JCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Prospéri et al.,
|
|
- Derick Miles
- 6 years ago
- Views:
Transcription
1 Supplemental material JCB Prospéri et al., THE JOURNAL OF CELL BIOLOGY Figure S1. Myo1b Tail interacts with YFP-EphB2 coated beads and genistein inhibits Myo1b phosphorylation. (A) YFP-EphB2 has been pulled down with GFP-Trap beads from Hek293T cells expressing this recombinant protein. The same amount of YFP-EphB2 beads were then incubated with isolated GST or recombinant GST-Myo1b-Tail and analyzed by SDS-PAGE and immunoblot using anti-gst antibodies. 1/10 of the samples have been analyzed by SDS- PAGE and anti-ephb2 antibodies. For comparison, 50 ng of GST and GST-Myo1b-Tail were detected by immunoblotting using anti-gst antibodies (Input). (B) EGFP-Myo1b has been pulled down with GFP-Trap beads from Hek293T cell lysate (Input) expressing EGFP-Myo1b and Flag-EphB2 after treatment with 1% DMSO containing or not 100 µm genistein (EMD Millipore) for 1 h at 37 C. 70% of the pull-down was loaded to detect the coip of Flag-EphB2, while 4% was loaded to detect EGFP-Myo1b and EGFP-Myo1b tyrosine phosphorylation. Note that tyrosine phosphorylation of Flag-EphB2 that coip with Myo1b is hardly detectable in these conditions. (C) The amounts of Flag-EphB2 that coip with EGFP-Myo1b and phosphorylated Myo1b in the absence or in presence of genistein treatment were quantified as described in Material and methods, normalized to the amount of EGFP-Myo1b pulled down, and expressed as a percentage of the amount detected in the presence of DMSO. Data are shown as the mean of three experiments. Error bars represent ± SEM. JCB 2015 Myosin 1b, an effector of EphB signaling Prospéri et al. S16 S17
2 Figure S2. Characterization of the cells expressing Cherry-ephrinB1 or YFP-EphB2. (A) Expression of endogenous EphB2 in Hek293T and HCT116 cells and expression of YFP-EphB2 in the isolated cellular pools were analyzed by SDS-PAGE and immunoblotted with anti-ephb2 antibodies. Tubulin was used as a loading control. Note that the level of Myo1b expression is not affected by expression of YFP-EphB2. (B) Expression of endogenous ephrinb1 in Hek293T and HCT116 cells and expression of Cherry-ephrinB1 in the isolated cellular pools were analyzed by SDS-PAGE and immunoblotted with anti-ephrinb1 antibodies. Tubulin was used as a loading control. Note that the level of Myo1b expression is not affected by expression of Cherry-ephrinB1. (C and D) YFP-EphB2 was immunoprecipitated from YFP-EphB2-HCT116 (C) and YFP-EphB2- Hek293T (D) cells treated or not for 10 min with ephrinb1-fc and analyzed by immunoblotting with anti-ephb2 or anti-phosphotyrosine antibodies. Note the increase of phosphorylation of EphB2 when the cells were stimulated with ephrinb1. (E and F) YFP-EphB2 and Cherry-ephrinB1 available at the cell surface of HCT116 (E) or Hek293T (F) cellular pools and wild-type cells were detected by incubating cells for 30 min at 4 C with clustered ephrinb1-fc or EphB2-Fc, respectively, and detected with fluorescent goat anti-igg as described in Materials and methods. Note that both YFP-EphB2 and Cherry-ephrinB1 are available at the cell surface of the cellular pools but endogenous EphB2 receptors and ephrinb1 were not detected at the surface of the wild-type cells. E and F are shown at the same magnification. Bar, 20 µm. S17
3 Figure S3. Analysis of the number of cells per islet formed. A corresponds to Fig. 3 A and shows the overlay of the phase-contrast images (gray) and fluorescent images (green) of YFP-EphB2 expressing cells (green) transfected with control or Myo1b sirnas and cocultivated with Cherry-ephrinB1-HCT116 or Cherry-HCT116 cells. (B) To identify the YFP-EphB2 islets, YFP images were first manually thresholded under ImageJ (Schneider et al., 2012) using the YFP images overlaid with the Cherry images corresponding to Cherry-ephrinB1 or Cherry-expressing cells as a visual reference. (C) Cherry cells growing occasionally on top of YFP cells (see Fig. 4 and Video 2); Cherry images were manually thresholded and subtracted from YFP masks for all the different co-cultures. (D) To eliminate sparse pixels a Gaussian filter radius of 15 pixels (9.45 µm) was applied to the resulting corrected YFP mask. Islets were then manually thresholded from this blurred image using the composite image (B) as a reference. (E) To quantify the number of nuclei present in the islets, DAPI images were used and a Cell Profiler (Lamprecht et al., 2007) pipeline was created. First DAPI intensity was enhanced by a logarithm transform. (F) Then the centers of nuclei were identified as the local minima of the Laplacien of Gaussian-filtered DAPI images for which the Gaussian radius was set to the mean size of nuclei and reconstructed by watershed. Nuclei were counted in the islets only if half of each nuclei and their center were inside the islet mask. Islets touching the image border were discarded. Bars, 150 µm. JCB 2015 Myosin 1b, an effector of EphB signaling Prospéri et al. S18 S19
