Supplementary Figure legends. Supplementary Methods
|
|
- Herbert Gregory
- 6 years ago
- Views:
Transcription
1 Supplementary Methods Transmission electron microscopy. For transmission electron microscopy (TEM), the cell populations were rinsed with 0.1 Sorensen s buffer (ph 7.5), fixed in 2.5% glutaraldehyde for 1.5 h, and subsequently dehydrated and embedded in Spurr s resin. The block was then sectioned into nm ultra thin sections and picked up on copper grids. For routine analysis, ultrathin sections were stained with 2% uranyl acetate and lead citrate. Electron micrographs were obtained using a transmission electron microscope (Joel JEM-1230 equipped with a Gatan UltraScan 4000SP 4K 4K CCD camera). Plasmids, transfection and RNA interference. Cells were cultured in six-well plates and transfected at 80% confluence with Oligofectamine reagent (Invitrogen), in the presence of 100 nm of sirnas specific for human Beclin-1, atg5, hvps34, atf6 and ire1 with appropriate sirna controls. Transient transfections with plasmids were performed with Lipofectamine 2000 reagent (Invitrogen) and cells were used 48 h after transfection for autophagy and apoptosis studies. Assessment of Cytosolic Ca2+ Levels. DU-145 Cells were plated in 24-well plates and transfected with or without calbindin and Calcium levels were measured from cells loaded with the calcium-sensitive fluorescent dye fura-2am (Molecular Probes, Junction City, OR) as described by the manufacturer. Briefly, after Ad.mda-7 treatment for different times DU-145 cells were loaded with fura-2am (5μM) for 30 min at 37 C and fluorescence was measured using Victor3 (PerkinElmer, Waltham, Massachusetts). To quantify the extracellular calcium, fluorescence was measured using, excitation of 340nm and 380nm and the ratio of fluorescence intensities detected at ~510 nm was determined (Thomas and Delaville, 1991). From this ratio, the level of intracellular calcium can be accurately estimated. Supplementary Figure legends Supplementary Figure S1. Electron microscopic analysis of autophagy. (A G) Selected micrographs showing the assembly and progression of autophagic vesicles. (A) Sequestration of cytoplasm by pre-autophagasome (arrow); (B) Cup-shaped membranous structures (arrow) in the cytoplasm; (C) An autophagosome (arrow), containing organelles undergoing degenerative changes; (D) A close contact of autophagosome with lysosome (arrow); (E) Docking and fusion
2 of autophagosome with lysosome (arrow); (F) Typical autolysosomes containing remnant of digested organelles or cytoplasm (arrow) (G) Features of late autophagic cell showing membrane blebbing (arrow head) and autolysosome (arrow). Scale bars: (A, B and C), 0.5 μm; (D, E), 1 μm; (F,G), 1 μm. Supplementary Figure S2. MDA-7/IL-24 induces autophagy in prostate cancer cells. Prostate cancer (PC-3, LNCaP) and P69 normal immortal prostate epithelial cells were infected with Ad.vec or Ad.mda-7 (100 pfu/cell) for 24 h and LC3 expression was determined by Western blotting. Supplementary Figure S3. (A) DU-145 cells were transfected with the indicated sirnas and protein down-regulation was determined by immunoblotting; (B) MDA-7/IL-24 regulates the levels of specific chaperone protein expression. Cells were infected with Ad.vec or Ad.mda-7 (100 pfu/cell) for 24 h and changes in BiP/GRP78, GRP94, GADD153, total eif2α, and p-eif2α proteins were quantified by Western blot analyses. (C) DU-145 cells were infected with 100 pfu/cell of Ad.vec or Ad.mda-7 for different times and ceramide generation was measured as described in Material and methods. Values reported are the mean ± S.D. of three independent experiments. *, p < 0.05 versus control cells. (D) Functional assay of dominant negative PERK. Cells were treated with 1 µm of Thapsigargin (TG) for 24 h and analyzed by Western blotting for total eif2α and p-eif2α as a downstream target of PERK. (E) LC3-II expression 24 h after administration of the indicated sirnas and Ad.mda-7 infection (100 pfu/cell) was determined by immunoblotting. Supplementary Figure S4. (A) DU-145 cells were infected with 100 pfu/cell of Ad.vec or Ad.mda-7 and immunoprecipitated with anti-mda-7/il-24 or anti-beclin-1 followed by immunoblotting with anti-beclin-1, anti-mda-7/il-24, anti-bcl2 or anti-bcl-xl antibodies. (B) DU-145 cells were infected with 100 pfu/cell of Ad.vec or Ad.mda-7 for different times and calcium mobilization was measured as described in Material and methods. Values reported are the mean ± S.D. of three independent experiments. *, p < 0.05 versus control cells.
