supplementary information

Separation of a functional deubiquitylating module from the SAGA complex by the proteasome regulatory particle

Supplementary information for Separation of a functional deubiquitylating module from the SAGA complex by the proteasome regulatory particle Sungsu Lim 1, Jaechan Kwak 1, Minhoo Kim 1 and Daeyoup Lee 1,*

c Nup82-TAP purification

a Dbp5-TAP Nup159-TAP b Dbp5-TAP Dbp5-TAP/dyn2Δ Nup116 Dbp5 Nup159 Nsp1 Nup82 Nup159 Nup116 Nsp1 Nup82 Dbp5 # # 1 2 1 2 Western c Nup82-TAP purification input flow through pull-down 1 2 3 α-nup82 1 2 3

supplementary information

DOI: 10.1038/ncb2007 Figure S1 Temperature sensitivity of DNA ligase I alleles. a, SSL204 (CDC9), SSL612 (cdc9-1) and SSL613 (cdc9-2) cells were spotted in ten-fold serial dilutions on YPD plates and incubated

Kin28 regulates the transient association of mediator with core promoters

Supplementary material for Kin8 regulates the transient association of mediator with core promoters Célia Jeronimo and François Robert, Institut de recherches cliniques de Montréal, Montréal, Québec, Canada.

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Supplementary Figure 1 Detection of MCM-subunit SUMOylation under normal growth conditions. a. Sumoylated forms of MCM subunits show differential shifts when SUMO is attached to differently sized tags.

SUPPLEMENTARY INFORMATION

doi:10.1038/nature11326 Supplementary Figure 1: Histone exchange increases over the ORF in a set2 mutant. (a) Gene average analysis. Schematic representation of the bin distribution over the coding and

SUPPLEMENTARY MATERIALS

SUPPLEMENTARY MATERIALS SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1 Condensin is required for condensation of rdna array during starvation (A) Loss of condensin blocks rdna condensation during

Supplementary Figure 1. Nature Structural & Molecular Biology: doi: /nsmb.3494

Supplementary Figure 1 Pol structure-function analysis (a) Inactivating polymerase and helicase mutations do not alter the stability of Pol. Flag epitopes were introduced using CRISPR/Cas9 gene targeting

SUPPLEMENTARY INFORMATION

doi: 1.138/nature7652 Supplementary Figure legends Figure 1. Diagrammatic representation of the rdna locus on yeast chromosome XII and the processing pathway from 35S full length nascent rrna to mature

supplementary information

DOI: 10.1038/ncb2172 Figure S1 p53 regulates cellular NADPH and lipid levels via inhibition of G6PD. (a) U2OS cells stably expressing p53 shrna or a control shrna were transfected with control sirna or

Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh

Developmental Cell, Volume 22 Supplemental Information Control of Seed Germination by Light-Induced Histone Arginine Demethylation Activity Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary figures Supplementary Figure 1: Suv39h1, but not Suv39h2, promotes HP1α sumoylation in vivo. In vivo HP1α sumoylation assay. Top: experimental scheme. Middle: we

Supplemental Information. The E2F functional analog SBF recruits the Rpd3(L) HDAC, via Whi5 and Stb1,

The E2F functional analog SBF recruits the Rpd3(L) HDAC, via Whi5 and Stb1, and the FACT chromatin reorganizer, to yeast G1 cyclin promoters Shinya Takahata, Yaxin Yu, and David J. Stillman Supplemental

THE JOURNAL OF CELL BIOLOGY

Supplemental Material THE JOURNL OF CELL BIOLOGY Onischenko et al., http://www.jcb.org/cgi/content/full/jcb.200810030/dc1 Figure S1. Characterization of Ndc1 interactions. () Intracellular distribution

42 fl organelles = 34.5 fl (1) 3.5X X 0.93 = 78,000 (2)

SUPPLEMENTAL DATA Supplementary Experimental Procedures Fluorescence Microscopy - A Zeiss Axiovert 200M microscope equipped with a Zeiss 100x Plan- Apochromat (1.40 NA) DIC objective and Hamamatsu Orca

Name Genotype Reference

Supplemental Data Supplemental Table 1 S. cerevisiae strains. Name Genotype Reference RMY200 UKY403 W303-1a MATa ade2-101 (och) his3 200 lys2-801 (amp) trp1 901 ura3-52 hht1,hhf1::leu2 hht2,hhf2::his3

Autophagy induction [h]