4 Figure S4. Efficiency of Myo1b sirnas. (A) YFP-EphB2-HCT116 cells transfected with 10 nm of control or Myo1b sirnas were analyzed by SDS-PAGE and immunoblotting with anti-myo1b antibodies 48 and 72 h after transfection. Tubulin was used as a loading control. Note the important reduction of Myo1b in cells transfected with Myo1b sirna. (B) To quantify EphB2 at the surface of YFP-EphB2-HCT116 cells transfected with 10 nm of control or Myo1b sirnas, cells were incubated with clustered ephrinb1-fc as described in Materials and methods and the ratio of fluorescence detected at the cell surface for bound ephrinb1 over the fluorescence detected for YFP-EphB2 that represents the total amount of receptors was calculated for both experimental conditions and expressed in arbitrary unit. Data are shown as the mean of three experiments. Error bars represent ± SEM (n = 45 for cells transfected with control sirna and n = 46 for cells transfected with Myo1b sirna). Paired Student s t test was used to analyze the probabilities of these data: P = Note that the difference is not significant. (C) YFP-EphB2-Hek293T cells transfected with 10 nm of control or Myo1b sirnas were analyzed by SDS-PAGE and immunoblotting with anti-myo1b antibodies 48 and 96 h after transfection. Tubulin was used as a loading control. Note the important reduction of Myo1b in cells transfected with Myo1b sirna. (D) To quantify EphB2 at the surface of YFP-EphB2-HEK293T cells transfected with 10 nm of control or Myo1b sirnas, cells were incubated with clustered ephrinb1-fc as described Materials and methods and the ratio of fluorescence detected at the cell surface for bound ephrinb1 over the fluorescence detected for YFP-EphB2 that represents the total amount of receptors was calculated for both experimental conditions and expressed in arbitrary units. Data are shown as the mean of three experiments. Error bars represent ± SEM. n = 48 for cells transfected with control sirna and cells transfected with Myo1b sirna. Paired Student s t test was used to analyze the probabilities of these data: P = Note that the difference is not significant. (E) YFP-EphB2- HCT116 cells transfected with Myo1b or control sirnas were stimulated 10 min or not with clustered ephrinb1-fc and analyzed by SDS-PAGE and immunoblotted with anti-pmlc(ser19). Tubulin was used as loading control. (F) The amount of pmlc(ser19) in YFP-EphB2- HCT116 cells transfected with Myo1b or control sirnas and treated 10 min with clustered ephrinb1-fc has been quantified as described in Materials and methods and normalized to the amount of tubulin detected in the sample. Data are shown as the mean of three experiments. Error bars represent ± SEM. (G) To determine the efficiency of fascin sirna, YFP-EphB2-HCT116 cells transfected with 30 nm of control or fascin sirnas were analyzed by SDS-PAGE and immunoblotting with anti-fascin antibodies 48 h after transfection. Tubulin was used as a loading control. Note the reduction of fascin in cells transfected with fascin sirna. (H) To determine the efficiency of fascin sirna, YFP-EphB2-Hek293T cells transfected with 10 nm of control or fascin sirnas were analyzed by SDS-PAGE and immunoblotting with anti-fascin antibodies 48 h after transfection. Tubulin was used as a loading control. Note the important reduction of fascin in cells transfected with fascin sirna. (I) Distribution of NMM2 was analyzed by immunofluorescence labeling and 3D fluorescent microscopy in YFP-EphB2-HCT116 cells transfected with 30 nm of control or fascin sirnas stimulated or not with ephrinb1-fc for 10 min. Bar, 8.5 µm. (J) HUVECs transfected with 10 nm of control or Myo1b sirnas were analyzed by SDS-PAGE and immunoblotting with anti-myo1b antibodies 48 h after transfection. Tubulin was used as a loading control. Note the important reduction of Myo1b in cells transfected with Myo1b sirna. S19
5 Figure S5. HUVECs expressing endogenous EphB receptors form filopodia when they contact Cherry-ephrinB1 expressing HUVECs before cell repulsion. (A) First frame of the overlay of the Cherry and GFP fluorescence of HUVECs transfected with GFP-LifeAct or Cherry-ephrinB1, cocultivated, treated or not with DMSO, and analyzed by spinning disk confocal microscopy (Video 3, A and B). Bars, 15 µm. The colored squares represent the enlarged regions shown in B. (B) The sequences of the overlay of Cherry and GFP images from time 0 to 14 min from Video 3 show the formation of protrusions at the interface of cells expressing ephrinb1 and those expressing LifeAct before cell repulsion. The white lines outline the edge of the cells expressing LifeAct in contact with the ephrinb1-expressing cell at the beginning of the videos. Note that filopodia are growing out from the cell edge. Video 1. Related to Fig. 4. Representative videos of a YFP-EphB2-HCT116 cell that contacts a Cherry-ephrinB1- HCT116 cell (A) and another one that contacts a Cherry-HCT116 cell (B). Cell behavior was monitored at 37 C and under 10% CO 2 by timelapse imaging using spinning disk confocal microscopy. The overlaid focal planes of cells expressing Cherry-ephrinB1 (red) and YFP-EphB2 (green) are shown. Images