3 Supplementary Figure-1
4 Supplementary Figure-2
5 Supplementary Figure-3
6 Supplementary Figure-4
Journal of Cell Science Supplementary Material
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 SUPPLEMENTARY FIGURE LEGENDS Figure S1: Eps8 is localized at focal adhesions and binds directly to FAK (A) Focal
More informationSupplemental Information. Pacer Mediates the Function of Class III PI3K. and HOPS Complexes in Autophagosome. Maturation by Engaging Stx17
Molecular Cell, Volume 65 Supplemental Information Pacer Mediates the Function of Class III PI3K and HOPS Complexes in Autophagosome Maturation by Engaging Stx17 Xiawei Cheng, Xiuling Ma, Xianming Ding,
More informationSupplement Figure 1. Plin5 Plin2 Plin1. KDEL-DSRed. Plin-YFP. Merge
Supplement Figure 1 Plin5 Plin2 Plin1 KDEL-DSRed Plin-YFP Merge Supplement Figure 2 A. Plin5-Ab MitoTracker Merge AML12 B. Plin5-YFP Cytochrome c-cfp merge Supplement Figure 3 Ad.GFP Ad.Plin5 Supplement
More informationAnti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR
Supplementary Methods Antibodies Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR (Cat#2646), anti-igf1r (Cat#3018), anti-insr (Cat#3020), anti-akt (pan, Cat#4691), anti-phospho-akt
More informationHeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid
SUPPLEMENTAL MATERIALS AND METHODS Cell culture, transfection and treatments. HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid encoding vmia (HeLa vmia) 1 were cultured
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationAutophagy induction [h]
A SD-N [h]: SD-N [h]: 1 2 4 1 2 4 1 2 4 -GFP 1 2 4 percentage GFP-Atg8 [%] 1 9 8 7 6 5 4 3 2 1 1 2 4 Autophagy induction [h] -13xmyc SD-N [h]: 1 2 4 -GFP -13xmyc 1 prape1 mape1 - - GFP - 13xmyc mape1 [%]
More informationCOPYRIGHTED MATERIAL. Tissue Preparation and Microscopy. General Concepts. Chemical Fixation CHAPTER 1
CHAPTER 1 Tissue Preparation and Microscopy General Concepts I. Biological tissues must undergo a series of treatments to be observed with light and electron microscopes. The process begins by stabilization
More informationSupplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr
Supplemental figure legends Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr A, LβT2 cells were transfected with either scrambled or PEA-15 sirna. Cells were then
More informationAutophagy. Innovative Tools for Analysis. enzolifesciences.com
Autophagy Innovative Tools for Analysis 3FIND YOUR AUTOPHAGY SOLUTION COMPREHENSIVE SOLUTIONS FOR AUTOPHAGY Enabling a Clearer Understanding of Autophagy and Disease Through Innovative Assays Autophagy
More informationCell Structure and Function
Cell Structure and Function Dead White Men Who Discovered (and were made of) Cells: Anton Van Leeuwenhoek Robert Hooke Where the Magic Happened Schleiden Cell Theory All plants are made of cells Schwann
More informationAssays for studying mitochondrial health and function
APPLICATION NOTE Fluorescence labeling and detection Assays for studying mitochondrial health and function Introduction Mitochondria play a critical role in maintaining normal cellular activities. Mitochondria
More informationSupplementary Methods
Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed
More informationChapter. Methods for and. Analysis of Plant Cell Tissue Ultrastructure. Contents. 1.1 Introduction. John E. Mayfield and William V.
