T H E J O U R N A L O F C E L L B I O L O G Y

Size: px
Start display at page:

Download "T H E J O U R N A L O F C E L L B I O L O G Y"

Transcription

1 T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Feng et al., Figure S1. A modest elevation of disulfide-bonded K14 in primary mouse keratinocytes upon calcium switch. (A and B) The global disulfide bond staining in primary cultures of newborn mouse skin keratinocytes (A) and the localization of ER lumen (labeled using an antibody to recognize the marker protein disulfide isomerase [PDI]), where disulfide formation and isomerization of nascent proteins are catalyzed, thereby contributing to the perinuclear staining of disulfides labeled by maleimide (B). S-S, disulfide bonds; IgG, goat anti-rabbit IgG. Bar, 10 µm. (C) Disulfide-bonded K14 in primary mouse keratinocytes is modestly elevated upon calcium switch. Quantification of the total amount of disulfide-bonded K14 and K5 under low versus high calcium culture conditions achieved by densitometry-based analysis of disulfide-bonded versus monomeric keratins as reported in Fig. 1 A. Data were obtained from three independent experiments. Error bars represent standard deviations. Disulfide bonding and keratin filaments Feng and Coulombe S1

2 Figure S2. Intermolecular disulfide bonds involving K14WT, K14CF-C367, and K5WT. Keratin assemblies were subjected to high-speed sedimentation (150,000 g, 30 min), and pellet (Pel) and supernatant (Sup) fractions were loaded on nonreducing SDS-PAGE gels with or without being pretreated with a reducing agent followed by immunoblotting analysis. M, keratin monomer. Black lines indicate that intervening lanes have been spliced out. S2

3 Figure S3. Criteria used to assign keratin filament network organization to one of three categories: peripheral, pan-cytoplasmic, and perinuclear-concentrated networks. Using ImageJ, we determined the relative intensity of the fluorescence signal for keratin IFs (FI%) across the relative distance (RD) extending from the outer cell membrane (set as 0) to the nuclear envelope (set as 1), using transfected GFP-K14WT as an example. If keratin filaments (FI% > 50%) are distributed relatively evenly across the cytoplasm (RD = 0 1), such a network is designated pan-cytoplasmic (see A); if keratin filaments (FI% > 50%) are mainly concentrated in the perinuclear region (RD > 0.7), it is called perinuclear-concentrated (see B); finally, if keratin filaments (FI% > 50%) appear concentrated at the cell periphery (RD < 0.4), such a network is called peripheral (see C). For each graph, the 10 different color tracings represent 10 individual GFP-K14WT expressing keratinocytes. Disulfide bonding and keratin filaments Feng and Coulombe S3

4 Figure S4. Evidence that the existence of different phenotypes in Krt14 / cells expressing either K14WT or cysteine variants is not related to differences in transgene expression levels among individual cells. (A C) The K14 cysteine variants used in this study, e.g., K14CF, K14C367A, and K14CF-C367 (A), and fluorescence intensity comparison of GFP-K14WT versus GFP-K14CF (B), and GFP-K14CF-C367 expressing keratinocytes with (w/perin) or without (w/o pern) perinuclear-concentrated networks (C). Each symbol represents the mean fluorescence intensity of individual keratinocytes at seven time points (from 0 to 6 h) during movie recordings from a single experiment. n = 22 cells for GFP-K14WT, n = 22 cells for GFP-K14CF, n = 13 cells for GFP-K14CF- C367 w/perin, and n = 15 cells for GFP-K14CF-C367 w/o perin. S4

5 Figure S5. Enhanced nuclear and cellular movements manifested by GFP-K14CF-expressing keratinocytes. (A and B) Still images (A) and 2.5-dimentional views of z stacks of mobile GFP-K14CF expressing keratinocytes, derived from live movie recordings (B). Bar, 10 µm. (C F) Comparison of nuclear and whole cell movements obtained by tracking the position of the nucleus in GFP-K14WT (C), GFP-K14CF (D), and GFP-K14CF-C367 expressing (E) cells, as well as speed (F). More than 20 transfected cells were analyzed for each sample. Each color in C E and each symbol in F denote individual cells. Disulfide bonding and keratin filaments Feng and Coulombe S5