were acquired at 1 frame/5 min during 3 h 40 min. Bars,15 µm. Video 2. Related to Fig. 4. Representative videos of YFP-EphB2-HCT116 cells that contact Cherry-ephrinB1-HCT116 cells after 30-min incubation with 50 µm blebbistatin in DMSO, 1 µm PCIP in DMSO, or only DMSO. Cell behavior was monitored at 37 C and under 10% CO 2 by time-lapse imaging using spinning disk confocal microscopy. The overlaid focal planes of cells expressing Cherry-ephrinB1 (red) and YFP-EphB2 (green) are shown. Images were acquired at 1 frame/min during 3 h. Bars, 15 µm. Video 3. Related to Figs. 5 and S5. Representative videos of HUVECs transfected with the plasmid encoding GFP-LifeAct that contacts HUVECs transfected with the plasmid encoding Cherry-ephrinB1 without treatment (A) or after 30-min incubation with 2 µm PCIP (C) in DMSO or with DMSO (B). Cell behavior was monitored at 37 C and under 10% CO 2 by time-lapse imaging using spinning disk confocal microscopy. The overlaid focal planes of cells expressing Cherry-ephrinB1 (red) and GFP-LifeAct (green) are shown. Images were acquired at 1 frame/min during 3 h. Bars, 15 µm. JCB 2015 Myosin 1b, an effector of EphB signaling Prospéri et al. S20 S21
6 Video 4. Related to Fig. 5. Representative videos of HUVECs transfected with the plasmid encoding GFP-LifeAct and control or Myo1b sirna and in contact with HUVECs transfected with the plasmid encoding Cherry-ephrinB1. Cell behavior was monitored at 37 C and under 10% CO 2 by time-lapse imaging using spinning disk confocal microscopy. The overlaid focal planes of cells expressing Cherry-ephrinB1 (red) and GFP-LifeAct (green) are shown. Images were acquired at 1 frame/ min during 3 h. Bar, 15 µm. Video 5. Related to Fig. 6. Representative videos of YFP-EphB2-HCT116 cells transfected with control sirna, Myo1b sirna, and fascin sirna that contacts Cherry-ephrinB1-HCT116 cells. Cell behavior was monitored at 37 C and under 10% CO 2 by time-lapse imaging using spinning disk confocal microscopy. The overlaid focal planes of cells expressing Cherry-ephrinB1 (red) and cells expressing YFP-EphB2 (green) are shown. Images were acquired at 1 frame/min during 3 h. Bar,15 µm. Video 6. Related to Fig. 7 A. Representative videos of YFP-EphB2-Hek293T cells transfected with control sirna and cultivated in front of other YFP-EphB2-Hek293T cells transfected with control sirna (A) or Cherry-ephrinB1-Hek293T (B) cells analyzed by fluorescence. Cell behavior was monitored at 37 C and under 10% CO 2 by time-lapse imaging using video microscopy. Images were acquired at 1 frame/5 min. Bar, 10 µm. Video 7. Related to Fig. 7 D. Representative video of YFP-EphB2-Hek293T cells transfected with control sirna and cultivated in front of Cherry-ephrinB1-Hek293T analyzed by phase contrast (A) or fluorescence to visualize YFP-EphB2 (B). Cell behavior was monitored at 37 C and under 10% CO 2 by time-lapse imaging using video microscopy. Images were acquired at 1 frame/10 s. Bars, 10 µm. Video 8. Related to Fig. 7 D. Representative video of YFP-EphB2-Hek293T cells transfected with Myo1b sirna and cultivated in front of Cherry-ephrinB1-Hek293T analyzed by phase contrast (A) or fluorescence to visualize YFP-EphB2 (B). Cell behavior was monitored at 37 C and under 10% CO 2 by time-lapse imaging using video microscopy. Images were acquired at 1 frame/10 s. Bars, 10 µm. Video 9. Related to Fig. 8 A. Representative video of YFP-EphB2-Hek293T cells transfected with control sirna and stimulated with clustered ephrinb1-fc (red arrow). Cell behavior was monitored at 37 C and under 10% CO 2 by time-lapse imaging using spinning disk confocal microscopy. Images were acquired at 1 frame/10 s. Bar, 5 µm. S21
7 Video 10. Related to Fig. 8 B. Representative video of YFP-EphB2-Hek293T cells transfected with a plasmid encoding MRLC- RFP and stimulated with clustered ephrinb1-fc (red arrow). Cell behavior was monitored at 37 C and under 10% CO 2 by timelapse imaging using spinning disk confocal microscopy. Images were acquired at 1 frame/10 s. Bar, 5 µm. References Lamprecht, M.R., D.M. Sabatini, and A.E. Carpenter CellProfiler: free, versatile software for automated biological image analysis. Biotechniques. 42: Schneider, C.A., W.S. Rasband, and K.W. Eliceiri NIH Image to ImageJ: 25 years of image analysis. Nat. Methods. 9: nmeth.2089 S22 JCB 2015 Myosin 1b, an effector of EphB signaling Prospéri et al. S22
SUPPLEMENTARY INFORMATION
a 14 12 Densitometry (AU) 1 8 6 4 2 t b 16 NMHC-IIA GAPDH NMHC-IIB Densitometry (AU) 14 12 1 8 6 4 2 1 nm 1 nm 1 nm 1 nm sirna 1 nm 1 nm Figure S1 S4 Quantification of protein levels. (a) The microtubule
More informationJCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Paul et al.,
Supplemental material JCB Paul et al., http://www.jcb.org/cgi/content/full/jcb.201502040/dc1 THE JOURNAL OF CELL BIOLOGY Figure S1. Mutant p53-expressing cells display limited retrograde actin flow at
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Allison et al., http://www.jcb.org/cgi/content/full/jcb.201211045/dc1 Figure S1. Spastin depletion causes increased endosomal tubulation.