In: Dashek, William V., ed. Methods in plant biochemistry and molecular biology. Boca Raton, FL: CRC Press: pp. 3-11. Chapter 1. 1997. Chapter Methods for and Analysis of Plant Cell Tissue Ultrastructure
More information42 fl organelles = 34.5 fl (1) 3.5X X 0.93 = 78,000 (2)
SUPPLEMENTAL DATA Supplementary Experimental Procedures Fluorescence Microscopy - A Zeiss Axiovert 200M microscope equipped with a Zeiss 100x Plan- Apochromat (1.40 NA) DIC objective and Hamamatsu Orca
More informationGFP CCD2 GFP IP:GFP
D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant
More informationSupporting Information
Supporting Information Chakrabarty et al. 10.1073/pnas.1018001108 SI Materials and Methods Cell Lines. All cell lines were purchased from the American Type Culture Collection. Media and FBS were purchased
More informationAzure Biosystems Western Blotting Workflow
Azure Biosystems Western Blotting Workflow PROBE PLAN SEPARATE ANALYZE VISUALIZE PLAN Plan your experiment and choose your detection method Chemiluminescent Western Blotting The most common method for
More informationInvestigation of cellular uptake mechanisms by correlative TEM and SIM
Collaborative Research Center (SFB 1278) Investigation of cellular uptake mechanisms by correlative TEM and SIM Rainer Heintzmann, Fengjiao Ma, Institute of Physical Chemistry Stephanie Höppener, Martin
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationIKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity
IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p5 activity H6 5 5 H58 A59 H6 H58 A59 anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα
More informationGeneral Education Learning Outcomes
BOROUGH OF MANHATTAN COMMUNITY COLLEGE City University of New York Department of Science Title of Course: Cell Biology Class hours 3 BIO Section: 260 Lab hours 3 Semester Spring 2018 Credits 4 Schedule:
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationsirna Transfection Into Primary Neurons Using Fuse-It-siRNA
sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative
More informationab Autophagy Detection Kit
ab139484 Autophagy Detection Kit Instructions for Use For detection of autophagy in live cells by fluorescence microscopy, flow cytometry and fluorescence microplate assay. This product is for research
More informationTransmission Electron Microscopic Study of Antibiotic Action on Klebsiella pneumoniae Biofilm
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Aug. 2002, p. 2679 2683 Vol. 46, No. 8 0066-4804/02/$04.00 0 DOI: 10.1128/AAC.46.8.2679 2683.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved.
More informationOnline Supplementary Information
Online Supplementary Information NLRP4 negatively regulates type I interferon signaling by targeting TBK1 for degradation via E3 ubiquitin ligase DTX4 Jun Cui 1,4,6,7, Yinyin Li 1,5,6,7, Liang Zhu 1, Dan
More informationComparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research.
Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research. by Altogen Labs, 11200 Manchaca Road, Suite 203 Austin TX 78748 USA Tel. (512) 433-6177
More informationInstructions. Fuse-It-siRNA. Shipping and Storage. Overview. Kit Contents. Specifications. Note: Important Guidelines
Membrane fusion is a highly efficient method for transfecting various molecules and particles into mammalian cells, even into sensitive and primary cells. The Fuse-It reagents are cargo-specific liposomal
More informationSupplementary Figure 1. Isolation of GFPHigh cells.
Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding
More informationASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
More informationSupplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets.
Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets. Scale bar represent 100 nm. The sizes of EVs from MDA-MB-231-D3H1 (D3H1),
More informationPlasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System
Plasmid DNA transfection of human colorectal cancer cells with the Biontex K2 Transfection System Stephanie Hehlgans and Franz Rödel, Department of Radiotherapy and Oncology, Goethe- University Frankfurt,
More informationSUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells
SUPPLEMENTARY INFORMATION Small molecule activation of the TRAIL receptor DR5 in human cancer cells Gelin Wang 1*, Xiaoming Wang 2, Hong Yu 1, Shuguang Wei 1, Noelle Williams 1, Daniel L. Holmes 1, Randal
More informationSupplemental Data Supplementary Figure Legends and Scheme Figure S1.
Supplemental Data Supplementary Figure Legends and Scheme Figure S1. UTK1 inhibits the second EGF-induced wave of lamellipodia formation in TT cells. A and B, EGF-induced lamellipodia formation in TT cells,
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid
More informationSupplementary Figure Legend
Supplementary Figure Legend Supplementary Figure S1. Effects of MMP-1 silencing on HEp3-hi/diss cell proliferation in 2D and 3D culture conditions. (A) Downregulation of MMP-1 expression in HEp3-hi/diss
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Thompson et al., http://www.jcb.org/cgi/content/full/jcb.200909067/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Modification-specific antibodies do not detect unmodified
More informationSupplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.
Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/323/5910/124/dc1 Supporting Online Material for Regulation of Neuronal Survival Factor MEF2D by Chaperone-Mediated Autophagy Qian Yang, Hua She, Marla Gearing, Emanuela
More informationFocus Application. Cell Migration. Featured Study: Inhibition of Cell Migration by Gene Silencing. xcelligence System Real-Time Cell Analyzer
xcelligence System Real-Time Cell Analyzer Focus Application Cell Migration Featured Study: Inhibition of Cell Migration by Gene Silencing Markus Greiner and Richard Zimmermann Department of Medical Biochemistry
More informationSupplemental Material
Supplemental Material 1 Figure S1. Phylogenetic analysis of Cep72 and Lrrc36, comparative localization of Cep72 and Lrrc36 and Cep72 antibody characterization (A) Phylogenetic alignment of Cep72 and Lrrc36
More informationBIOLOGICAL SAMPLE PREPARATION FOR TEM OBSERVATION. TEM Seminar Nov 16, 2017 Astari Dwiranti, Ph.D
BIOLOGICAL SAMPLE PREPARATION FOR TEM OBSERVATION TEM Seminar Nov 16, 2017 Astari Dwiranti, Ph.D Why do we need EM for biological samples? (O'Connor and Adams, 2010) Why do we need EM for biological samples?
More informationNanoparticle orientation to control RNA loading and ligand display on extracellular vesicles for cancer regression
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41565-017-0012-z In the format provided by the authors and unedited. Nanoparticle orientation to control RNA loading and ligand display on extracellular
More informationMolecular Cloning. Joseph Sambrook. David W. Russell A LABORATORY MANUAL COLD SPRING HARBOR LABORATORY PRESS VOLUME.
VOLUME Molecular Cloning A LABORATORY MANUAL THIRD EDITION www.molecularcloning.com Joseph Sambrook PETER MACCALLUM CANCER INSTITUTE AND THE UNIVERSITY OF MELBOURNE, AUSTRALIA David W. Russell UNIVERSITY
More informationShort hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
More informationTransfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX
Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA
More informationSupplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
More informationSONOMA STATE UNIVERSITY DEPARTMENT OF BIOLOGY BIOLOGY 344: CELL BIOLOGY Fall 2013
SONOMA STATE UNIVERSITY DEPARTMENT OF BIOLOGY BIOLOGY 344: CELL BIOLOGY Fall 2013 Instructor Murali C. Pillai, PhD Office 214 Darwin Hall Telephone (707) 664-2981 E-mail pillai@sonoma.edu Website www.sonoma.edu/users/p/pillai
More informationRatiometric Calcium Assay Kit
BD Technical Data Sheet Ratiometric Calcium Assay Kit Product Information Catalog Number: 644244 Components: Ratiometric Calcium Indicator, 10 vials, lyophilized 10X Signal Enhancer, 100 ml Description
More informationRevision Checklist for Science Signaling Research Manuscripts: Data Requirements and Style Guidelines
Revision Checklist for Science Signaling Research Manuscripts: Data Requirements and Style Guidelines Further information can be found at: http://stke.sciencemag.org/sites/default/files/researcharticlerevmsinstructions_0.pdf.