6 Video 1. GFP-K14WT-transfected K14 / mouse keratinocytes in primary culture. K14 / mouse keratinocytes were transfected with GFP-K14WT (green) and H2B-mCherry (red). Images were recorded using a laser scanning confocal microscope (LSM780-FCS, Carl Zeiss). Recording intervals were 5 min and the whole recording time was 6 h. Video 2. GFP-K14CF-transfected K14 / mouse keratinocytes in primary culture showing a stationary behavior. K14 / mouse keratinocytes were transfected with GFP-K14CF (green) and H2B-mCherry (red). Images were recorded using a laser scanning confocal microscope (LSM780-FCS; Carl Zeiss). Recording intervals were 5 min and the whole recording time was 6 h. Video 3. GFP-K14CF transfected K14 / mouse keratinocytes in primary culture showing a motile behavior. K14 / mouse keratinocytes were transfected with GFP-K14CF (green) and H2B-mCherry (red). Images were recorded using a laser scanning confocal microscope (LSM780-FCS; Carl Zeiss). Recording intervals were 5 min and the whole recording time was 6 h. Video 4. GFP-K14CF-C367 transfected K14 / mouse keratinocytes in primary culture showing perinuclear-concentrated networks. K14 / mouse keratinocytes were transfected with GFP-K14CF-C367 (green) and H2B-mCherry (red). Images were recorded using a laser scanning confocal microscope (LSM780-FCS; Carl Zeiss). Recording intervals were 5 min and the whole recording time was 6 h. Video 5. GFP-K14CF-C367 transfected K14 / mouse keratinocytes in primary culture showing a lack of stable perinuclearconcentrated networks. K14 / mouse keratinocytes were transfected with GFP-K14CF-C367 (green) and H2B-mCherry (red). Images were recorded using a laser scanning confocal microscope (LSM780-FCS; Carl Zeiss). Recording intervals were 5 min and the whole recording time was 6 h. S6

Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.

Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Kanaani et al., http://www.jcb.org/cgi/content/full/jcb.200912101/dc1 Figure S1. The K2 rabbit polyclonal antibody is specific for GAD67,

More information

Description: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto

Description: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tables Title of file for HTML: Supplementary Movie 1 Description: Nuclear morphology and dynamics

More information

JBC Papers in Press. Published on July 27, 2015 as Manuscript M

JBC Papers in Press. Published on July 27, 2015 as Manuscript M JBC Papers in Press. Published on July 27, 2015 as Manuscript M115.654749 The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.m115.654749 MS ID#: JBC/2015/654749, revised Title: Complementary

More information

Supporting Information

Supporting Information Supporting Information Shao et al. 10.1073/pnas.1504837112 SI Materials and Methods Immunofluorescence and Immunoblotting. For immunofluorescence, cells were fixed with 4% paraformaldehyde and permeabilized

More information

Supplemental Information. A Versatile Tool for Live-Cell Imaging. and Super-Resolution Nanoscopy Studies. of HIV-1 Env Distribution and Mobility

Supplemental Information. A Versatile Tool for Live-Cell Imaging. and Super-Resolution Nanoscopy Studies. of HIV-1 Env Distribution and Mobility Cell Chemical Biology, Volume 24 Supplemental Information A Versatile Tool for Live-Cell Imaging and Super-Resolution Nanoscopy Studies of HIV-1 Env Distribution and Mobility Volkan Sakin, Janina Hanne,

More information

Supplementary Figure S1

Supplementary Figure S1 Supplementary Figure S1 Figure S1. CENP- FP constructs target to centromeres irrespective of site of tagging. FP- CENP and CENP- FP constructs were transfected into U2OS cells and counterstained with anti-

More information

Confocal immunofluorescence microscopy

Confocal immunofluorescence microscopy Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,

More information

Supplement Figure 1. Plin5 Plin2 Plin1. KDEL-DSRed. Plin-YFP. Merge

Supplement Figure 1. Plin5 Plin2 Plin1. KDEL-DSRed. Plin-YFP. Merge Supplement Figure 1 Plin5 Plin2 Plin1 KDEL-DSRed Plin-YFP Merge Supplement Figure 2 A. Plin5-Ab MitoTracker Merge AML12 B. Plin5-YFP Cytochrome c-cfp merge Supplement Figure 3 Ad.GFP Ad.Plin5 Supplement

More information

Spectral Separation of Multifluorescence Labels with the LSM 510 META

Spectral Separation of Multifluorescence Labels with the LSM 510 META Microscopy from Carl Zeiss Spectral Separation of Multifluorescence Labels with the LSM 510 META Indians living in the South American rain forest can distinguish between almost 200 hues of green in their

