Supplementary Online Material

Size: px
Start display at page:

Download "Supplementary Online Material"

Transcription

1 Material and Methods Supplementary Online Material Reagents and antibodies Wortmannin, JNK inhibitor II (Anthra[1,9-cd]pyrazol-6(2H)-one 1,9-pyrazoloanthrone), SB 2358, and PD 9859 were purchased from Calbiochem (San Diego, CA). Benzyloxycarbonyl-Valyl-Alanyl-Aspartyl- (O-methyl)-fluoromethylketone (zvad), benzyloxycarbonyl-phenyl- Alanyl-fluoromethylketone (zfa), benzyloxycarbonyl-leucyl-glutamyl- Histidyl-Aspartyl-fluoromethylketone (LEHD), benzyloxycarbonyl- Aspartyl-(O-methyl)-Glutamyl-(O-methyl)-Valyl-Aspartyl-(O-methyl)- fluoromethylketone (DEVD), and benzyloxycarbonyl-alanyl-alanyl- Aspartyl-(O-methyl)-chloromethylketone (zaad) were purchased from Enzyme Systems Products (Livermore, CA). Cycloheximide, 3- methyladenine, and Phorbol myristate acetate were from Sigma (St Louis). Antibodies to mouse caspase-8, RIP, and Beclin-1 were purchased from Pharmingen (San Diego, CA). Antibodies to phospho-jnk, MKK7, and c- Jun were from Cell Signaling Technology (Beverly, MA). The Atg7 antibody was a kind gift from Dr. William Dunn. Preparation of sirna Non-specific RNAi oligoribonucleotides and RNAi oligoribonucleotides corresponding to the following cdna sequences were purchased from Dharmacon (Boulder, CO): Mouse sequences: CAGTTTGGCACAATCAATA for beclin 1. GTTTGTAGCCTCAAGTGTT for mouse ATG7. CCACTAGTCTGACTGATGA for RIP. TGAGATACTCGAGGTGGAT for MKK7. CATTCGATCTCATTCAGTA for c-jun. GATCGAGGATTATGAAAGA for caspase-8. CAAGGAGUGGUGUUGUUAA for caspase-1. CUUGUCUCUGCUCUUAUGA for caspase-2. UUAGCAAGAUUUGGCGAUA for caspase-3. GACGUUGACUGGCUUGUUC for caspase-9. UGACACGCUAUUUCUACCU for caspase-12. Human sequences: CAGTTTGGCACAATCAATA for beclin 1. GGAGUCACAGCUCUUCCUU for human ATG7.

2 Transfection of sirna.5 nmol RNAi were transfected by Amaxa nucleofection TM, using V solution, program T-2 (Gaithersburg, MD). Cells were then cultured in growth medium for 96 hrs before further analysis. Tissue Culture The mouse L929 cell line and human cell line U937 were obtained from the American Type Culture Collection (Rockville, MD). Mouse RAW264.7 cells were a kind gift from Dr. Richard Siegel. L929 cells were cultured in Dulbecco s modified Eagle s medium with 4.5 g/l glucose. U937, RAW264.7 macrophage cells and mouse peritoneal macrophages prepared by thioglycollate injection were cultured in RPMI 164 medium. Media were supplemented with 2 mm L-glutamine, 1% penicillin/streptomycin solution, and 1% fetal bovine serum (FBS). Cell Death Analysis Cell viability was determined after treatments by staining with propidium iodide (2 µg/ml) and flow cytometric analysis on a FACScan. Percent cell death was quantitated as previously described (26). Detection of the phosphorylated JNK/SAPK: L929 cells were treated with DMSO or zvad for 24 hrs in the presence of 2% FBS. The cell lysate was spun for 1 minutes at 13 rpm. 2 ul of the c-jun beads (SAPK/JNK assay kit from Cell Signaling) were added to the supernatant and incubated overnight at 4 C. Beads were washed 4 times with lysis buffer and resuspended in 5 ul of 1X sample buffer. Samples were boiled for 5 minutes and analyzed by SDS-PAGE and Western blot for phosphorylated SAP/JNK by probing with phospho-jnk antibody. Electron microscopy analyses. Cells were fixed in 3% glutaraldehyde in.1 M MOPS buffer (ph 7.) for 8 hrs at room temperature, 3% glutaraldehyde/1% paraformaldehyde in.1 M MOPS buffer (ph 7.) for 16 hours at 4 o C, post-fixed in 1% osmium tetroxide for 1 hour, embedded in Spurr's resin, sectioned, double stained with Uranyl acetate and Lead citrate, and analyzed using a Zeiss EM 1 transmission electron microscope. For each treatment or control group, at least 1 cells from randomly chosen transmission electron microscopy fields were analyzed for quantification of morphological features. Cells with YDFXROHVZHUHVFRUHGDVDXWRSKDJ\SRVLWLYH&HOOVZHUHVWUDWLILHGDV