More informationFigure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
More informationFor labelling sub-cellular organelles in tissue sections, cell cultures and cell free experiments using our proprietary Red fluorescence probe
ab112127 CytoPainter F-actin Staining Kit - Red Fluorescence Instructions for Use For labelling sub-cellular organelles in tissue sections, cell cultures and cell free experiments using our proprietary
More informationCytoPainter Golgi Staining Kit Green Fluorescence
ab139483 CytoPainter Golgi Staining Kit Green Fluorescence Instructions for Use Designed for the detection of Golgi bodies by microscopy This product is for research use only and is not intended for diagnostic
More informationViral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover
Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and
More informationFigure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43
More informationSOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency
Molecular Cell, Volume 52 Supplemental Information SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency Kengo Homma, Takao Fujisawa, Naomi Tsuburaya, Namiko
More informationSupplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate
Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated
More informationXfect Protein Transfection Reagent
Xfect Protein Transfection Reagent Mammalian Expression Systems Rapid, high-efficiency, low-toxicity protein transfection Transfect a large amount of active protein Virtually no cytotoxicity, unlike lipofection
More informationVisualizing Cells Molecular Biology of the Cell - Chapter 9
Visualizing Cells Molecular Biology of the Cell - Chapter 9 Resolution, Detection Magnification Interaction of Light with matter: Absorbtion, Refraction, Reflection, Fluorescence Light Microscopy Absorbtion
More informationmcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet
Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet Details
More informationTechnical Note. Housekeeping Protein Validation Protocol
Technical Note Housekeeping Protein Validation Protocol Published March 2017. The most recent version of this Technical Note is posted at licor.com/bio/support. Visit us on protocols.io! Explore an interactive
More informationSupplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1.
Supplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1. Percent of original fluorescence was plotted as a function of time following photobleaching
More informationTRANSFEX - SUPERIOR GENE EXPRESSION FOR HARD-TO-TRANSFECT CELL TYPES. Kevin Grady Product Line Business Manager ASCB Vendor Showcase Dec.
TRANSFEX - SUPERIOR GENE EXPRESSION FOR HARD-TO-TRANSFECT CELL TYPES Kevin Grady Product Line Business Manager ASCB Vendor Showcase Dec. 15, 2013 Outline Overview of transfection TransfeX Primary/hTERT
More informationSegments of the obstructed intestinal loops were fixed in 4% paraformaldehyde
Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with
More informationab CytoPainter Phalloidin-iFluor 594
Version 4 Last updated 23 May 2017 ab176757 CytoPainter Phalloidin-iFluor 594 Reagent For staining actin filaments (F-actin) in formaldehyde-fixed cells and tissues. This product is for research use only
More informationSupplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected
Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected with the sirna against lnc-2, lnc-6, lnc-7, and the
More informationImaging Quantum Dots using FUJIFILM LAS 4000
Imaging Quantum Dots using FUJIFILM LAS 4000 Application Note John Pizzonia, Ph.D. 9-28-07 Quantum dots (also known as nanocrystals) are a special class of materials known as semiconductors, which are
More informationFigure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion
Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin
More informationover time using live cell microscopy. The time post infection is indicated in the lower left corner.
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Supplementary Movie 1 Description: Fusion of NBs. BSR cells were infected
More informationKwon et al., Supplemental Figure 1
Kwon et al., Supplemental Figure 1 Mock, 14 dpi AvrRpm1, 14 dpi RabG3bDN RabG3bRNAi Supplemental Figure S1. Cell death phenotypes of leaves inoculated with Pst DC3000 (AvrRpm1) in 5-week-old young plants.