A SD-N [h]: SD-N [h]: 1 2 4 1 2 4 1 2 4 -GFP 1 2 4 percentage GFP-Atg8 [%] 1 9 8 7 6 5 4 3 2 1 1 2 4 Autophagy induction [h] -13xmyc SD-N [h]: 1 2 4 -GFP -13xmyc 1 prape1 mape1 - - GFP - 13xmyc mape1 [%]

Supplemental Data. Farmer et al. (2010) Plant Cell /tpc

Supplemental Figure 1. Amino acid sequence comparison of RAD23 proteins. Identical and similar residues are shown in the black and gray boxes, respectively. Dots denote gaps. The sequence of plant Ub is

T H E J O U R N A L O F C E L L B I O L O G Y

Supplemental material JCB Tanaka et al., http://www.jcb.org/cgi/content/full/jcb.201402128/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Nonselective autophagy is normal in Hrr25-depleted

SUPPLEMENTARY INFORMATION

doi:10.1038/nature11070 Supplementary Figure 1 Purification of FLAG-tagged proteins. a, Purification of FLAG-RNF12 by FLAG-affinity from nuclear extracts of wild-type (WT) and two FLAG- RNF12 transgenic

Supplementary Figure 1 Collision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK2, PPK3 and PPK4 respectively.

Supplementary Figure 1 lision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK, PPK3 and PPK respectively. % of nuclei with signal / field a 5 c ppif3:gus pppk1:gus 0 35 30 5 0 15 10

Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.

Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying

Figure S1, related to Figure 1. Characterization of biosensor behavior in vivo.

Developmental Cell, Volume 23 Supplemental Information Separase Biosensor Reveals that Cohesin Cleavage Timing Depends on Phosphatase PP2A Cdc55 Regulation Gilad Yaakov, Kurt Thorn, and David O. Morgan

Supplementary Materials for

www.sciencesignaling.org/cgi/content/full/6/291/ra78/dc1 Supplementary Materials for Regulation of Yeast G Protein Signaling by the Kinases That Activate the AMPK Homolog Snf1 Sarah T. Clement, Gauri Dixit,

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Supplementary Figure 1 Impaired ITS2 processing results in mislocalization of foot-factors to the cytoplasm. (a) Schematic representation of ITS2 processing. The endonuclease Las1 initiates ITS2 processing

Phosphorylation of RNA polymerase CTD dictates transcription

Supplementary Information Phosphorylation of RNA polymerase CTD dictates transcription termination choice Rajani Kanth Gudipati 1,2,3, Tommaso Villa 1,2,3, Jocelyne Boulay 1,2 and Domenico Libri 1,2. 1

Supplementary Methods

Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed

Racine et al, Histone H2B ubiquitylation promotes activity of the intact Set1 histone methyltransferase complex in fission yeast

Supplemental Materials Racine et al, Histone H2B ubiquitylation promotes activity of the intact Set histone methyltransferase complex in fission yeast Supplemental Experimental Procedures Table S Figures

Materials and Methods: All strains were derivatives of SK1 and are listed in Supplemental Table 1.

Supplemental Online Material: Materials and Methods: All strains were derivatives of SK1 and are listed in Supplemental Table 1. Constructs: pclb2-3ha-cdc5 and pclb2-3ha-cdc2 strains were constructed by

supplementary information

DOI: 10.1038/ncb1816 A Gal4 Gal4 B Kinase domain C (1502) N (5111191) Interaction with SIAH1 C SIAH1 SIAH1 C (182) SIAH1 N (82282) RING domain Interaction with Input GST GSTSIAH1 1a a N C Input GST GSTSIAH1

Supporting Information

Supporting Information Üstün and Börnke, 2015 Figure S1: XopJ does not display acetyltransferase activity. Autoacetylation activity in vitro. Acetylation reactions using MBP, MBP-XopJ, GST and GST-HopZ1a

T H E J O U R N A L O F C E L L B I O L O G Y

Supplemental material Thompson et al., http://www.jcb.org/cgi/content/full/jcb.200909067/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Modification-specific antibodies do not detect unmodified

Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the

Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the prey clones identified in the yeast two hybrid screen.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43

Lecture 22 Eukaryotic Genes and Genomes III

Lecture 22 Eukaryotic Genes and Genomes III In the last three lectures we have thought a lot about analyzing a regulatory system in S. cerevisiae, namely Gal regulation that involved a hand full of genes.