More information

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

More information

PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF

PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF YFP-PHF1 CFP-PHT1;2 PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF + CFP-PHT1;2 Negative control!-gfp Supplemental Figure 1: PHT1;2 accumulation is PHF1 dependent. Immunoblot analysis on total protein extract

More information

Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than. SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with

Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than. SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with concentration of 800nM) were incubated with 1mM dgtp for the indicated

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using

More information

Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand

Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand SUPPLEMENTAL FIGURES Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand C. Ravelli et al. FIGURE S. I Figure S. I: Gremlin

More information

42 fl organelles = 34.5 fl (1) 3.5X X 0.93 = 78,000 (2)

42 fl organelles = 34.5 fl (1) 3.5X X 0.93 = 78,000 (2) SUPPLEMENTAL DATA Supplementary Experimental Procedures Fluorescence Microscopy - A Zeiss Axiovert 200M microscope equipped with a Zeiss 100x Plan- Apochromat (1.40 NA) DIC objective and Hamamatsu Orca

More information

Post-expansion antibody delivery, after epitope-preserving homogenization.

Post-expansion antibody delivery, after epitope-preserving homogenization. Supplementary Figure 1 Post-expansion antibody delivery, after epitope-preserving homogenization. (a, b) Wide-field fluorescence images of Thy1-YFP-expressing mouse brain hemisphere slice before expansion

More information

Cycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney

Cycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney 1 Supplementary text and data for: 2 3 4 5 Cycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney Authors: David A. D. Munro 1*, Peter Hohenstein 2, and Jamie A.

More information

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with

More information

The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit

The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Cell Reports, Volume 5 Supplemental Information The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Andrey Poleshko, Katelyn M. Mansfield, Caroline

More information

cell and tissue imaging by fluorescence microscopy

cell and tissue imaging by fluorescence microscopy cell and tissue imaging by fluorescence microscopy Steven NEDELLEC Plateforme Micropicell SFR Santé François Bonamy Nantes 1 A matter of size Limit of resolution 0.15mm aims: building the image of an object

More information

Supplemental Data. Aung et al. (2011). Plant Cell /tpc

Supplemental Data. Aung et al. (2011). Plant Cell /tpc 35S pro:pmd1-yfp 10 µm Supplemental Figure 1. -terminal YFP fusion of PMD1 (PMD1-YFP, in green) is localized to the cytosol. grobacterium cells harboring 35S pro :PMD1-YFP were infiltrated into tobacco

More information

Supplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1.

Supplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1. Supplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1. Percent of original fluorescence was plotted as a function of time following photobleaching

More information

(A) Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site.

(A) Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site. SUPPLEMENTRY INFORMTION SUPPLEMENTL FIGURES Figure S1. () Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site. () Western blot of ligated and unligated sciatic

More information

3D Transfection System

3D Transfection System 3D Transfection System Why 3D Technology? Introduction to Three Dimensional (3D) Cell Culture The goal of three-dimensional (3D) cell culture is to eliminate the stress and artificial responses cells experience

More information

Nature Immunology: doi: /ni Supplementary Figure 1

Nature Immunology: doi: /ni Supplementary Figure 1 Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact

More information

X2-C/X1-Y X2-C/VCAM-Y. FRET efficiency. Ratio YFP/CFP

X2-C/X1-Y X2-C/VCAM-Y. FRET efficiency. Ratio YFP/CFP FRET efficiency.7.6..4.3.2 X2-C/X1-Y X2-C/VCAM-Y.1 1 2 3 Ratio YFP/CFP Supplemental Data 1. Analysis of / heterodimers in live cells using FRET. FRET saturation curves were obtained using cells transiently

More information

over time using live cell microscopy. The time post infection is indicated in the lower left corner.

over time using live cell microscopy. The time post infection is indicated in the lower left corner. Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Supplementary Movie 1 Description: Fusion of NBs. BSR cells were infected

More information

Nodes of regulation in cellular systems

Nodes of regulation in cellular systems Nodes of regulation in cellular systems cell membrane signal transduction ligands receptors oligomerization transport signal transduction modified protein Golgi transcription factor transport ER transport

More information

Supplementary Figure 1: Expression of RNF8, HERC2 and NEURL4 in the cerebellum and knockdown of RNF8 by RNAi (a) Lysates of the cerebellum from rat

