Materials and Methods

Size: px

Start display at page:

Download "Materials and Methods"

Meredith Townsend
6 years ago
Views:

1 Materials and Methods Construction of noxa / mice and genotyping The targeting vector (see Fig. S) was prepared from a C57BL/6 DNA λ phage library (Stratagene) by replacing a 2.7 kb region encompassing the BH3-containing exons 2 and 3 with a PGK promoter driven hygromycin resistance cassette, flanked by loxp sites. Linearised targeting vector (20 µg) was electroporated into Bruce4 ES cells (C57BL/6). EcoRI-digested DNA from 00 hygromycin-resistant colonies was then screened by Southern blotting with a 600-bp external 3 for the 0.2 kb EcoRI fragment specific to the targeted allele, reduced from 2 kb in the wt. DNA from positive clones was further analyzed to confirm targeting at the 5 arm and that there was a single integration of the targeting construct. Two independent ES clones bearing a single targeted mutation in the noxa allele were microinjected into C57BL/6 blastocysts, which were implanted into pseudo-pregnant BALB/c mice. Chimeric black offspring were backcrossed to C57BL/6 mice and C57BL/6-Deleter mice to generate mice with a deleted mutant noxa allele (see Fig. S). Genotyping was performed using primers specific for the wildtype allele (a and b in Fig. S) [5 -GGAGGGCATAAATGGGCAATGACAC (sense) and 5 -GATGCTTCTTGGGTGCACCCACAC (antisense)] and knockout allele (a and c in Fig. S): a, as before; b, 5 -CAAATTAAGGGCCAAGCTCATTCCTCC (antisense). Construction of puma/bbc3 / mice and genotyping In the targeting vector (see Fig. S3), prepared from C57BL/6 BAC DNA (RP23-277F5), a.8-kb region comprising the BH3-containing exons 2 and 3 was replaced by the PGKneo expression cassette, flanked by loxp sites. Linearized targeting vector (20 µg) was electroporated into Bruce4 ES cells. SphI-digested DNA from 200 neomycin-resistant colonies was screened by Southern blotting with a 600-bp external 3 for a truncated SphI fragment (2Kb - 9Kb). DNA from positive clones was further analyzed using a 500-bp 5 external (BamHI/HindIII digest) as well as a neo-specific (SacI digest). Two independent ES clones bearing a single targeted mutation in the puma/bbc3allele were microinjected into C57BL/6 blastocysts, which were implanted into pseudo-pregnant BALB/c mice. Chimeric black offspring were backcrossed to C57BL/6 mice and C57BL/6-Deleter mice to generate mice with a deleted mutant Puma/bbc3 allele (see Fig. S3). Genotyping was performed using primers specific for the wildtype allele [5 -CCCCAGACGCAGTCTGTGCGCCC (sense) and 5 - CTTTGTGGTTCTAAGTACTGTGGTTTCC (antisense)] and the knockout allele using an alternative antisense primer, 5 - GCCCTGGGGACTAAGGCTGGGGTG. Southern blotting Genomic liver and spleen DNA (20 µg) digested with the appropriate enzymes was electrophoresed on a 0.7% agarose gel and transferred onto GeneScreen Plus hybridization membranes (PerkinElmer Life Sciences). Hybridization was performed using 32 P random primer-labeled s external to the 5 or 3 s boundaries of the targeting constructs.

2 Northern blotting Poly-A + RNA was isolated from tissues and cells by homogenization in guanidine isothyocianate followed by phenol/chloroform extraction and incubation with oligo-(dt) cellulose (Boehringer, Roche). Poly-A + RNA (4 µg) was separated on a % agaroseformaldehyde gel and transferred to Hybond N + membrane (Amersham). Hybridisation was performed using 32 P random primer-labelled cdna s spanning the noxa or puma/bbc3 coding sequence. RT-PCR Total RNA isolated from thymocytes using TRIzol (Gibco BRL) and treated with DNAseI (Boehringer, Roche) was reverse transcribed using AMV-RT (Promega) according to the manufacturer s instructions. The cdna template was used in PCR reactions performed using Amplitaq (Applied Biosystems, Roche) and these primers: noxa, 5 CGTCGGAACGCGCCAGTGAACCC and 5 TCCTTCCTGGGAGGTCCCTTCTTGC; puma/bbc3, 5 ATGGCCCGCGCACGCCAGG and 5 CCGCCGCTCGTACTGCGCGTTG; hprt, 5 GCTGGTGAAAAGGACCTC and 5 CACAGGACTAGAACACCTGC; gapdh 5 TGATGACATCAAGAAGGTGGTGAAG and 5 TCCTTGGAGGCCATGTAGGCCAT. Subsequently, Southern blot transfer was performed onto GeneScreen Plus hybridization membrane (PerkinElmer Life Sciences). Hybridization was performed using 32 P end-labeled oligonucleotides specific for internal noxa (5 AACCCGGGTGCCAGCAGACTTG), puma/bbc3 (5 CGGCGGATGGCGGACGACCTC), hprt (5 GGATACAGGCCAGACTTT) or gapdh (5 CCCGGCATCGAAGGTGGAAGAG) coding sequences, respectively. Whole animal experiments Total viable cell number in bone marrow, thymus, spleen and lymph nodes was determined by preparing single cell suspensions from these organs and counting an aliquot stained with trypan blue in a hemocytometer. The cellular composition of these organs was determined by staining aliquots (0.5 x 0 6 cells) with cell surface markerspecific monoclonal antibodies and flow cytometric analysis (see below). Tissue Culture For liquid culture, cells were grown in the high glucose version of Dulbecco's modified Eagle's medium (DMEM) supplemented with 250 µm asparagine, 50 µm 2- mercaptoethanol and 0% FCS. Mouse embryonic fibroblasts (MEFs) were derived from E4.5 day embryos. The fibroblasts were cultured on gelatin-coated plates, and used between passage and 3. Retroviral Gene Transfer Retroviruses expressing the Ad5 EA cdna were isolated following transfection of Phoenix cells. Viral supernatants were used to infect early-passage MEFs and pure populations of EA-expressing MEFs were isolated by selection for 2-3 days in the presence of 3 µg/ml puromycin. Immunofluorescent Staining and Cell Sorting 2