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Nakajima and Tanoue, http://www.jcb.org/cgi/content/full/jcb.201104118/dc1 Figure S1. DLD-1 cells exhibit the characteristic morphology
More informationJCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Hong et al.,
Supplemental material JCB Hong et al., http://www.jcb.org/cgi/content/full/jcb.201412127/dc1 THE JOURNAL OF CELL BIOLOGY Figure S1. Analysis of purified proteins by SDS-PAGE and pull-down assays. (A) Coomassie-stained
More informationQuantitative analysis of Bidirectional Signaling (qbids)
Quantitative analysis of Bidirectional Signaling (qbids) EphB2 + cells were labeled independently with light (C 12 N 14 ) arginine and lysine or heavy (C 13 N 15 ) arginine and lysine ephrin-b1 + cells
More informationSupplementary Information
Supplementary Information Supplementary Figure 1: Over-expression of CD300f in NIH3T3 cells enhances their capacity to phagocytize AC. (a) NIH3T3 cells were stably transduced by EV, CD300f WT or CD300f
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2271 Supplementary Figure a! WM266.4 mock WM266.4 #7 sirna WM266.4 #10 sirna SKMEL28 mock SKMEL28 #7 sirna SKMEL28 #10 sirna WM1361 mock WM1361 #7 sirna WM1361 #10 sirna 9 WM266. WM136
More informationSupplementary Figure 1. Confirmation of sirna in PC3 and H1299 cells PC3 (a) and H1299 (b) cells were transfected with sirna oligonucleotides
Supplementary Figure 1. Confirmation of sirna in PC3 and H1299 cells PC3 (a) and H1299 (b) cells were transfected with sirna oligonucleotides targeting RCP (SMARTPool (RCP) or two individual oligos (RCP#1
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for Integrative Biology. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information Table S1. Definition of quantitative cellular features
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Rainero et al., http://www.jcb.org/cgi/content/full/jcb.201109112/dc1 Figure S1. The expression of DGK- is reduced upon transfection
More informationSupporting Information
Supporting Information Stavru et al. 0.073/pnas.357840 SI Materials and Methods Immunofluorescence. For immunofluorescence, cells were fixed for 0 min in 4% (wt/vol) paraformaldehyde (Electron Microscopy
More informationSUPPLEMENTARY INFORMATION
(Supplementary Methods and Materials) GST pull-down assay GST-fusion proteins Fe65 365-533, and Fe65 538-700 were expressed in BL21 bacterial cells and purified with glutathione-agarose beads (Sigma).
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Han et al., http://www.jcb.org/cgi/content/full/jcb.201311007/dc1 Figure S1. SIVA1 interacts with PCNA. (A) HEK293T cells were transiently
More informationAoki et al.,
JCB: SUPPLEMENTAL MATERIAL Aoki et al., http://www.jcb.org/cgi/content/full/jcb.200609017/dc1 Supplemental materials and methods Calculation of the raw number of translocated proteins First, the average
More informationsupplementary information
DOI: 10.1038/ncb2172 Figure S1 p53 regulates cellular NADPH and lipid levels via inhibition of G6PD. (a) U2OS cells stably expressing p53 shrna or a control shrna were transfected with control sirna or
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/404/ra120/dc1 Supplementary Materials for The subcellular localization and activity of cortactin is regulated by acetylation and interaction with Keap1 Akihiro
More informationPlutoni et al., http :// /cgi /content /full /jcb /DC1
Supplemental material JCB Plutoni et al., http ://www.jcb.org /cgi /content /full /jcb.201505105 /DC1 THE JOU RNAL OF CELL BIO LOGY Figure S1. Cell morphology during migration. (a) Protein extracts (20
More informationJCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Kimura et al.,
Supplemental material JCB Kimura et al., http://www.jcb.org/cgi/content/full/jcb.201503023/dc1 THE JOURNAL OF CELL BIOLOGY Figure S1. TRIMs regulate IFN-γ induced autophagy. (A and B) HC image analysis
More informationJournal of Cell Science Supplementary Material
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 SUPPLEMENTARY FIGURE LEGENDS Figure S1: Eps8 is localized at focal adhesions and binds directly to FAK (A) Focal
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Monteiro et al., http://www.jcb.org/cgi/content/full/jcb.201306162/dc1 Figure S1. 3D deconvolution microscopy analysis of WASH and exocyst
More informationSupplementary Figure 1. Drawing of spinal cord open-book preparations and DiI tracing. Nature Neuroscience: doi: /nn.3893
Supplementary Figure 1 Drawing of spinal cord open-book preparations and DiI tracing. Supplementary Figure 2 In ovo electroporation of dominant-negative PlexinA1 in commissural neurons induces midline
More informationSupplementary Figure 1. The Hsp70 acetylation level is related to the co-chaperone binding of Hsp70 under various stress conditions.