Supplementary Figure 1: Expression of RNF8, HERC2 and NEURL4 in the cerebellum and knockdown of RNF8 by RNAi (a) Lysates of the cerebellum from rat Supplementary Figure 1: Expression of RNF8, HERC2 and NEURL4 in the cerebellum and knockdown of RNF8 by RNAi (a) Lysates of the cerebellum from rat pups at P6, P14, P22, P30 and adult (A) rats were subjected

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION a before amputation regeneration regenerated limb DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS DERMIS SKELETON MUSCLE SCHWANN CELLS EPIDERMIS developmental origin: lateral plate mesoderm presomitic mesoderm

More information

Confocal Microscopy Analyzes Cells

Confocal Microscopy Analyzes Cells Choosing Filters for Fluorescence A Laurin Publication Photonic Solutions for Biotechnology and Medicine November 2002 Confocal Microscopy Analyzes Cells Reprinted from the November 2002 issue of Biophotonics

More information

Supplemental information

Supplemental information Supplemental information - Control samples (200 subjects) - Immunohistochemistry of rat brain - Immunocytochemistry on neuronal cultures - Immunocompetition assay - Immunoprecipitation - Immunocytochemistry

More information

Supplementary Figure 1. RAD51 and RAD51 paralogs are enriched spontaneously onto

Supplementary Figure 1. RAD51 and RAD51 paralogs are enriched spontaneously onto Supplementary Figure legends Supplementary Figure 1. and paralogs are enriched spontaneously onto the S-phase chromatin during DN replication. () Chromatin fractionation was carried out as described in

More information

Intermediate Filaments in Motion: Observations of Intermediate Filaments in Cells Using Green Fluorescent Protein-Vimentin V

Intermediate Filaments in Motion: Observations of Intermediate Filaments in Cells Using Green Fluorescent Protein-Vimentin V Molecular Biology of the Cell Vol. 10, 1289 1295, May 1999 Intermediate Filaments in Motion: Observations of Intermediate Filaments in Cells Using Green Fluorescent Protein-Vimentin V Jayme L. Martys,

More information

ab Ran Activation Assay Kit

ab Ran Activation Assay Kit ab173247 Ran Activation Assay Kit Instructions for Use For the simple and fast measurement of Ran activation. This product is for research use only and is not intended for diagnostic use. Version 1 Last

More information

ab G alpha i Activation Assay Kit

ab G alpha i Activation Assay Kit ab173234 G alpha i Activation Assay Kit Instructions for Use For the simple and fast measurement of G alpha i activation. This product is for research use only and is not intended for diagnostic use. Version

More information

mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet

mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet Details

More information

Active targeting of the nucleus using non-peptidic boronate tags

Active targeting of the nucleus using non-peptidic boronate tags Supporting Information Active targeting of the nucleus using non-peptidic boronate tags Rui Tang 1, Ming Wang 2, Moumita Ray 1, Ying Jiang 1, Ziwen Jiang 1, Qiaobing Xu 2 *, Vincent M. Rotello 1 * 1 Department

More information

vector company modification/annotation insert

vector company modification/annotation insert Supplemental information Plasmids Table 1. List of constructs used in the study. vector company modification/annotation insert pegfp-c1 Mikhaylova et al. 2009 Caln1 (NM_001077201.1) pegfp-c1 Caln1 ΔC (aa

More information

Purification of Lactate Dehydrogenase

Purification of Lactate Dehydrogenase Dominican University of California Dominican Scholar Scholarly & Creative Works Conference 2018 Scholarly and Creative Works Conference 2016 Apr 15th, 1:30 PM - 2:00 PM Purification of Lactate Dehydrogenase

More information

Supplementary material

Supplementary material Supplementary material Tracking mesenchymal stem cell contributions to regeneration in an immunocompetent cartilage regeneration model Daniela Zwolanek, María Satué, Verena Proell, Josè R. Godoy, Kathrin

More information

Supplementary Figure 1: Two modes of low concentration of BsSMC on a DNA (a) Protein staining (left) and fluorescent imaging of Cy3 (right) confirm

Supplementary Figure 1: Two modes of low concentration of BsSMC on a DNA (a) Protein staining (left) and fluorescent imaging of Cy3 (right) confirm Supplementary Figure 1: Two modes of low concentration of BsSMC on a DNA (a) Protein staining (left) and fluorescent imaging of Cy3 (right) confirm that BsSMC was labeled with Cy3 NHS-Ester. In each panel,

More information

Supplemental Movie Legend.