More informationResolution of Microscopes Visible light is nm Dry lens(0.5na), green(530nm light)=0.65µm=650nm for oil lens (1.4NA) UV light (300nm) = 0.13µm f
Microscopes and Microscopy MCB 380 Good information sources: Alberts-Molecular Biology of the Cell http://micro.magnet.fsu.edu/primer/ http://www.microscopyu.com/ Approaches to Problems in Cell Biology
More informationCell type-specific delivery of sirnas with aptamer-sirna chimeras
Cell type-specific delivery of sirnas with aptamer-sirna chimeras Sullenger, B. A. et al Duke Center for Translational Research, Duke University Nature Biotechnology, 2006, 24, 1005 Julia Vargas November
More informationBD Ratiometric Calcium Assay Kit
BD Technical Data Sheet BD Ratiometric Calcium Assay Kit Product Information Catalog Number: 644243 Components: Ratiometric Calcium Indicator, 1 vial, lyophilized 10X Signal Enhancer, 10 ml Calcium Assay
More informationPHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF
YFP-PHF1 CFP-PHT1;2 PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF + CFP-PHT1;2 Negative control!-gfp Supplemental Figure 1: PHT1;2 accumulation is PHF1 dependent. Immunoblot analysis on total protein extract
More informationConfocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
More informationNucleic Acid Transfection. Genomics. TransIT Transfection Tools. Technical tip D.103
The nucleic acids delivery specialists design our transfection reagents. Our formulations provide superior transfection efficiency and cell viability. This complete range includes TransIT reagents, based
More informationCHAPTER 1. Aspects of the Three-Dimensional Intracellular Organization of Mesocarp Cells as Revealed by Scanning Electron Microscopy
CHAPTER 1 Aspects of the Three-Dimensional Intracellular Organization of Mesocarp Cells as Revealed by Scanning Electron Microscopy Reprinted from Protoplasma by permission of Springer-Verlag Publishers,
More informationCyto-ID Autophagy Detection Kit
Enabling Discovery in Life Science Cyto-ID Autophagy Detection Kit for flow cytometry and fluorescence microscopy Instruction Manual Cat. No. ENZ-51031-K200 For research use only. Rev. 1.3 April 2011 Notice
More informationand MCU Channels by Regulating Threshold and Gain
Cell Reports, Volume 21 Supplemental Information MICU2 Restricts Spatial Crosstalk between InsP 3 R and MCU Channels by Regulating Threshold and Gain of MICU1-Mediated Inhibition and Activation of MCU
More informationUse of Phase Contrast Imaging to Track Morphological Cellular Changes due to Apoptotic Activity
A p p l i c a t i o n N o t e Use of Phase Contrast Imaging to Track Morphological Cellular Changes due to Apoptotic Activity Brad Larson and Peter Banks, Applications Department, BioTek Instruments, Inc.,
More informationNature Medicine: doi: /nm.4464
Supplementary Fig. 1. Amino acid transporters and substrates used for selectivity screening. (A) Common transporters and amino acid substrates shown. Amino acids designated by one-letter codes. Transporters
More informationSupplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-
#1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals
More informationSureSilencing sirna Array Technology Overview
SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference
More informationT1: Pure spongia-13(16),14-dien-19-oic acid (T1) (514 mg) was obtained from a Spongia sp.
Supplementary Materials and Methods Synthesis of spongian diterpenoids T1: Pure spongia-13(16),14-dien-19-oic acid (T1) (514 mg) was obtained from a Spongia sp. (sample # 47612) as follows. 45 g dry weight
More informationSciences, Budapest, H-1117 Magyar tudósok körútja 2, PO Box 286, HUNGARY
Title: Interactions of retinoids with the ABC transporters P-glycoprotein and Breast Cancer Resistance Protein Running title: Interactions of retinoids with ABCB1 and ABCG2 Authors: Szabolcs Tarapcsák
More informationChapter 10: Classification of Microorganisms
Chapter 10: Classification of Microorganisms 1. The Taxonomic Hierarchy 2. Methods of Identification 1. The Taxonomic Hierarchy Phylogenetic Tree of the 3 Domains Taxonomic Hierarchy 8 successive taxa
More informationSUPPLEMENTAL MATERIAL. Supplemental Methods. Cumate solution was from System Biosciences. Human complement C1q and complement
SUPPLEMENTAL MATERIAL Supplemental Methods Reagents Cumate solution was from System Biosciences. Human complement Cq and complement C-esterase inhibitor (C-INH) were from Calbiochem. C-INH (Berinert) for
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationSupplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc..4. A B Supplemental Figure. Immunoblot analysis verifies the expression of the AD-PP2C and BD-RGLG proteins in the Y2H assay. Total proteins were extracted
More informationof Medicine, Zhejiang University, Hangzhou, Zhejiang , China Michigan, 4424B MS-1, 1301 Catherine Street, Ann Arbor, MI 48109, USA.