Supplementary Figure 1. The Hsp70 acetylation level is related to the co-chaperone binding of Hsp70 under various stress conditions. 1 (a) Etoposide treatment gradually changes acetylation level and co-chaperone
More informationJ. Cell Sci. 128: doi: /jcs : Supplementary Material. Supplemental Figures. Journal of Cell Science Supplementary Material
Supplemental Figures Figure S1. Trio controls endothelial barrier function. (A) TagRFP-shTrio constructs were expressed in ECs. Western blot shows efficient Trio knockdown in TagRFP-expressing ECs. (B)
More informationSupplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb.
Supplementary Figure 1 α-synuclein is truncated in PD and LBD brains. (a) Specificity of anti-n103 antibody. Anti-N103 antibody was coated on an ELISA plate and different concentrations of full-length
More informationSupplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr
Supplemental figure legends Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr A, LβT2 cells were transfected with either scrambled or PEA-15 sirna. Cells were then
More informationSupplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1.
Supplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1. Percent of original fluorescence was plotted as a function of time following photobleaching
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Yamaguchi et al., http://www.jcb.org/cgi/content/full/jcb.201009126/dc1 S1 Figure S2. The expression levels of GFP-Akt1-PH and localization
More informationDescription: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tables Title of file for HTML: Supplementary Movie 1 Description: Nuclear morphology and dynamics
More informationSupplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of
Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of the cell line) were immunostained for HA, acetylated
More informationtranscription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected with the wwp-luc reporter, and FLAG-tagged FHL1,
Supplementary Data Supplementary Figure Legends Supplementary Figure 1 FHL-mediated TGFβ-responsive reporter transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected
More informationTHE JOURNAL OF CELL BIOLOGY
Supplemental Material THE JOURNAL OF CELL BIOLOGY Yeung et al., http://www.jcb.org/cgi/content/full/jcb.200903020/dc1 Figure S1. Assessment of the surface charge of maturing phagosomes. (A C and F H) RAW
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Rodríguez-Fraticelli et al., http://www.jcb.org/cgi/content/full/jcb.201203075/dc1 Figure S1. Cell spreading and lumen formation in confined
More informationNo wash 2 Washes 2 Days ** ** IgG-bead phagocytosis (%)
Supplementary Figures Supplementary Figure 1. No wash 2 Washes 2 Days Tat Control ** ** 2 4 6 8 IgG-bead phagocytosis (%) Supplementary Figure 1. Reversibility of phagocytosis inhibition by Tat. Human
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3363 Supplementary Figure 1 Several WNTs bind to the extracellular domains of PKD1. (a) HEK293T cells were co-transfected with indicated plasmids. Flag-tagged proteins were immunoprecipiated
More informationSupplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured
Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured under static conditions. Cells were seeded in the chamber area of the device and cultured overnight without medium perfusion.
More informationSupplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators.
Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators. (a) A graphic depiction of the approach to determining the stability of
More informationFig. S1. Endocytosis of extracellular cargo does not depend on dia. (A) To visualize endocytosis, fluorescently labelled wheat germ agglutinin
Fig. S1. Endocytosis of extracellular cargo does not depend on dia. (A) To visualize endocytosis, fluorescently labelled wheat germ agglutinin (WGA-Alexa555) was injected into the extracellular perivitteline
More informationSupplementary Fig. 1 Identification of Nedd4 as an IRS-2-associated protein in camp-treated FRTL-5 cells.