(a) Immunoblotting to show the migration position of Flag-tagged MAVS

Supplementary Figure 1 Characterization of six MAVS isoforms. (a) Immunoblotting to show the migration position of Flag-tagged MAVS isoforms. HEK293T Mavs -/- cells were transfected with constructs expressing

Isolation of the recombinant middle and head + middle modules.

Supplementary Figure 1 Isolation of the recombinant middle and head + middle modules. (a) Scheme illustrating the multi-step purification protocol for the reconstituted middle module. Extract from infected

Supplementary Information. Trapping toxins within lipid droplets is a resistance mechanism in fungi

Supplementary Information Trapping toxins within lipid droplets is a resistance mechanism in fungi Wenqiang Chang, 1 Ming Zhang, 1 Sha Zheng, 1 Ying Li, 1 Xiaobin Li, 1 Wei Li, 1 Gang Li, 1 Zhaomin Lin,

Supplementary Information for. Regulation of Rev1 by the Fanconi Anemia Core Complex

Supplementary Information for Regulation of Rev1 by the Fanconi Anemia Core Complex Hyungjin Kim, Kailin Yang, Donniphat Dejsuphong, Alan D. D Andrea* *Corresponding Author: Alan D. D Andrea, M.D. Alan_dandrea@dfci.harvard.edu

Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53

Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -

Received 29 September 2005/Returned for modification 9 November 2005/Accepted 21 November 2005

MOLECULAR AND CELLULAR BIOLOGY, Feb. 2006, p. 1496 1509 Vol. 26, No. 4 0270-7306/06/$08.00 0 doi:10.1128/mcb.26.4.1496 1509.2006 Copyright 2006, American Society for Microbiology. All Rights Reserved.

SUPPLEMENTARY INFORMATION

doi:10.1038/nature12119 SUPPLEMENTARY FIGURES AND LEGENDS pre-let-7a- 1 +14U pre-let-7a- 1 Ddx3x Dhx30 Dis3l2 Elavl1 Ggt5 Hnrnph 2 Osbpl5 Puf60 Rnpc3 Rpl7 Sf3b3 Sf3b4 Tia1 Triobp U2af1 U2af2 1 6 2 4 3

Supplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA

Supplemental Data. Wu et al. (2). Plant Cell..5/tpc..4. A B Supplemental Figure. Immunoblot analysis verifies the expression of the AD-PP2C and BD-RGLG proteins in the Y2H assay. Total proteins were extracted

Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified

Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified by primers used for mrna expression analysis. Gray

Supporting Information

Supporting Information Chen et al. 1.173/pnas.153331112 Fig. S1. The sae2δ-suppressing mre11 alleles: protein level and location. (A) Protein level of Mre11 and Mre11 P11L expressed from the endogenous

Supplemental Figure 1 Human REEP family of proteins can be divided into two distinct subfamilies. Residues (single letter amino acid code) identical

Supplemental Figure Human REEP family of proteins can be divided into two distinct subfamilies. Residues (single letter amino acid code) identical in all six REEPs are highlighted in green. Additional

SUPPLEMENTARY INFORMATION

DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation

SUPPLEMENTARY INFORMATION

Supplementary Table 1 Components of the RAD6 damage tolerance pathway in yeast and humans S. cerevisiae Homo sapiens Functions Rad6 HHR6A and HHR6B Ubiquitin conjugating enzyme (E2) Rad18 RAD18 Ubiquitin

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Karotki et al., http://www.jcb.org/cgi/content/full/jcb.201104040/dc1 Figure S1. Eisosome proteins form highly stable filaments of variable

An mrna decapping mutant deficient in P body assembly limits mrna stabilization in response to osmotic stress

An mrna decapping mutant deficient in P body assembly limits mrna stabilization in response to osmotic stress SUPPLEMENTAL INFORMATION Susanne Huch and Tracy Nissan Supplementary Information Figure S1.

Jack et al. Jack et al. Supporting Information. Materials and Methods

Supporting Information Materials and Methods Yeast strains and media Yeast strains (Table S1) were created by standard methods: cassettes were amplified from the pfa6a plasmid series (1, 2), pfa6a-leu2

Supplementary Figures 1-12

Supplementary Figures 1-12 Supplementary Figure 1. The specificity of anti-abi1 antibody. Total Proteins extracted from the wild type seedlings or abi1-3 null mutant seedlings were used for immunoblotting

Recombinant DNA procedures were carried out as described previously (Sambrook and

Supplemental information Plasmids construction Recombinant DNA procedures were carried out as described previously (Sambrook and Russell 2006). XbaI-EcoRI fragment of pit798 (Inada and Aiba 2005) was inserted