Supplemental Movie Legend. Supplemental Movie Legend. Transfected T cells were dropped onto SEE superantigen-pulsed Raji B cells (approximate location indicated by circle). Maximum-intensity projections from Z-stacks (17 slices,

More information

Fig. S1. Endocytosis of extracellular cargo does not depend on dia. (A) To visualize endocytosis, fluorescently labelled wheat germ agglutinin

Fig. S1. Endocytosis of extracellular cargo does not depend on dia. (A) To visualize endocytosis, fluorescently labelled wheat germ agglutinin Fig. S1. Endocytosis of extracellular cargo does not depend on dia. (A) To visualize endocytosis, fluorescently labelled wheat germ agglutinin (WGA-Alexa555) was injected into the extracellular perivitteline

More information

Supplementary Figures

Supplementary Figures Supplementary Figures a HindIII XbaI pcdna3.1/v5-his A_Nfluc-VVD 1-398 37-186 Nfluc Linker 1 VVD HindIII XhoI pcdna3.1/v5-his A_VVD-Nfluc 37-186 1-398 VVD Linker 2 Nfluc HindIII XbaI pcdna3.1/v5-his A_Cfluc-VVD

More information

Azure Biosystems Western Blotting Workflow

Azure Biosystems Western Blotting Workflow Azure Biosystems Western Blotting Workflow PROBE PLAN SEPARATE ANALYZE VISUALIZE PLAN Plan your experiment and choose your detection method Chemiluminescent Western Blotting The most common method for

More information

NEW! CHOgro Expression System

NEW! CHOgro Expression System NEW! CHOgro Expression System At Mirus Bio, we know it s all about expression. Introducing the new CHOgro Expression System, a transient transfection platform that finally gets high protein titers with

More information

SANTA CRUZ BIOTECHNOLOGY, INC.

SANTA CRUZ BIOTECHNOLOGY, INC. TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same

More information

BIO 315 Lab Exam I. Section #: Name:

BIO 315 Lab Exam I. Section #: Name: Section #: Name: Also provide this information on the computer grid sheet given to you. (Section # in special code box) BIO 315 Lab Exam I 1. In labeling the parts of a standard compound light microscope

More information

To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well

To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well Supplemental Information: Supplemental Methods: Cell culture To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well in 96 well Primaria plates in GNS media and incubated at

More information

Figure S6. Detection of anti-gfp antibodies in anti-dna and normal plasma without competition DNA--9

Figure S6. Detection of anti-gfp antibodies in anti-dna and normal plasma without competition DNA--9 Supplementary Information Ultrasensitive antibody detection by agglutination-pcr (ADAP) Cheng-ting Tsai 1 *, Peter V. Robinson 1 *, Carole A. Spencer 2 and Carolyn R. Bertozzi 3,4ǂ Department of 1 Chemistry,

More information

1. Introduction. T. Zavašnik-Bergant 1

1. Introduction. T. Zavašnik-Bergant 1 Application of monoclonal and ultrathin cryosections in immunogold electron microscopy: a study on recombinant human inhibitor expressed in bacterial cells T. Zavašnik-Bergant 1 1 Department of Biochemistry,

More information

GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts

GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts Current Biology, Volume 24 Supplemental Information GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts Wei Zhou, Jin Chang, Xin Wang, Masha G. Savelieff, Yinyin Zhao, Shanshan

More information

CHOgro Expression System

CHOgro Expression System CHOgro Expression System At Mirus Bio, we know it s all about expression. Introducing the new CHOgro Expression System, a transient transfection platform that finally gets high protein titers with robust

More information

QImaging Camera Application Notes Multicolor Immunofluorescence Imaging

QImaging Camera Application Notes Multicolor Immunofluorescence Imaging QImaging Camera Application Notes Multicolor Immunofluorescence Imaging In order to image localization of intracellular proteins with high specificity, it is frequently necessary to multiplex antibody

More information

GFP CCD2 GFP IP:GFP

GFP CCD2 GFP IP:GFP D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant

More information

Resolution of Microscopes Visible light is nm Dry lens(0.5na), green(530nm light)=0.65µm=650nm for oil lens (1.4NA) UV light (300nm) = 0.13µm f

