FGFR1 promotes receptor endocytosis independently of its kinase activity Łukasz Opaliński*, Aleksandra Sokołowska-Wędzina, Martyna Szczepara,
RPGR ORF15 isoform co-localizes with RPGRIP1 at centrioles and basal bodies and interacts with nucleophosmin
RPGR ORF15 isoform co-localizes with RPGRIP1 at centrioles and basal bodies and interacts with nucleophosmin X. Shu 1, A.M. Fry 2, B. Tulloch 1, F.D.C. Manson 1,{, J.W. Crabb 3, H. Khanna 4, A.J. Faragher
Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-
#1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals
7.17: Writing Up Results and Creating Illustrations
7.17: Writing Up Results and Creating Illustrations A Results Exercise: Kansas and Pancakes Write a 5-sentence paragraph describing the results illustrated in this figure: - Describe the figure: highlights?
Microtubule Minus-End Stabilization by Polymerization-Driven CAMSAP Deposition
Article Microtubule Minus-End Stabilization by Polymerization-Driven CAMSAP Deposition Kai Jiang, 1 Shasha Hua, 1 Renu Mohan, 1 Ilya Grigoriev, 1 Kah Wai Yau, 1 Qingyang Liu, 1,2 Eugene A. Katrukha, 1
HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid
SUPPLEMENTAL MATERIALS AND METHODS Cell culture, transfection and treatments. HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid encoding vmia (HeLa vmia) 1 were cultured
Protocol for induction of expression and cell lysate production
Protocol for induction of expression and cell lysate production AV-04 Doxycyclin induction and cell lysate 1.0 Introduction / Description This method is intended for the treatment of the previously transfected
The ubiquitin ligase Rnf6 regulates local LIM kinase 1 levels in axonal growth cones
The ubiquitin ligase Rnf6 regulates local LIM kinase 1 levels in axonal growth cones Baris Tursun, 1,5 Anne Schlüter, 1,5 Marvin A. Peters, 1 Birte Viehweger, 1 Heather P. Ostendorff, 1 Juliana Soosairajah,
Lecture 25 (11/15/17)
Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);
Figure S1. Immunoblotting showing proper expression of tagged R and AVR proteins in N. benthamiana.
SUPPLEMENTARY FIGURES Figure S1. Immunoblotting showing proper expression of tagged R and AVR proteins in N. benthamiana. YFP:, :CFP, HA: and (A) and HA, CFP and YFPtagged and AVR1-CO39 (B) were expressed
FLASH, a Proapoptotic Protein Involved in Activation of Caspase-8, Is Essential for 3 0 End Processing of Histone Pre-mRNAs
Article FLASH, a Proapoptotic Protein Involved in Activation of Caspase-8, Is Essential for 3 0 End Processing of Histone Pre-mRNAs Xiao-cui Yang, 1 Brandon D. Burch, 2 Yan Yan, 1 William F. Marzluff,
SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency
Molecular Cell, Volume 52 Supplemental Information SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency Kengo Homma, Takao Fujisawa, Naomi Tsuburaya, Namiko
Ribonomic analysis of human DZIP1 reveals its involvement in ribonucleoprotein complexes and stress granules
Shigunov et al. BMC Molecular Biology 2014, 15:12 RESEARCH ARTICLE Open Access Ribonomic analysis of human DZIP1 reveals its involvement in ribonucleoprotein complexes and stress granules Patrícia Shigunov
IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity
IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p5 activity H6 5 5 H58 A59 H6 H58 A59 anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/3/6/ra27/dc Supplementary Materials for AAA+ Proteins and Coordinate PIKK Activity and Function in Nonsense-Mediated mrna Decay Natsuko Izumi, Akio Yamashita,*
Supplementary Figure 1. Isolation of GFPHigh cells.
Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding
Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover
Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and
affects the development of newborn neurons Brain Mind Institute and School of Life Sciences, Ecole Polytechnique Fédérale de
Shedding of neurexin 3β ectodomain by ADAM10 releases a soluble fragment that affects the development of newborn neurons Erika Borcel* a, Magda Palczynska* a, Marine Krzisch b, Mitko Dimitrov a, Giorgio
The MAP Kinase Family
The MAP Kinase Family Extracellular stimuli Classical MAP kinases Atypical MAP kinases MAPKKK MLK1/2/3/7; LZK RAF-1/A/B TAK1; TPL2 c-mos MEKK1-4; DLK ASK1/2; MLTK TAO1/2 ASK1 TAK1 MEKK1-4 MEKK2/3 TPL2???