Supplemental Information

Transcription

1 Molecular Cell, Volume 54 Supplemental Information BRD7, a Tumor Suppressor, Interacts with p85 and Regulates PI3K Activity Yu-Hsin Chiu, Jennifer Y. Lee, and Lewis C. Cantley

2 Supplemental Materials Supplemental Figure Legends Figure S1. The p85-binding region in BRD7 is consisted of two α-helices, related to Figure 1. (A) Structure analysis of the C-terminal fragment of BRD7 from residue 543 to 651. Residue 543 and 604 were indicated. The structure is predicted by the PSIPRED Protein Sequence Analysis Workbench. (B) HEK293T cells were co-transfected with Flag-tagged p85α and various GST-tagged BRD7 fragments. Proteins were immunoprecipitated with Anti-FLAG M2-agarose and immunoblotted with anti-gst and Flag antibodies. (C) HEK293T cells were co-transfected with Flag-tagged p85α together with GST protein or GST-tagged full-length, or BRD7. Cell lysates were analyzed by GST pull-down (GST-PD) and then immunoblotted with anti-gst and Flag antibodies. (D) CHO-K1 cells were co-transfected with GFP-p85 and GST tagged full length or BRD7. The cells were immunostained with anti-gst antibodies, followed by DAPI staining and imaged with a fluorescent microscope. Figure S2. The anti-p85α antibody used in immunofluorescence is specifically against endogenous p85α in cells, related to Figure 2. (A) COS7 cells were transfected with control sirna or sirna pool against p85α and subsequently transfected with mcherry-brd7. Cells were examined using immunofluorescence with an antibody against p85α, followed by DAPI staining and imaged with a fluorescent microscope. (B) HeLa cells were transfected with myc-tagged BRD7 and Flag-tagged p85α. Nucleoplasm and chromatin fractions were prepared as described in Experimental Procedures and

3 analyzed with immunoblotting using antibodies against myc, Flag, p110α, p110β, c-jun (nucleoplasm fraction marker) and Histone H3 (chromatin fraction marker). (C) CHO-K1 cells were co-transfected with Flag-tagged p85α, HA-tagged p110α, and His-tagged BRD7. Cell lysates were immunoprecipitated with anti-p85α, anti-ha, and Omni antibodies, followed by immunoblotting with anti-ha and anti-p85α antibodies. (D) Recombinant PI3K complexes were incubated with BRD7 or BSA proteins at indicated ratio at room temperature for 30 minutes and then immunoprecipitated with anti-p110α or p85α antibodies, followed by immunoblotting with antibodies against BRD7, p110α and p85α. (E) Recombinant p85α was incubated with BRD7 or BSA proteins at indicated ratio at room temperature for 30 minutes and then immunoprecipitated with p85α antibodies or control IgG, followed by immunoblotting with antibodies against BRD7 and p85α. Figure S3. BRD7 does not enhance the nuclear translocation of PTEN, related to Figure 2. (A) COS7 cells were transfected with GFP-PTEN and GST-tagged BRD7 or Flag-tagged p85α as indicated. Cells were immunostained with anti-gst or anti-flag antibodies and than incubated with DAPI before imaged with a fluorescent microscope. (B) HeLa cells were co-transfected with myc-tagged BRD7 and Flag-tagged p85α. Cell lysates were immunoblotted with antibodies against PTEN, myc, lamin B1 and α-tubulin. Figure S4. Loss of p85α and/or p85β does not affect BRD7-mediated p21 mrna induction, related to Figure 4. (A) Wild-type, p85α knockout (KO), p85β KO or

4 p85α/β KO MEFs were infected with lentivirus containing vector control or V5-tagged BRD7. After 48 hours, cells were lysed in high-salt buffer and immunoblotted with antibodies against V5, p85α, p85 Pan and β-actin. (B) Total RNAs were extracted from those cells from (A) and analyzed with real-time RT-PCR using primers specifically designed for detecting p21 and β-actin. The mrna level of p21 was normalized with the level of the housekeeping gene, β-actin. ** and *** indicate p 0.01 and p 0.001, respectively. The values are the average of triplicates ± SD.

5

6

7

8

9 Supplemental Tables Table S1 The result from yeast-two-hybrid screen using the ish2 domains of p85α from the database of Alliance for Cell Signaling Data Center (AfCS ID: A001775), related to Figure 1. Prey CATNB ( ) CATNB ( ) EIF4G2 ( ) EIF4G2 ( ) EIF4G2 ( ) EIF4G2 ( ) PIK3CA (1-105) PIK3CD (1-369) PIK3CD (7-336) PTPN13IP ( ) PTPN13IP ( ) PTPN13IP ( ) PTPN13IP ( ) PTPN13IP ( ) PTPN13IP ( ) PTPN13IP ( ) PTPN13IP ( ) PTPN13IP ( ) PTPN13IP ( ) PTPN13IP ( ) PTPN13IP ( ) GOLGA ( ) Library NK-Tag myocyte NK-Tag myocyte NK-Tag myocyte NK-Tag myocyte