3 follows: ( YDFXROHVFHOOYDFXROHVFHOO vacuoles/cell), 3 ( YDFXROHVFHOO6FRUHVZHUHUDQNHGDQGFRPSDULVRQV of treatment to control groups were made using the Mann-Whitney U test using the Statview 5..1 program. Statistical analysis of the differences in Fig.1, panels D, E, F, and G and Fig. 2 A, B, D were significant (p<.1). vacuoles / total cytoplasmic area (%) vacuole area / total cytoplasmic area (%) DMSO zvad Fig. S1 Supplemental Figure S1: morphometric analyses of L929 cells treated with DMSO or zvad. NIH Image software was used to compute fractional surface area occupied by autophagic vacuoles

4 ZVAD hrs ZVAD 8 hrs ZVAD 12 hrs Normal cells Autophagic cells(total) Mild autophagy ( cell with 1~ vacuoles) Moderate autophagy ( cell with 2~ vacuoles) Severe Autophagy ( cell with 3 or 1 1 more vacuoles) Apoptotic cell 4 1 Autophagic and apoptotic features 1 1 Lytic/necrotic cell 3 Vacuolated(but not autophagic) 15 Total Table S1 Supplemental Table S1: Time course for zvad-induced autophagy in L929 cells. The fractions of cells with autophagic features based on TEM were quantitated. vacuolated cells (%) DMSO zvad Fig. S2

5 Supplemental Figure S2: Transmission electron microscopy (TEM) of U937 cells treated for 24 hours with DMSO (a) or zvad (b).scale bar in (a, b), 1 um; (c) The fractions of cells with autophagic features based on TEM were quantitated as described in Fig 1 legend. Sample NS RNAi U937 Beclin-1 RNAi Normal U937 ATG7 RNAi Autophagic cells Apoptotic cells Lytic/necrotic cells Vacuolated cells TOTAL Table S2 Supplemental Table S2: Beclin-1 and ATG7 are required for zvad induced autophagy. The fractions of cells with autophagic features based on TEM were quantitated.

6 RAW DMSO 3-MA wortmannin Supplemental Figure S3: zvad induces cell death in RAW264.7, which can be blocked by autophagy inhibitors. RAW264.7 cells were treated with.1 ug/ml Wortmannin (WM) or 1 mm 3-methyladenine (3-MA) for 1 hr and with 1 um zvad or DMSO for 48 hrs, after which cell loss was quantitated by flow cytometry. 6 5 mouse peritoneal macrophages DMSO 3-MA wortmannin Supplemental Figure S4: zvad induce cell death in mouse peritoneal macrophages, which can be blocked by autophagy inhibitors. Mouse

7 peritoneal macrophages cells were treated with.1 ug/ml Wortmannin (WM) or 1 mm 3-methyladenine (3-MA) for 1 hr and with 1 um zvad or DMSO for 24 hrs, after which cell loss were quantitated by flow cytometry DMSO JNK inhibitor p38 inhibitor Erk inhibitor Fig. S5 Supplemental Figure S5: p38 and Erk signaling are not involved in zvad induced L929 cell death. L929 cells were pretreated with 1 ug/ml JNK inhibitor II, 1ug/ml p38 inhibitor SB 2358, or 1 ug/ml Erk inhibitor PD 9859 for 1 hour, and were then treated with 2 um zvad for 4 hours. % cell loss was quantified by flow cytometry as described in the legend to Fig. 1E.