Supplementary Fig. 1 Supplementary Fig. 1 Identification of Nedd4 as an IRS-2-associated protein in camp-treated FRTL-5 cells. (a) FRTL-5 cells were treated with 1 mm dibutyryl camp for 24 h, and the lysates
More informationSupplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated
Supplementary Figure Legends Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated with either vehicle (left; n=3) or CCl 4 (right; n=3) were co-immunostained for NRP-1 (green)
More informationFlag-Rac Vector V12 V12 N17 C40. Vector C40 pakt (T308) Akt1. Myc-DN-PAK1 (N-SP)
a b FlagRac FlagRac V2 V2 N7 C4 V2 V2 N7 C4 p (T38) p (S99, S24) p Flag (Rac) NIH 3T3 COS c +Serum p (T38) MycDN (NSP) Mycp27 3 6 2 3 6 2 3 6 2 min p Myc ( or p27) Figure S (a) Effects of Rac mutants on
More informationsupplementary information
DOI: 10.1038/ncb1977 Figure S1 a. Immunofluorescence analysis of IFT20 localization in PBL costained with anti-β-tubulin antibodies. b. Immunofluorescence analysis of IFT20 localization in Jurkat cells,
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid
More informationThis is the author's accepted version of the manuscript.
This is the author's accepted version of the manuscript. The definitive version is published in Nature Communications Online Edition: 2015/4/16 (Japan time), doi:10.1038/ncomms7780. The final version published
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/4/9/eaat5401/dc1 Supplementary Materials for GLK-IKKβ signaling induces dimerization and translocation of the AhR-RORγt complex in IL-17A induction and autoimmune
More informationSupplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various
Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various GST-tagged N-terminal truncated APP fragments including GST-APP full-length (FL), APP (123-695), APP (189-695), or
More informationSupplement Figure 1. Plin5 Plin2 Plin1. KDEL-DSRed. Plin-YFP. Merge
Supplement Figure 1 Plin5 Plin2 Plin1 KDEL-DSRed Plin-YFP Merge Supplement Figure 2 A. Plin5-Ab MitoTracker Merge AML12 B. Plin5-YFP Cytochrome c-cfp merge Supplement Figure 3 Ad.GFP Ad.Plin5 Supplement
More informationSupplementary Figure S1. N-terminal fragments of LRRK1 bind to Grb2.
Myc- HA-Grb2 Mr(K) 105 IP HA 75 25 105 1-1163 1-595 - + - + - + 1164-1989 Blot Myc HA total lysate 75 25 Myc HA Supplementary Figure S1. N-terminal fragments of bind to Grb2. COS7 cells were cotransfected
More informationSupplementary Materials
Supplementary Materials Supplementary Figure 1. PKM2 interacts with MLC2 in cytokinesis. a, U87, U87/EGFRvIII, and HeLa cells in cytokinesis were immunostained with DAPI and an anti-pkm2 antibody. Thirty
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Bays et al., http://www.jcb.org/cgi/content/full/jcb.201309092/dc1 Figure S1. Specificity of the phospho-y822 antibody. (A) Total cell
More informationMannen et al., http :// /cgi /content /full /jcb /DC1
Supplemental material JCB Mannen et al., http ://www.jcb.org /cgi /content /full /jcb.201601024 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. Characterization of SNB components. (A) SNB localization of Venus-tagged
More informationindicated numbers of pups at day of life (DOL) 10, or embryonic day (ED) B. Male mice of
SUPPLEMENTRY FIGURE LEGENDS Figure S1. USP44 loss leads to chromosome missegregation.. Genotypes obtained from the indicated numbers of pups at day of life (DOL) 10, or embryonic day (ED) 13.5.. Male mice
More informationsupplementary information
DOI: 10.1038/ncb2156 Figure S1 Depletion of p114rhogef with different sirnas. Caco-2 (a) and HCE (b) cells were transfected with individual sirnas, pools of the two sirnas or the On Target (OnT) sirna
More informationXu et al., Supplementary Figures 1-7
Xu et al., Supplementary Figures 1-7 Supplementary Figure 1. PIPKI is required for ciliogenesis. (a) PIPKI localizes at the basal body of primary cilium. RPE-1 cells treated with two sirnas targeting to
More informationDOI: 10.1038/ncb3259 A Ismail et al. Supplementary Figure 1 B 60000 45000 SSC 30000 15000 Live cells 0 0 15000 30000 45000 60000 FSC- PARR 60000 45000 PARR Width 30000 FSC- 15000 Single cells 0 0 15000
More informationRecruitment of Grb2 to surface IgG and IgE provides antigen receptor-intrinsic costimulation to class-switched B cells
SUPPLEMENTARY FIGURES Recruitment of Grb2 to surface IgG and IgE provides antigen receptor-intrinsic costimulation to class-switched B cells Niklas Engels, Lars Morten König, Christina Heemann, Johannes
More informationHossain_Supplemental Figure 1
Hossain_Supplemental Figure 1 GFP-PACT GFP-PACT Motif I GFP-PACT Motif II A. MG132 (1µM) GFP Tubulin GFP-PACT Pericentrin GFP-PACT GFP-PACT Pericentrin Fig. S1. Expression and localization of Orc1 PACT
More informationX2-C/X1-Y X2-C/VCAM-Y. FRET efficiency. Ratio YFP/CFP
FRET efficiency.7.6..4.3.2 X2-C/X1-Y X2-C/VCAM-Y.1 1 2 3 Ratio YFP/CFP Supplemental Data 1. Analysis of / heterodimers in live cells using FRET. FRET saturation curves were obtained using cells transiently