Resolution of Microscopes Visible light is nm Dry lens(0.5na), green(530nm light)=0.65µm=650nm for oil lens (1.4NA) UV light (300nm) = 0.13µm f Microscopes and Microscopy MCB 380 Good information sources: Alberts-Molecular Biology of the Cell http://micro.magnet.fsu.edu/primer/ http://www.microscopyu.com/ Approaches to Problems in Cell Biology

More information

Overview of Solulink Products. June 2011

Overview of Solulink Products. June 2011 Overview of Solulink Products June 2011 1 Who we are Established in 2003, Solulink develops, patents, manufactures, and sells consumables to over 1,000 customers in life science, diagnostic, and pharmaceutical

More information

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin

More information

Immunohistochemistry: Basics and Methods

Immunohistochemistry: Basics and Methods Immunohistochemistry: Basics and Methods Bearbeitet von Igor B Buchwalow, Werner Böcker 1st Edition. 2010. Buch. x, 153 S. Hardcover ISBN 978 3 642 04608 7 Format (B x L): 15,5 x 23,5 cm Gewicht: 445 g

More information

M X 500 µl. M X 1000 µl

M X 500 µl. M X 1000 µl GeneGlide TM sirna Transfection Reagent (Catalog # M1081-300, -500, -1000; Store at 4 C) I. Introduction: BioVision s GeneGlide TM sirna Transfection reagent is a cationic proprietary polymer/lipid formulation,

More information

FLUORESCENT PEPTIDES. Outstanding Performance and Wide Application Range

FLUORESCENT PEPTIDES. Outstanding Performance and Wide Application Range FLUORESCENT PEPTIDES Peptides and amino acids labeled with and Tide Quencher TM We offer peptides and amino acids tagged with fluorescent dyes. They meet highest demands in fluorescence intensity and photo-stability,

More information

Supplemental Material for

Supplemental Material for Supplemental Material for TXI TELNGIECTSI MUTTED (TM)-MEDITED DN DMGE RESPONSE IN OXIDTIVE STRESS-INDUCED VSCULR ENDOTHELIL CELL SENESCENCE Hong Zhan 1, Toru Suzuki 1,2, Kenichi izawa 1, Kiyoshi Miyagawa,

More information

7.17: Writing Up Results and Creating Illustrations

7.17: Writing Up Results and Creating Illustrations 7.17: Writing Up Results and Creating Illustrations A Results Exercise: Kansas and Pancakes Write a 5-sentence paragraph describing the results illustrated in this figure: - Describe the figure: highlights?

More information

IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only

IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only Introduction The IgG TrueBlot for mouse, rabbit, or goat-derived antibodies represents unique series of respective

More information

SUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells

SUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells SUPPLEMENTARY INFORMATION Small molecule activation of the TRAIL receptor DR5 in human cancer cells Gelin Wang 1*, Xiaoming Wang 2, Hong Yu 1, Shuguang Wei 1, Noelle Williams 1, Daniel L. Holmes 1, Randal

More information

TF-1a lymphoblastic leukemia cell line: marking with GFP, phenotyping and sorting

TF-1a lymphoblastic leukemia cell line: marking with GFP, phenotyping and sorting Supplemental Material Supplemental Methods TF-1a lymphoblastic leukemia cell line: marking with GFP, phenotyping and sorting In order to determine if the multi-parameter FACS approach would be successful

More information

SONOMA STATE UNIVERSITY DEPARTMENT OF BIOLOGY BIOLOGY 344: CELL BIOLOGY Fall 2013

SONOMA STATE UNIVERSITY DEPARTMENT OF BIOLOGY BIOLOGY 344: CELL BIOLOGY Fall 2013 SONOMA STATE UNIVERSITY DEPARTMENT OF BIOLOGY BIOLOGY 344: CELL BIOLOGY Fall 2013 Instructor Murali C. Pillai, PhD Office 214 Darwin Hall Telephone (707) 664-2981 E-mail pillai@sonoma.edu Website www.sonoma.edu/users/p/pillai

More information

ab Ubiquitylation Assay Kit

ab Ubiquitylation Assay Kit ab139467 Ubiquitylation Assay Kit Instructions for Use For the activation of ubiquitin for use in ubiquitylation experiments This product is for research use only and is not intended for diagnostic use.