Supplemental Materials

Supplemental Materials Flores-Pérez et al., Supplemental Materials, page 1 of 5 Supplemental Figure S1. Pull-down and BiFC controls, and quantitative analyses associated with the BiFC studies. (A) Controls

7.03, 2006, Lecture 23 Eukaryotic Genes and Genomes IV

1 Fall 2006 7.03 7.03, 2006, Lecture 23 Eukaryotic Genes and Genomes IV In the last three lectures we have thought a lot about analyzing a regulatory system in S. cerevisiae, namely Gal regulation that

7.05, 2005, Lecture 23 Eukaryotic Genes and Genomes IV

7.05, 2005, Lecture 23 Eukaryotic Genes and Genomes IV In the last three lectures we have thought a lot about analyzing a regulatory system in S. cerevisiae, namely Gal regulation that involved a hand

Supplementary Figure S1 Purification of deubiquitinases HEK293 cells were transfected with the indicated DUB-expressing plasmids.

Supplementary Figure S1 Purification of deubiquitinases HEK293 cells were transfected with the indicated DUB-expressing plasmids. The cells were harvested 72 h after transfection. FLAG-tagged deubiquitinases

Regulation of ARE transcript 3 end processing by the. yeast Cth2 mrna decay factor

Regulation of ARE transcript 3 end processing by the yeast Cth2 mrna decay factor Manoël Prouteau, Marie-Claire Daugeron and Bertrand Séraphin Supplementary Information Material and Methods Plasmid construction

Figure S1. Immunoblotting showing proper expression of tagged R and AVR proteins in N. benthamiana.

SUPPLEMENTARY FIGURES Figure S1. Immunoblotting showing proper expression of tagged R and AVR proteins in N. benthamiana. YFP:, :CFP, HA: and (A) and HA, CFP and YFPtagged and AVR1-CO39 (B) were expressed

Supplementary Figure 1. Immunoprecipitation of synthetic SUMOm-remnant peptides using UMO monoclonal antibody. (a) LC-MS analyses of tryptic

Supplementary Figure 1. Immunoprecipitation of synthetic SUMOm-remnant peptides using UMO 1-7-7 monoclonal antibody. (a) LC-MS analyses of tryptic digest from HEK293 cells spiked with 6 SUMOmremnant peptides

A RRM1 H2AX DAPI. RRM1 H2AX DAPI Merge. Cont. sirna RRM1

A H2AX DAPI H2AX DAPI Merge Cont sirna Figure S1: Accumulation of RRM1 at DNA damage sites (A) HeLa cells were subjected to in situ detergent extraction without IR irradiation, and immunostained with the

Aspergillus fumigatus CalA binds to integrin α 5 β 1 and mediates host cell invasion

In the format provided by the authors and unedited. SUPPLEMENTARY INFORMATION ARTICLE NUMBER: 16211 DOI: 10.1038/NMICROBIOL.2016.211 Aspergillus fumigatus CalA binds to integrin α 5 β 1 and mediates host

SUPPLEMENTARY INFORMATION

doi:10.1038/nature11355 Supplemental Table 1. Gene targeting efficiency in mutants of nonessential genes. This table is presented as a separate Excel file. Supplemental Table 2. Genes with altered expression

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Han et al., http://www.jcb.org/cgi/content/full/jcb.201311007/dc1 Figure S1. SIVA1 interacts with PCNA. (A) HEK293T cells were transiently

Schematic representation of the endogenous PALB2 locus and gene-disruption constructs

Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying

Nature Methods: doi: /nmeth Supplementary Figure 1. Construction of a sensitive TetR mediated auxotrophic off-switch.

Supplementary Figure 1 Construction of a sensitive TetR mediated auxotrophic off-switch. A Production of the Tet repressor in yeast when conjugated to either the LexA4 or LexA8 promoter DNA binding sequences.