10 Table S2 The result from yeast-two-hybrid screen using the ish2 domains of p85β from the database of Alliance for Cell Signaling Data Center (AfCS ID: A001776), related to Figure 1. Prey HSPA5 ( ) NF-KAPPA-B ( ) PDK2 (1-118) PDK2 (47-397) PIK3CD (10-138) PRKAR1A (30-382) PTPN13IP ( ) PTPN13IP ( ) PTPN13IP ( ) PTPN13IP ( ) PTPN13IP ( ) PTPN13IP ( ) PTPN13IP ( ) PTPN13IP ( ) PTPN13IP ( ) ERMP (20-247) HSPC306 ( ) FGFR1OP2 (77-184) Sfpq ( ) Sfpq ( ) LOC80291 (21-198) NAPA (42-296) CARD11 ( ) S100A10 (1-97) S100A10 (1-98) SH3D2B ( ) TRAF1 ( ) PIBF1(756) ( ) BECN1 ( ) TRIM8 (8-552) NP_ ( ) Library Primary myocyte Primary myocyte Embryo Embryo NK-Tag myocyte Embryo Embryo NK-Tag myocyte Embryo NK-Tag myocyte

11 Supplemental Experimental Procedures Plasmids and Proteins. Human full-length or truncated BRD7 coding sequences were amplified by PCR and then cloned into pebb in frame with an N-terminal 3xMyc, GST or mcherry tag. Residues 61 to 92 in BRD7 were deleted to generated NLS deletion mutant. BRD7 was subcloned into pcdna4/hismax and pfastbac-hta vectors (Life Technologies). The mouse p85α constructs (pegfp-c1-p85α-flag, pegfp-c1-p85α- ΔiSH2-Flag and pcmv6-p85α-flag) and the bovine p110α construct (pcdna3-p110α- HA) have been described previously (Luo et al., 2005). The coding sequences of fulllength and truncated mouse p85α were subcloned into the mammalian expression vector pcdna3 in frame with an N-terminal Flag or HA. The BRD7 sirna-resistant cdna encoding full-length or truncated BRD7 with a V5 tag were subcloned into pcdh-ef1- MCS-IRES-Puro (System Biosciences). The pegfp-c-pten construct was kindly provided by Dr. Pier Paolo Pandolfi (Beth Israel Deaconess Medical Center). His 6 -tagged BRD7 was purified by nickel-affinity chromatography (QIAGEN). Recombinant PI3K and p85α proteins were purchased from Echelon Biosciences and Abcam, respectively. Cell culture, transfection and stimulation. HEK293T, HeLa, COS7 and CHO-K1 cells were cultured in DMEM supplemented with 10% fetal calf serum and antibiotics. NCI- H520 cells were maintained in RPMI supplemented with 10% fetal calf serum and antibiotics. Wild-type, p85α knockout, p85β knockout and p85α/β knockout MEFs were generated and cultured as described previously (Brachmann et al., 2005). Human whole blood in cell preparation tube with sodium heparin was purchased from Research Blood Components and mononuclear cells were purified according to manufacturer s

12 instructions. Transfection of DNA or sirna into cells was performed using Lipofectamine 2000 or Lipofectamine RNAiMAX, respectively (Life Technologies). To generate BRD7 sirna-resistant cells, HeLa cells were infected with lentivirus carrying BRD7 with silent mutations and selected with 1µg/ml puromycin. HeLa cells were serum-starved overnight and then stimulated with insulin (100 µm) in serum-free medium or incubated with the medium containing 15% FCS for 30 min. Antibody. Antibodies against GST, phospho-akt (S473), p110β, c-jun and PTEN were purchased from Cell Signaling Technology. Antibodies for p85α were obtained from Millipore or Abcam. Anti-p85 antibody (anti-p85pan) was from Millipore. Antibodies for BRD7 were purchased from Abcam or Bethyl Laboratories. Anti-BRD9 antibody was manufactured by Bethyl Laboratories. Anti-HA and anti-v5 antibodies were obtained from Covance and AbD serotec, respectively. Antibodies against lamin B1, α-tubulin, ARID2, Histone H3 and β-actin were purchased from Abcam. Antibodies for c-myc, total Akt and Omni-probe antibodies were from Santa Cruz Biotechnology. Anti-p110α antibody was obtained from BD Biosciences. Anti-FLAG M2-agarose and anti-flag antibody were manufactured by Sigma. The fluorescence conjugated secondary antibodies (Alexa Fluor 405, Alexa Fluor 488 and Alexa Fluor 568) were purchased from Life Technologies. RNAi. sirna oligos at a final concentration of 20 nm were transfected into HeLa or NCI-H520 cells using Lipofectamine RNAiMAX (Life Technologies). The transfection procedure was repeated on the next day. Cells were harvested on the fourth day for