More information

Cell were phenotyped using FITC-conjugated anti-human CD3 (Pharmingen, UK)

Cell were phenotyped using FITC-conjugated anti-human CD3 (Pharmingen, UK) SUPPLEMENTAL MATERIAL Supplemental Methods Flow cytometry Cell were phenotyped using FITC-conjugated anti-human CD3 (Pharmingen, UK) and anti-human CD68 (Dako, Denmark), anti-human smooth muscle cell α-actin

More information

Genetically targeted all-optical electrophysiology with a transgenic Credependent

Genetically targeted all-optical electrophysiology with a transgenic Credependent Genetically targeted all-optical electrophysiology with a transgenic Credependent Optopatch mouse Short title: Transgenic Optopatch mouse Shan Lou 1, Yoav Adam 1, Eli N. Weinstein 1,4, Erika Williams 2,

More information

Visualizing Cells Molecular Biology of the Cell - Chapter 9

Visualizing Cells Molecular Biology of the Cell - Chapter 9 Visualizing Cells Molecular Biology of the Cell - Chapter 9 Resolution, Detection Magnification Interaction of Light with matter: Absorbtion, Refraction, Reflection, Fluorescence Light Microscopy Absorbtion

More information

In-Gel Western Detection Using Near-Infrared Fluorescence

In-Gel Western Detection Using Near-Infrared Fluorescence In-Gel Western Detection Using Near-Infrared Fluorescence Developed for: Aerius, and Odyssey Family of Imagers Please refer to your manual to confirm that this protocol is appropriate for the applications

More information

Nature Methods: doi: /nmeth Supplementary Figure 1. Retention of RNA with LabelX.

Nature Methods: doi: /nmeth Supplementary Figure 1. Retention of RNA with LabelX. Supplementary Figure 1 Retention of RNA with LabelX. (a) Epi-fluorescence image of single molecule FISH (smfish) against GAPDH on HeLa cells expanded without LabelX treatment. (b) Epi-fluorescence image

More information

Staining Techniques. Staining Techniques. There are many dyes. Histochemical Stains: chemical reactions. Feulgen reaction -DNA

Staining Techniques. Staining Techniques. There are many dyes. Histochemical Stains: chemical reactions. Feulgen reaction -DNA Staining Techniques There are many dyes. http://medinfo.ufl.edu/~dental/denhisto/stains.html Examples: Sudan black -Lipids Myelinated axons- blue ihcworld.com/imagegallery/displayimage.php?al... Weigert

More information

Amersham Western blotting

Amersham Western blotting Amersham Western blotting Selection guide www.gelifesciences.com Innovative solutions designed to meet your specific protein analysis needs Since 1990 when we first launched Amersham ECL we have continued

More information

Supplementary Table 1. Oligonucleotide sequences used in the study

Supplementary Table 1. Oligonucleotide sequences used in the study Supplementary Table 1. Oligonucleotide sequences used in the study Oligonucleotides Sequences (5 3 ) Substrate strand Lock -4 Lock -5 Lock -6 Lock -7 Free control DNAzyme DNAzyme strand linked to AuNP

More information

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary

More information

Assays for studying mitochondrial health and function

Assays for studying mitochondrial health and function APPLICATION NOTE Fluorescence labeling and detection Assays for studying mitochondrial health and function Introduction Mitochondria play a critical role in maintaining normal cellular activities. Mitochondria

More information

Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System

Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System Plasmid DNA transfection of human colorectal cancer cells with the Biontex K2 Transfection System Stephanie Hehlgans and Franz Rödel, Department of Radiotherapy and Oncology, Goethe- University Frankfurt,

More information

Cationic Vector Intercalation into the Lipid Membrane Enables Intact Polyplex DNA Escape from Endosomes for Gene Delivery

Cationic Vector Intercalation into the Lipid Membrane Enables Intact Polyplex DNA Escape from Endosomes for Gene Delivery Cationic Vector Intercalation into the Lipid Membrane Enables Intact Polyplex DNA Escape from Endosomes for Gene Delivery Sriram Vaidyanathan, 1 Junjie Chen, 2 Bradford G. Orr, 3 Mark M. Banaszak Holl

More information

Daughter-cell-specific modulation of nuclear pore complexes controls cell cycle entry during asymmetric division

Daughter-cell-specific modulation of nuclear pore complexes controls cell cycle entry during asymmetric division SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0056-9 In the format provided by the authors and unedited. Daughter-cell-specific modulation of nuclear pore complexes controls cell

More information

FRAUNHOFER IME SCREENINGPORT

FRAUNHOFER IME SCREENINGPORT FRAUNHOFER IME SCREENINGPORT Detection technologies used in drug discovery Introduction Detection technologies in drug discovery is unlimited only a biased snapshot can be presented Differences can presented