Supplemental Data. Zhang et al. Plant Cell (2014) /tpc

Supplemental Data. Zhang et al. Plant Cell (214) 1.115/tpc.114.134163 55 - T C N SDIRIP1-GFP 35-25 - Psb 18 - Histone H3 Supplemental Figure 1. Detection of SDIRIP1-GFP in the nuclear fraction by Western

SUPPLEMENTARY INFORMATION

doi: 10.1038/nature06721 SUPPLEMENTARY INFORMATION. Supplemental Figure Legends Supplemental Figure 1 The distribution of hatx-1[82q] in Cos7 cells. Cos7 cells are co-transfected with hatx-1[82q]-gfp (green)

monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal antibody was examined in

Supplementary information Supplementary figures Supplementary Figure 1 Determination of the s pecificity of in-house anti-rhbdd1 mouse monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal

indicated numbers of pups at day of life (DOL) 10, or embryonic day (ED) B. Male mice of

SUPPLEMENTRY FIGURE LEGENDS Figure S1. USP44 loss leads to chromosome missegregation.. Genotypes obtained from the indicated numbers of pups at day of life (DOL) 10, or embryonic day (ED) 13.5.. Male mice

Supplementary Figure h HO -GFP-Atg h HO -GFP-Atg8. 8 Breaks. 1 Break - GFP -GFP. No Breaks.

A 1 Break 0 6 12 18 24h HO 8 Breaks 0 6 12 15 18 24h HO - GFP No Breaks C rad9 0 1 2 3 4 h - GFP B mec1δ WT mec1δ tel1δ tel1δ Rapamycin Normalized GFP ratio 1.2 1 0.8 0.6 0.4 0.2 0 D WT rad53δ chk1δ rad53δ

SUPPLEMENTARY INFORMATION

DOI: 10.1038/ncb3209 Supplementary Figure 1 IR induces the association of FH with chromatin. a, U2OS cells synchronized by thymidine double block (2 mm) underwent no release (G1 phase) or release for 2

Western blot showing expression of mutant Sec63p. The strains used in Figure 7 were treated

Supplemntary figure legend Western blot showing expression of mutant Sec63p. The strains used in Figure 7 were treated with methionine to repress transcription of genomic SEC63, and total protein extracts

Supplementary Information to: Genome-wide Real-time in vivo Transcriptional Dynamics During Plasmodium falciparum. Blood-stage Development

Supplementary Information to: Genome-wide Real-time in vivo Transcriptional Dynamics During Plasmodium falciparum Blood-stage Development Painter et al. 1 of 8 Supplementary Figure 1: Supplementary Figure

S156AT168AY175A (AAA) were purified as GST-fusion proteins and incubated with GSTfused

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 Supplemental Materials Supplemental Figure S1 (a) Phenotype of the wild type and grik1-2 grik2-1 plants after 8 days in darkness.

Biology Open (2016): doi: /bio : Supplementary information. Biology Open Supplementary information

Table S1. Strains used in this study Strain Genotype Source JC470 MATa; ade2-1 trp1-1 his3-11 his3-15 ura3-1 leu2-3 leu2-112, RAD5+ (W303) JC471 MAT ; ade2-1 trp1-1 his3-11 his3-15 ura3-1 leu2-3 leu2-112,

SUPPLEMENTARY INFORMATION

(Supplementary Methods and Materials) GST pull-down assay GST-fusion proteins Fe65 365-533, and Fe65 538-700 were expressed in BL21 bacterial cells and purified with glutathione-agarose beads (Sigma).

pgbkt7 Anti- Myc AH109 strain (KDa) 50

pgbkt7 (KDa) 50 37 Anti- Myc AH109 strain Supplementary Figure 1. Protein expression of CRN and TDR in yeast. To analyse the protein expression of CRNKD and TDRKD, total proteins extracted from yeast culture

Supplementary Figures

Supplementary Figures 11 1 1 Supplementary Figure 1. Clinical features of EBS cases with KLHL mutations. (a) Photo of Patient 1 s hands showing mild atrophic skin and unaffected finger nails. (b) The skin

DOI: 10.1038/ncb3259 A Ismail et al. Supplementary Figure 1 B 60000 45000 SSC 30000 15000 Live cells 0 0 15000 30000 45000 60000 FSC- PARR 60000 45000 PARR Width 30000 FSC- 15000 Single cells 0 0 15000

Supplemental Data. Cui et al. (2012). Plant Cell /tpc a b c d. Stem UBC32 ACTIN

A Root Stem Leaf Flower Silique Senescence leaf B a b c d UBC32 ACTIN C * Supplemental Figure 1. Expression Pattern and Protein Sequence of UBC32 Homologues in Yeast, Human, and Arabidopsis. (A) Expression

Supplementary Figure 1. The Hsp70 acetylation level is related to the co-chaperone binding of Hsp70 under various stress conditions.

Supplementary Figure 1. The Hsp70 acetylation level is related to the co-chaperone binding of Hsp70 under various stress conditions. 1 (a) Etoposide treatment gradually changes acetylation level and co-chaperone

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.