8 DMSO zvad zfa LEHD DEVD zaad Supplemental Figure S6: Induction of L929 cell death by caspases inhibitors. L929 cells were treated with 1ul/ml DMSO, 2uM zvad, 2 um zfa, 2 um LEHD, 2 um DEVD, or 2 um zaad for 4 hours, and % cell loss was quantified by flow cytometry as described in the legend to Fig. 1E NS C-1 C-2 C-3 C-8 C-9 C-12 Fig. S7 Supplemental Figure S7: Induction of L929 cell death by caspase RNAi. L929 cells were transfected with caspase-1, caspase-2, caspase-3, caspase-8, caspase-9, caspase-12 or nonspecific (NS) RNAi. 11 hours after

9 transfection, % cell loss was quantified by flow cytometry as described in the legend to Fig. 1E. Panels below show the abundance of caspases by Western blot or RT-PCR.. RIP cleaved RIP Fig. S8 Supplemental Figure S8: zvad treatment prevents RIP from constitutive caspase-8 cleavage. L929 cells were treated with zvad for 8 hours, and cleavage of RIP was analyzed by western blot using a RIP antibody. The indicated band is the 42 kd proteolytic product that is characteristic of caspase-8 cleavage (1). References 1. Y. Lin, A. Devin, Y. Rodriguez, Z. G. Liu, Genes & Development 13, (1999).

Apoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells

Apoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells Apoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells Ryosuke Horie. Kagawa University of medecine, Kita-gun, Japan. Disclosures: R. Horie: None.

More information

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6

More information

Supplementary Figure legends. Supplementary Methods

Supplementary Figure legends. Supplementary Methods Supplementary Methods Transmission electron microscopy. For transmission electron microscopy (TEM), the cell populations were rinsed with 0.1 Sorensen s buffer (ph 7.5), fixed in 2.5% glutaraldehyde for

More information

For in vitro killing assays with lysed cells, neutrophils were sonicated using a 550 Sonic

For in vitro killing assays with lysed cells, neutrophils were sonicated using a 550 Sonic Supplemental Information Cell Host & Microbe, Volume 8 Statins Enhance Formation of Phagocyte Extracellular Traps Ohn A. Chow, Maren von Köckritz-Blickwede, A. Taylor Bright, Mary E. Hensler, Annelies

More information

Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2

Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2 Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2 female) or wild-type (5 months old, 1 male; 11 months old,

More information

Cell death analysis using the high content bioimager BD PathwayTM 855 instrument (BD

Cell death analysis using the high content bioimager BD PathwayTM 855 instrument (BD Supplemental information Materials and Methods: Cell lines, reagents and antibodies: Wild type (A3) and caspase-8 -/- (I9.2) Jurkat cells were cultured in RPMI 164 medium (Life Technologies) supplemented

More information

FSC-H FSC-H FSC-H

FSC-H FSC-H FSC-H Supplement Figure A 4 h control + h B 4 h control + h Supplement Figure A-H BV6/TNF-α + ctrl A B 9 h C D h E F 8 h G H Supplement Figure I-P + ctrl I J 8 h K L 4 h M N h O P Supplement Figure 3 A Survival

More information

Supplemental Information

Supplemental Information Supplemental Information Intrinsic protein-protein interaction mediated and chaperonin assisted sequential assembly of a stable Bardet Biedl syndome protein complex, the BBSome * Qihong Zhang 1#, Dahai

More information

SUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION

SUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION SUPPLEMENTAL MATERIALS SIRTUIN PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF ACTIVATION Haranatha R. Potteti*, Subbiah Rajasekaran*, Senthilkumar B. Rajamohan*, Chandramohan R. Tamatam,

More information

Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide,

Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide, Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide, conjugated with either TAT or Myristic acid and biotin for

More information

ER stress and autophagy: new players in the mechanism of action and drug resistance of SUPPLEMENTAL DATA