More information

Product Guide SPL Red Kit for 40 Western Blots

Product Guide SPL Red Kit for 40 Western Blots Additional materials required: Smart Protein Layers Product Guide SPL Red Kit for 40 Western Blots Product No.: PR911-M, PR911-R, PR911-G; PR912-M, PR912-R, PR912-G Recommended combination product for

More information

HT Pico Protein Express LabChip Kit, Frequently Asked Questions

HT Pico Protein Express LabChip Kit, Frequently Asked Questions Protein Detection 1. How does the GXII determine protein concentration? Protein samples contain a single lower marker. Alignment to a single marker does not provide enough constraints to align large proteins,

More information

Supplementary Information

Supplementary Information Supplementary Information Live imaging reveals the dynamics and regulation of mitochondrial nucleoids during the cell cycle in Fucci2-HeLa cells Taeko Sasaki 1, Yoshikatsu Sato 2, Tetsuya Higashiyama 1,2,

More information

Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD

Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Developed for: Aerius, Odyssey Classic, Odyssey CLx and Odyssey Sa Imaging Systems

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid

More information

Microscopy from Carl Zeiss. DirectFRAP. News from the Cell. The New Class of Laser Manipulation for the Analysis of Cell Dynamics

Microscopy from Carl Zeiss. DirectFRAP. News from the Cell. The New Class of Laser Manipulation for the Analysis of Cell Dynamics Microscopy from Carl Zeiss DirectFRAP News from the Cell The New Class of Laser Manipulation for the Analysis of Cell Dynamics DirectFRAP. New Insights into Cell Dynamics. Fluorescence breaks new ground:

More information

WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits

WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits Code N221-KIT N220-KIT Description WesternMAX Chemiluminescent AP Kit, Anti-Mouse Includes: Alkaline Phosphatase (AP) Conjugated Anti-Mouse

More information

Cell culture. HeLa cells were cultured as monolayers in Dulbecco s Minimal Essential

Cell culture. HeLa cells were cultured as monolayers in Dulbecco s Minimal Essential Supporting Online Material Materials and methods Cell culture. HeLa cells were cultured as monolayers in Dulbecco s Minimal Essential Medium (Gibco BRL, Invitrogen Corporation, Carlsbad, CA, USA), supplemented

More information

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43

More information

western blotting tech

western blotting tech western blotting tech note 6148 Transfer of High Molecular Weight Proteins to Membranes: A Comparison of Transfer Efficiency Between Blotting Systems Nik Chmiel, Bio-Rad Laboratories, Inc., 6000 James

More information

Immunohistochemistry: Basics and Methods

Immunohistochemistry: Basics and Methods Immunohistochemistry: Basics and Methods Igor B. Buchwalow l Werner Böcker Immunohistochemistry: Basics and Methods Prof. Dr. Igor B. Buchwalow Prof. Dr. Werner Böcker Gerhard-Domagk-Institut für Pathologie

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Construction of Synthetic Nucleoli in Human Cells Reveals How a Major Functional Nuclear Domain is Formed and Propagated Through Cell Divisision Authors: Alice Grob, Christine Colleran

More information

One-step split GFP staining for sensitive protein detection and localization in mammalian cells

One-step split GFP staining for sensitive protein detection and localization in mammalian cells Supplementary Materials For: One-step split GFP staining for sensitive protein detection and localization in mammalian cells Lara Kaddoum 1,3, Eddy Magdeleine 1,3, Geoffrey S. Waldo 4, Etienne Joly 1,3,

More information

Cell Structure and Function

Cell Structure and Function Cell Structure and Function Dead White Men Who Discovered (and were made of) Cells: Anton Van Leeuwenhoek Robert Hooke Where the Magic Happened Schleiden Cell Theory All plants are made of cells Schwann

More information

Supplementary Figure 1. Isolation of GFPHigh cells.

Supplementary Figure 1. Isolation of GFPHigh cells. Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding

More information

Supporting Figure 1: Meis2 and Pax6 transcripts in the adult murine brain detected by in situ

Supporting Figure 1: Meis2 and Pax6 transcripts in the adult murine brain detected by in situ DEVELOP2013097295_supplementary figures Supporting Figure 1: Meis2 and Pax6 transcripts in the adult murine brain detected by in situ hybridization on vibratome sections. (A) Meis2-specific transcripts

More information