More informationArtificial targeting of misfolded cytosolic proteins to endoplasmic reticulum as a mechanism for clearance
Supplementary Information Artificial targeting of misfolded cytosolic proteins to endoplasmic reticulum as a mechanism for clearance Fen Liu 1, Deanna M. Koepp 2, and Kylie J. Walters 1* 1 Protein Processing
More informationSupplementary Figure 1. GST pull-down analysis of the interaction of GST-cIAP1 (A, B), GSTcIAP1
Legends Supplementary Figure 1. GST pull-down analysis of the interaction of GST- (A, B), GST mutants (B) or GST- (C) with indicated proteins. A, B, Cell lysate from untransfected HeLa cells were loaded
More informationStargazin regulates AMPA receptor trafficking through adaptor protein. complexes during long term depression
Supplementary Information Stargazin regulates AMPA receptor trafficking through adaptor protein complexes during long term depression Shinji Matsuda, Wataru Kakegawa, Timotheus Budisantoso, Toshihiro Nomura,
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Prashar et al., http://www.jcb.org/cgi/content/full/jcb.201304095/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. FBT phagocytosis in cells expressing PM-GFP. (A) T-PC
More informationTHE JOURNAL OF CELL BIOLOGY
Supplemental Material THE JOURNAL OF CELL BIOLOGY Toso et al., http://www.jcb.org/cgi/content/full/jcb.200809055/dc1 Figure S1. Control experiments for sirna depletions used in Figs. 1 3. The phenotype
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary figures Supplementary Figure 1: Suv39h1, but not Suv39h2, promotes HP1α sumoylation in vivo. In vivo HP1α sumoylation assay. Top: experimental scheme. Middle: we
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 PCR-genotyping of the three mouse models used in this study and controls for behavioral experiments after semi-chronic Pten inhibition. a-c. DNA from App/Psen1 (a), Pten tg (b) and
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full//59/ra7/dc1 Supplementary Materials for Dok-7 ctivates the Muscle Receptor Kinase MuSK and Shapes Synapse Formation kane Inoue, Kiyoko Setoguchi, Yosuke Matsubara,
More informationSupplementary Materials for
www.sciencemag.org/cgi/content/full/science.1245533/dc1 Supplementary Materials for A Mechanism for Reorientation of Cortical Microtubule Arrays Driven by Microtubule Severing Jelmer J. Lindeboom, Masayoshi
More informationSupplemental material
Supplemental material THE JOURNAL OF CELL BIOLOGY Gillespie et al., http://www.jcb.org/cgi/content/full/jcb.200907037/dc1 repressor complex induced by p38- Gillespie et al. Figure S1. Reduced fiber size
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2386 Figure 1 Src-containing puncta are not focal adhesions, podosomes or endosomes. (a) FAK-/- were stained with anti-py416 Src (green) and either (in red) the focal adhesion protein paxillin,
More information(A) Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site.
SUPPLEMENTRY INFORMTION SUPPLEMENTL FIGURES Figure S1. () Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site. () Western blot of ligated and unligated sciatic
More informationTo examine the silencing effects of Celsr3 shrna, we co transfected 293T cells with expression
Supplemental figures Supplemental Figure. 1. Silencing expression of Celsr3 by shrna. To examine the silencing effects of Celsr3 shrna, we co transfected 293T cells with expression plasmids for the shrna
More informationBeta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand
SUPPLEMENTAL FIGURES Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand C. Ravelli et al. FIGURE S. I Figure S. I: Gremlin
More information(B) Comparable expression of major integrin subunits and glycoproteins on the surface of resting WT and Lnk -/- platelets.
Supplemental Figure S1. Characteristics of Lnk -/- platelets. (A) Electron micrographs of resting platelets showing the normal intracellular structure of Lnk -/ platelets. Samples were fixed with 4% PFA
More informationFigure S1 is related to Figure 1B, showing more details of outer segment of
Supplemental Information Supplementary Figure legends and Figures Figure S1. Electron microscopic images in Sema4A +/+ and Sema4A / retinas Figure S1 is related to Figure 1B, showing more details of outer
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/429/ra54/dc1 Supplementary Materials for Dephosphorylation of the adaptor LAT and phospholipase C by SHP-1 inhibits natural killer cell cytotoxicity Omri Matalon,
More informationActin cap associated focal adhesions and their distinct role in cellular mechanosensing
Actin cap associated focal adhesions and their distinct role in cellular mechanosensing Dong-Hwee Kim 1,2, Shyam B. Khatau 1,2, Yunfeng Feng 1,3, Sam Walcott 1,4, Sean X. Sun 1,2,4, Gregory D. Longmore
More informationSupporting Online Material for
Supporting Online Material for Spatiotemporal dynamics of Aurora B-PLK1-MCAK signaling axis orchestrates kinetochore bi-orientation and faithful chromosome segregation Hengyi Shao, Yuejia Huang, Liangyu
More informationTRIM31 is recruited to mitochondria after infection with SeV.