ER stress and autophagy: new players in the mechanism of action and drug resistance of SUPPLEMENTAL DATA ER stress and autophagy: new players in the mechanism of action and drug resistance of the cyclin-dependent kinase inhibitor SUPPLEMENTAL DATA METHODS Confocal immunofluorescence microscopy of fixed cells:

More information

HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid

HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid SUPPLEMENTAL MATERIALS AND METHODS Cell culture, transfection and treatments. HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid encoding vmia (HeLa vmia) 1 were cultured

More information

Supporting Information

Supporting Information Supporting Information He et al. 10.1073/pnas.1116302108 SI Methods Cell Culture. Mouse J774A.1 and RAW 264.7 macrophages were obtained from ATCC and were cultured in MEM supplemented with 10% FS (Sigma)

More information

SUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells

SUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells SUPPLEMENTARY INFORMATION Small molecule activation of the TRAIL receptor DR5 in human cancer cells Gelin Wang 1*, Xiaoming Wang 2, Hong Yu 1, Shuguang Wei 1, Noelle Williams 1, Daniel L. Holmes 1, Randal

More information

Protocol for induction of expression and cell lysate production

Protocol for induction of expression and cell lysate production Protocol for induction of expression and cell lysate production AV-04 Doxycyclin induction and cell lysate 1.0 Introduction / Description This method is intended for the treatment of the previously transfected

More information

< Supporting Information >

< Supporting Information > SUPPORTING INFORMATION 1 < Supporting Information > Discovery of autophagy modulators through the construction of high-content screening platform via monitoring of lipid droplets Sanghee Lee, Eunha Kim,

More information

Establishing sirna assays in primary human peripheral blood lymphocytes

Establishing sirna assays in primary human peripheral blood lymphocytes page 1 of 7 Establishing sirna assays in primary human peripheral blood lymphocytes This protocol is designed to establish sirna assays in primary human peripheral blood lymphocytes using the Nucleofector

More information

SANTA CRUZ BIOTECHNOLOGY, INC.

SANTA CRUZ BIOTECHNOLOGY, INC. TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same

More information

Cleavage of tau by asparagine endopeptidase mediates the neurofibrillary pathology in

Cleavage of tau by asparagine endopeptidase mediates the neurofibrillary pathology in Supplementary information Cleavage of tau by asparagine endopeptidase mediates the neurofibrillary pathology in Alzheimer s disease Zhentao Zhang, Mingke Song, Xia Liu, Seong Su Kang, Il-Sun Kwon, Duc

More information

b alternative classical none

b alternative classical none Supplementary Figure. 1: Related to Figure.1 a d e b alternative classical none NIK P-IkBa Total IkBa Tubulin P52 (Lighter) P52 (Darker) RelB (Lighter) RelB (Darker) HDAC1 Control-Sh RelB-Sh NF-kB2-Sh

More information

Supplementary Material

Supplementary Material Supplementary Material Supplementary Methods Cell synchronization. For synchronized cell growth, thymidine was added to 30% confluent U2OS cells to a final concentration of 2.5mM. Cells were incubated

More information

Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr

Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr Supplemental figure legends Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr A, LβT2 cells were transfected with either scrambled or PEA-15 sirna. Cells were then

More information

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of

More information

Fig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of

Fig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of Fig. S1 TGF RI inhibitor SB525334 effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of different concentrations of SB525334. Cells were lysed and

More information

B. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1.

B. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1. A. - Figure.S1,Li et al. B. : - + - + - + E-cadherin CK19 α-sma vimentin β -actin C. D. Apoptosis: 1.68% 2.99% 1.31% - : - + - + - + Apoptosis: 48.33% 45.32% 44.59% E. invaded cells number 400 300 200

More information

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with

More information

RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the

RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the Supplementary Methods RT-PCR and real-time PCR analysis RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the manufacturer s protocol and quantified by measuring the

More information

Supplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy

Supplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy Supplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy of various tumor type TRCs, including H22 (murine hepatocarcinoma) and CT26 (murine colon cancer). Bar, 50 µm. b, B16 cells