13 analysis. The sequences of the sirna oligos are as follows (only the sense strands are shown): BRD7-a, GCACGUAUGGAGUUCGAAA; BRD7-b, GUACUAAUGCCAUGAUUUA. ON-TARGETplus SMARTpool against human PIK3R1 or BRD9 sequence was used for knocking-down p85α or BRD9. These RNA oligos together with the control sirna (ON-TARGETplus Non-Targeting sirna) were purchased from Thermo Scientific. Immunoprecipitation and GST-pull down. For immunoprecipitation, cell lysates were incubated with anti-flag M2-agarose at 4 C for 2 hr or with specific antibodies for 1 hr followed by incubating with protein A agarose for another 2 hr. The immunoprecipitates were washed three times with lysis buffer before analyzed by immunoblotting. For GST pull-down experiments, cell lysates were incubated with glutathione sepharose 4B (GE Healthcare Life Sciences) at 4 C for 2 hr, and the sepharose were washed three times with lysis buffer before further analysis. Nuclear and cytoplasmic fractionation. HeLa cells were incubated in cytoplasmic lysis buffer (10 mm Hepes, ph7.5, 2 mm MgCl 2, 1 mm EGTA, 10 mm KCl, 10 mm NaF and 0.1 mm Na 3 VO 4 ) on ice for 5 min. NP-40 was added to the samples to the final concentration of 1%. After incubating for another 3 min on ice, the cell lysates were centrifuged at 13,000 x g for 30 sec. The supernatant was saved as cytoplasmic fraction, whereas the pellet was resuspended in nuclear extraction buffer (25 mm Hepes, ph7.5, 500 mm NaCl, 10mM NaF, 10% Glycerol, 0.2% NP-40 and 5 mm MgCl 2 ) and incubated

14 on ice for 15 min. After centrifugation at 13,000 x g for 5 min, the supernatant was saved as nuclear fraction. To separate nucleoplasm and chromatin proteins, HeLa cells were lysed in lysis buffer (10mM Hepes, ph7.4, 10mM KCl and 0.05% NP-40) on ice for 20 min and then were centrifuged at 13,000 x g for 5 min. The pellet was washed once with lysis buffer, resuspended in low salt buffer (10mM Tris-HCL, ph7.4, 2mM MgCl 2 and 1% Triton-X 100) and then incubated on ice for 15 min. After centrifugation at 13,000 x g for 10 min, the supernatant was saved as nucleoplasm fraction. The pellet was further resuspended in high-salt lysis buffer (20 mm Tris, ph7.5, 500 mm NaCl and 0.5% NP-40), followed by sonication for 20 sec and the supernatant was collected as chromatin fractions after centrifugation at 13,000 x g for 5 min. Real- Time RT- PCR. Total RNAs were extracted using TRIzol (Life Technologies) from cells according to the manufacturer s instructions. Reverse transcription and real-time PCR reactions were carried out using SuperScript VILO MasterMix (Life Technologies) and iq SYBR Green Supermix (Bio-Rad) according to manufacturer s directions. Realtime PCR reactions were performed with Corbett Rotor-Gene 6000 (Qiagen). The sequences of DNA primers for real-time PCR are as follows: Human p110α, sense: GAGTACCTTGTTCCAATCCCAG, anti-sense: TTCCTCTTTAGCACCCTTTCG; Human p110β, sense: CTATCCAGACCAGTACGTTCG, anti-sense: GAGGGCACAATCAAGAAAAGG; Human p85α, sense: GATGGCACTTTTCTTGTCCG, anti-sense: CTGTACAAGTTATAGGGCTCGG; Human BRD7, sense: CTGGAGATGCCGAAGCACAC, anti-sense:

15 TGGGATCCACAGGATGGAGA; Human GAPDH, sense: AGCCACATCGCTCAGACAC, anti-sense: GCCCAATACGACCAAATCC; Mouse p21, sense: GCAGATCCACAGCGATATCC, anti-sense: CAACTGCTCACTGTCCACGG; Mouse β-actin. sense: TGACGTTGACATCCGTAAAGACC, anti-sense: AAGGGTGTAAAACGCAGCTCA. Gel filtration. HeLa cells were lysed in RIPA buffer (50 mm Tris, ph7.4, 150 mm NaCl, 1% NP-40, 0.5% sodium deoxycholate and 0.1% SDS) on ice for 10 min and then centrifuged at 13,000 x g for 5 min. Cell lysates were filtered through 0.45µm filter and applied to Superdex /300 GL using an ÄKTApurifier system (GE Healthcare Life Sciences). Proteins were separated in buffer A (20 mm Tris, ph7.4, 20 mm NaCl, 10 mm KCl, 1 mm MgCl 2 and 1 mm DTT) and 0.5ml fractions were collected.