Supplemental figure legends: Neddylation inhibitor MLN4924 suppresses growth and migration of human gastric cancer cells Huiyin Lan 1,2#, Zaiming Tang 1#, Hongchuan Jin 2, and Yi Sun 1,3,4* 1 Institute
More informationNormalization of Agilent Seahorse XF Data by In-situ Cell Counting Using a BioTek Cytation 5
Normalization of Agilent Seahorse XF Data by In-situ Cell Counting Using a BioTek Cytation Application Note Authors Yoonseok Kam 1, Ned Jastromb 1, Joe Clayton, Paul Held, and Brian P. Dranka 1 1 Agilent
More informationOne-step split GFP staining for sensitive protein detection and localization in mammalian cells
Supplementary Materials For: One-step split GFP staining for sensitive protein detection and localization in mammalian cells Lara Kaddoum 1,3, Eddy Magdeleine 1,3, Geoffrey S. Waldo 4, Etienne Joly 1,3,
More informationX2-C/X1-Y X2-C/VCAM-Y. FRET efficiency. Ratio YFP/CFP
FRET efficiency.7.6..4.3.2 X2-C/X1-Y X2-C/VCAM-Y.1 1 2 3 Ratio YFP/CFP Supplemental Data 1. Analysis of / heterodimers in live cells using FRET. FRET saturation curves were obtained using cells transiently
More informationSupplemental Information. Lysine-5 Acetylation Negatively Regulates. Lactate Dehydrogenase A and Is Decreased. in Pancreatic Cancer
Cancer Cell, Volume 23 Supplemental Information Lysine-5 Acetylation Negatively Regulates Lactate Dehydrogenase A and Is Decreased in Pancreatic Cancer Di Zhao, Shao-Wu Zou, Ying Liu, Xin Zhou, Yan Mo,
More informationApoTrack Cytochrome c Apoptosis ICC Antibody
ab110417 ApoTrack Cytochrome c Apoptosis ICC Antibody Instructions for Use For the Immunocytochemistry analysis of cytochrome c and a mitochondrial marker (Complex Vα) in apoptotic cells and nonapoptotic
More informationSupplementary Material. TRIB3 inhibits proliferation and promotes osteogenesis in hbmscs by regulating the. ERK1/2 signaling pathway
Supplementary Material TRIB3 inhibits proliferation and promotes osteogenesis in hbmscs by regulating the ERK1/2 signaling pathway Cui Zhang 1, Fan-Fan Hong 1, Cui-Cui Wang 1, Liang Li 1, Jian-Ling Chen
More informationCBI Toolbox Tour 2015
CBI Toolbox Tour 2015 Thermophoresis (NanoTemper) NT.115 & NT.LabelFree Images: NanoTemper Circular Dichroism Jasco J-1500 Spectrometer Six Position Turreted Peltier Temperature Control System Automated
More informationCalcium Assay Kit. Technical Data Sheet. Product Information. Description. Storage. Materials not included
BD Technical Data Sheet Calcium Assay Kit Product Information Catalog Number: 640176 Size Reagents for 10 plates Components: Calcium Indicator, 1 vial, lyophilized 10X Signal Enhancer, 10 ml 1X Calcium
More information