/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG

Supplemental Data Genetic and Epigenetic Regulation of the FLO Gene Family Generates Cell-Surface Variation in Yeast

Supplemental Data Genetic and Epigenetic Regulation of the FLO Gene Family Generates Cell-Surface Variation in Yeast S1 Adrian Halme, Stacie Bumgarner, Cora Styles and Gerald R. Fink Yeast Strain Construction

Figure 1: RNAse treatment does not decrease the interaction between She2p-myc and

Shen et al. 1 SUPPLEMENTARY DATA SUPPLEMENTARY FIGURES Figure 1: RNAse treatment does not decrease the interaction between She2p-myc and Rpb1p in spt4 and spt5 mutant strains. (A) Deletion of SPT4 decreases

GFP CCD2 GFP IP:GFP

D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant

Supporting Online Material for

www.sciencemag.org/cgi/content/full/314/5800/815/dc1 Supporting Online Material for FG-Rich Repeats of Nuclear Pore Proteins Form a Three-Dimensional Meshwork with Hydrogel-Like Properties Steffen Frey,

Supplementary Materials for

www.sciencesignaling.org/cgi/content/full/3/146/ra80/dc1 Supplementary Materials for DNMT1 Stability Is Regulated by Proteins Coordinating Deubiquitination and Acetylation-Driven Ubiquitination Zhanwen

Fig. S1. CrgA intracellular levels in M. tuberculosis. Ten and twenty micrograms of

Supplementary data Fig. S1. CrgA intracellular levels in M. tuberculosis. Ten and twenty micrograms of cell free protein lysates from WT M. tuberculosis (Rv) together with various known concentrations

Revised: RG-RV2 by Fukuhara et al.

Supplemental Figure 1 The generation of Spns2 conditional knockout mice. (A) Schematic representation of the wild type Spns2 locus (Spns2 + ), the targeted allele, the floxed allele (Spns2 f ) and the

Chapter 14 Regulation of Transcription

Chapter 14 Regulation of Transcription Cis-acting sequences Distance-independent cis-acting elements Dissecting regulatory elements Transcription factors Overview transcriptional regulation Transcription

Supplemental Data. Hu et al. Plant Cell (2017) /tpc

1 2 3 4 Supplemental Figure 1. DNA gel blot analysis of homozygous transgenic plants. (Supports Figure 1.) 5 6 7 8 Rice genomic DNA was digested with the restriction enzymes EcoRⅠ and BamHⅠ. Lanes in the

Nature Structural & Molecular Biology: doi: /nsmb.1583

Acetylation by GCN5 regulates CDC6 phosphorylation in the S-phase of the cell cycle Roberta Paolinelli 1,2, Ramiro Mendoza-Maldonado 2, Anna Cereseto 1 and Mauro Giacca 2 1 Molecular Biology Laboratory,

SUPPLEMENTARY INFORMATION

DOI: 1.1/ncb2918 Supplementary Figure 1 (a) Biotin-dUTP labelling does not affect S phase progression. Cells synchronized in mid-s phase were labelled with biotindutp during a 5 min hypotonic shift (red)

Sarker et al. Supplementary Material. Subcellular Fractionation

Supplementary Material Subcellular Fractionation Transfected 293T cells were harvested with phosphate buffered saline (PBS) and centrifuged at 2000 rpm (500g) for 3 min. The pellet was washed, re-centrifuged

supplementary information

DOI: 10.1038/ncb2116 Figure S1 CDK phosphorylation of EZH2 in cells. (a) Comparison of candidate CDK phosphorylation sites on EZH2 with known CDK substrates by multiple sequence alignments. (b) CDK1 and

SUPPLEMENTARY INFORMATION

DOI:.38/ncb54 sensitivity (+/-) 3 det- WS bri-5 BL (nm) bzr-dbri- bzr-d/ bri- g h i a b c d e f Hypcocotyl length(cm) 5 5 PAC Hypocotyl length (cm)..8..4. 5 5 PPZ - - + + + + - + - + - + PPZ - - + + +

Supplementary Information

Supplementary Information Supplementary Figure 1. Elevated Smurf1 expression is associated with the progression of colorectal cancer. (a) The tumor microarray analysis with anti-smurf1 antibody. (b) Box

Nature Structural & Molecular Biology: doi: /nsmb.3018

Supplementary Figure 1 Validation of genetic complementation assay in Bmal1 / Per2 Luc fibroblasts. (a) Only Bmal1, not Bmal2, rescues circadian rhythms from cells. Cells expressing various Bmal constructs