3 Cell suspensions from bone marrow, thymus, spleen or lymph nodes were stained with surface marker-specific monoclonal antibodies. Antibodies used include: RA3-6B2 anti- CD45R(B220), 5. anti-igm (µ-heavy chain), S7 anti-cd43, T anti-thy-, H29 anti-cd4, YTA32 anti-cd4, YTS69 anti-cd8, MI/70 anti-mac-, RB6-8C5 anti-gr- and TER9 anti-erythroid cell surface marker. These antibodies were purified from hybridoma supernatant on protein-g sepharose columns (Pharmacia) and conjugated to fluorescein-isothiocyonate (FITC), R-phycoerythrin (R-PE), cychrome 5 (Cy5), Texas Red (TXR) or biotin according to the manufacturer s (Molecular Probes) instructions. Bound biotinylated antibodies were revealed by R-PE- or Tricolor-labeled streptavidin (Caltag). Stained cells were analyzed on a FACScan (Becton Dickinson), live and dead cells being discriminated by staining with 2 µg/ml propidium iodide (PI) (Sigma) and by their forward and side light scattering properties. Cell sorting was performed on a FACStar +, DIVA (Becton Dickinson) or MoFlo (Cytomation) cell sorter. Cell Death Analysis For cell death analysis, sorted cells were cultured in DME medium at a concentration of 0.2-x0 6 cells/ml in 96 well flat bottom microtiter plates (Falcon). Cytotoxic stimuli used included: dexamethasone (Sigma) at M and γ-radiation (-0 Gy from a 60 Co source). Cells were cultured for 6, 24, and 96 hours and cell viability determined by staining with PI (2 µg/ml) plus FITC-conjugated annexin V and flow cytometric analysis on a FACScan. Fig. S. Mouse noxa locus showing exons (open boxes) and restriction enzyme sites used to construct the targeting vector and diagnose homologous recombination. The targeting vector replaces exons 2 and 3 encoding the two BH3 domains with a hygromycin resistance cassette (loxp/pgk-hygro/loxp). The external 3 is indicated as well as the positions of PCR primers for detecting the WT allele (a and b) and mutant allele (a and c). B, BglII; S, SpeI; N, NcoI. Fig. S2. CD thymocytes sorted from WT and noxa / mice were cultured in simple medium (no treatment), γ-irradiated (.25 Gy), or treated with etoposide ( µg/ml), dexamethasone ( µm), ionomycin ( µg/ml) or PMA ( ng/ml). Fig. S3. The four exons of the mouse puma/bbc3 gene (open boxes) and restriction sites used to generate the targeting construct and to diagnose homologous recombination are indicated. The targeting vector replaces the ATG-containing exon 2 as well as exon 3, which harbours the BH3 domain, with a neomycin resistance gene flanked by loxp sites (loxp/pgk-neo/loxp) to allow deletion of the neomycin cassette. B, BglII; H, HindIII; P, PstI; S, SbfI. 3

4 Villunger_ Supplementary Figure 9.5 kb SacI N a b S B N Wild-type exon exon 2 exon 3 SacI N B S B Targeting construct loxp/pgkhygro/loxp SacI N B S B N Mutant allele SacI N B S B N Deleted mutant allele a lox c 7.7 kb

5 Villunger_ Supplementary Figure 2 CD4+8+ thymocytes No treatment γ-irradiation.25 Gy Etoposide µg/ml 00 viability % Dexamethasone µm Ionomycin µg/ml PMA ng/ml viability % wild type Hours noxa / p53 /

6 Villunger_ Supplementary Figure kb BamHI B S P BamHI P SalI Wild-type exon exon 2 exon 3 exon 4 B SH P Targeting construct loxp/pgkneo/loxp BamHI B SH P SalI Mutant allele 8 kb

TRANSGENIC ANIMALS. -transient transfection of cells -stable transfection of cells. - Two methods to produce transgenic animals:

TRANSGENIC ANIMALS. -transient transfection of cells -stable transfection of cells. - Two methods to produce transgenic animals: TRANSGENIC ANIMALS -transient transfection of cells -stable transfection of cells - Two methods to produce transgenic animals: 1- DNA microinjection - random insertion 2- embryonic stem cell-mediated gene