Supplementary Figure 1 TRIM31 is recruited to mitochondria after infection with SeV. (a) Confocal microscopy of TRIM31-GFP transfected into HEK293T cells for 24 h followed with SeV infection for 6 h. MitoTracker
More informationSupplementary information. Supplementary Figures
Supplementary information Supplementary Figures Supplementary Figure 1. A. i. HA-JMY expressing U2OS cells were treated with SAHA (6h). DAPI was used to visualise nuclei. ii. U2OS cells stably expressing
More informationFigure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Moutin et al., http://www.jcb.org/cgi/content/full/jcb.201110101/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Tagged Homer1a and Homer are functional and display different
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Wang et al., http://www.jcb.org/cgi/content/full/jcb.201405026/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Generation and characterization of unc-40 alleles. (A and
More informationNature Structural & Molecular Biology: doi: /nsmb.3308
Supplementary Figure 1 Analysis of CED-3 autoactivation and CED-4-induced CED-3 activation. (a) Repeat experiments of Fig. 1a. (b) Repeat experiments of Fig. 1b. (c) Quantitative analysis of three independent
More informationSupplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the
Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the prey clones identified in the yeast two hybrid screen.
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb327 a b Sequence coverage (%) 4 3 2 IP: -GFP isoform IP: GFP IP: -GFP IP: GFP Sequence coverage (%) 4 3 2 IP: -GFP IP: GFP 33 52 58 isoform 2 33 49 47 IP: Control IP: Peptide Sequence Start
More informationSUPPLEMENTAL FIGURES AND TABLES
SUPPLEMENTAL FIGURES AND TABLES A B Flag-ALDH1A1 IP: α-ac HEK293T WT 91R 128R 252Q 367R 41/ 419R 435R 495R 412R C Flag-ALDH1A1 NAM IP: HEK293T + + - + D NAM - + + E Relative ALDH1A1 activity 1..8.6.4.2
More informationover time using live cell microscopy. The time post infection is indicated in the lower left corner.
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Supplementary Movie 1 Description: Fusion of NBs. BSR cells were infected
More information42 fl organelles = 34.5 fl (1) 3.5X X 0.93 = 78,000 (2)
SUPPLEMENTAL DATA Supplementary Experimental Procedures Fluorescence Microscopy - A Zeiss Axiovert 200M microscope equipped with a Zeiss 100x Plan- Apochromat (1.40 NA) DIC objective and Hamamatsu Orca
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature09732 Supplementary Figure 1: Depletion of Fbw7 results in elevated Mcl-1 abundance. a, Total thymocytes from 8-wk-old Lck-Cre/Fbw7 +/fl (Control) or Lck-Cre/Fbw7 fl/fl (Fbw7 KO) mice
More informationSupplemental Information. A Versatile Tool for Live-Cell Imaging. and Super-Resolution Nanoscopy Studies. of HIV-1 Env Distribution and Mobility
Cell Chemical Biology, Volume 24 Supplemental Information A Versatile Tool for Live-Cell Imaging and Super-Resolution Nanoscopy Studies of HIV-1 Env Distribution and Mobility Volkan Sakin, Janina Hanne,
More informationHPV E6 oncoprotein targets histone methyltransferases for modulating specific. Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu,
1 HPV E oncoprotein targets histone methyltransferases for modulating specific gene transcription 3 5 Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu, Cheng-Ming Chiang, Sheng-Chung
More informationSupplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity.
Supplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity. (A) Amino acid alignment of HDA5, HDA15 and HDA18. The blue line
More informationAutomated Digital Microscopy
A p p l i c a t i o n G u i d e Peter Banks, Ph.D. and Peter J. Brescia, Applications Department, BioTek Instruments, Inc., Winooski, VT Table of Contents Introduction ----------------------------------------------------------------------------------------------------------------------
More informationPost-translational modification
Protein expression Western blotting, is a widely used and accepted technique to detect levels of protein expression in a cell or tissue extract. This technique measures protein levels in a biological sample
More informationFig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.
Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3230 a GM13267(ZW) WCE C N M H 2 O 2 : p(s1981) 2 2 LDH Lamin A/C β-integrin c b d AT Flag- WT Flag- RQ H 2 O 2 IgG p (S1981) p (S1981) 2 IP: Flag N.S. 2 e f A: Untreated AT5 cells B: AT5
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using
More informationSupplementary Information
Supplementary Information stability is regulated by CK2-dependent interaction with R2TP complex Patrick von Morgen 1,2, Kamila Burdova 1, Thomas G. Flower 3, Nicola J. O'Reilly 4, Simon J. Boulton 5, Stephen
More informationSarker et al. Supplementary Material. Subcellular Fractionation
Supplementary Material Subcellular Fractionation Transfected 293T cells were harvested with phosphate buffered saline (PBS) and centrifuged at 2000 rpm (500g) for 3 min. The pellet was washed, re-centrifuged
More information