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2386 Figure 1 Src-containing puncta are not focal adhesions, podosomes or endosomes. (a) FAK-/- were stained with anti-py416 Src (green) and either (in red) the focal adhesion protein paxillin,

More information

SUPPLEMENTARY INFORMATION. LIN-28 co-transcriptionally binds primary let-7 to regulate mirna maturation in C. elegans

SUPPLEMENTARY INFORMATION. LIN-28 co-transcriptionally binds primary let-7 to regulate mirna maturation in C. elegans SUPPLEMENTARY INFORMATION LIN-28 co-transcriptionally binds primary let-7 to regulate mirna maturation in C. elegans Priscilla M. Van Wynsberghe 1, Zoya S. Kai 1, Katlin B. Massirer 2-4, Victoria H. Burton

More information

For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab

For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab Page 1 For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab CODE No. M200-3 CLONALITY CLONE ISOTYPE QUANTITY SOURCE IMMUNOGEN FORMURATION STORAGE Monoclonal 1F2 Mouse IgG1 κ 100 µl,

More information

Flow cytometric determination of apoptosis by annexin V/propidium iodide double staining.

Flow cytometric determination of apoptosis by annexin V/propidium iodide double staining. Supplementary materials and methods Flow cytometric determination of apoptosis by annexin V/propidium iodide double staining. Cells were analyzed for phosphatidylserine exposure by an annexin-v FITC/propidium

More information

Supplemental Methods Cell lines and culture

Supplemental Methods Cell lines and culture Supplemental Methods Cell lines and culture AGS, CL5, BT549, and SKBR were propagated in RPMI 64 medium (Mediatech Inc., Manassas, VA) supplemented with % fetal bovine serum (FBS, Atlanta Biologicals,

More information

Figure S1. GST-MDA-7 toxicity in GBM cells is dependent on cathepsin proteases, and weakly

Figure S1. GST-MDA-7 toxicity in GBM cells is dependent on cathepsin proteases, and weakly Supplemental Figure Legends. Figure S1. GST-MDA-7 toxicity in GBM cells is dependent on cathepsin proteases, and weakly dependent on caspase 8. GBM6 and GBM12 cells were treated 24 h after plating with

More information

Cell viability. Cell viability was examined by MTT assay (Sigma-Aldrich).

Cell viability. Cell viability was examined by MTT assay (Sigma-Aldrich). Supplementary Materials Supplementary materials and methods Cell culture. Primary human dermal fibroblasts (DFs) were isolated from full-thickness skin samples. Tissue samples were dissected into small

More information

For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab

For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab Page 1 For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab CODE No. M200-3 CLONALITY CLONE ISOTYPE QUANTITY SOURCE IMMUNOGEN FORMURATION STORAGE Monoclonal 1F2 Mouse IgG1 100 L,

More information

Nature Medicine doi: /nm.2558

Nature Medicine doi: /nm.2558 Supplementary. Fig. 1. (a) Sirt1 and mutant HTT (detected by HTT 81-90 antibody) protein levels were detected by Western blotting in cerebral cortex of N171-82Q mice. (b) Sirt1 and mutant HTT (detected

More information

Reagents and cell culture Mcl-1 gene expression: real-time quantitative RT-PCR In vitro PP2A phosphatase assay Detection of Mcl-1 in vivo

Reagents and cell culture Mcl-1 gene expression: real-time quantitative RT-PCR In vitro PP2A phosphatase assay Detection of Mcl-1 in vivo Reagents and cell culture Antibodies specific for caspase 3, PARP and GAPDH were purchased from Cell Signaling Technology Inc. (Beverly, MA). Caspase inhibitor z-vad-fmk and ROS scavenger N-acetyl-Lcysteine

More information

Supplementary material and methods

Supplementary material and methods Inhibitory effect of caffeic acid on ADP-induced thrombus formation and platelet activation involves mitogen-activated protein kinases Yu Lu 1,2,3,#, Quan Li 3,4,#, Yu-Ying Liu 3,4, Kai Sun 3,4, Jing-Yu

More information

Apoptosis assay: Apoptotic cells were identified by Annexin V-Alexa Fluor 488 and Propidium

Apoptosis assay: Apoptotic cells were identified by Annexin V-Alexa Fluor 488 and Propidium Apoptosis assay: Apoptotic cells were identified by Annexin V-Alexa Fluor 488 and Propidium Iodide (Invitrogen, Carlsbad, CA) staining. Briefly, 2x10 5 cells were washed once in cold PBS and resuspended

More information

Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured

Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured under static conditions. Cells were seeded in the chamber area of the device and cultured overnight without medium perfusion.

More information

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe, Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5

More information

Breast cell lines with Combination Index (CI) and p53 mutation status

Breast cell lines with Combination Index (CI) and p53 mutation status Supplementary Table 1 Breast cell lines with Combination Index (CI) and p53 mutation status Cell Line CI p53 status a BT20 0.44 K132Q BT549 0.53 R249S CAL120 0.61 c.672+2t>g CAL51 0.73 wild-type CAMA1

More information

Marilyn G. Rimando, Hao-Hsiang Wu, Yu-An Liu, Chien-Wei Lee, Shu-Wen Kuo, Yin-

Marilyn G. Rimando, Hao-Hsiang Wu, Yu-An Liu, Chien-Wei Lee, Shu-Wen Kuo, Yin- Supplementary Information Glucocorticoid receptor and Histone Deacetylase 6 mediate the differential effect of dexamethasone during osteogenesis of Mesenchymal stromal cells (MSCs) Marilyn G. Rimando,

More information

Supplementary Fig. 1 Kinetics of appearence of the faster migrating form of Bcl-10.

Supplementary Fig. 1 Kinetics of appearence of the faster migrating form of Bcl-10. α-cd3 + α-cd28: Time (min): + + + + + + + + + 0 5 15 30 60 120 180 240 300 360 360 n.s. Supplementary Fig. 1 Kinetics of appearence of the faster migrating form of. Immunoblot of lysates from Jurkat cells

More information

Introduction and Background

Introduction and Background Introduction and Background Caspase cleaved Keratin 18 (cck18) Epithelial Apoptosis Biomarker entities. Consequently, M30 CytoDEATH mab represents a unique tool for easy and For in vitro Tumor and Organ

More information

SUPPLEMENTAL MATERIAL. Supplemental Methods. Cumate solution was from System Biosciences. Human complement C1q and complement

SUPPLEMENTAL MATERIAL. Supplemental Methods. Cumate solution was from System Biosciences. Human complement C1q and complement SUPPLEMENTAL MATERIAL Supplemental Methods Reagents Cumate solution was from System Biosciences. Human complement Cq and complement C-esterase inhibitor (C-INH) were from Calbiochem. C-INH (Berinert) for

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION The Supplementary Information (SI) Methods Cell culture and transfections H1299, U2OS, 293, HeLa cells were maintained in DMEM medium supplemented with 10% fetal bovine serum. H1299 and 293 cells were

More information

. Viability of colonies was then assessed using the WST-1 reagent as described above, and normalized relative to untreated controls.

. Viability of colonies was then assessed using the WST-1 reagent as described above, and normalized relative to untreated controls. Cell viability analysis in the absence of disaggregation To assess cell viability in the absence of disaggregation, quintuplicate samples of cells at 5 x 1 5 /ml were treated with mab (1 µg/ml) for 24

More information

Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53

Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53 Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -

More information

Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various

Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various GST-tagged N-terminal truncated APP fragments including GST-APP full-length (FL), APP (123-695), APP (189-695), or

More information

Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4

Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4 SUPPLEMENTARY FIGURE LEGENDS Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4 directly up-regulates the expression of NIPP1 and CCNF that together inhibit protein phosphatase

More information

Data Sheet IDO2 - HEK293 Recombinant Cell Line Cat #: 60533

Data Sheet IDO2 - HEK293 Recombinant Cell Line Cat #: 60533 Data Sheet IDO2 - HEK293 Recombinant Cell Line Cat #: 60533 Description Recombinant HEK293 cell line expressing tetracycline-inducible human indoleamine 2,3- dioxygenase (IDO2), Genbank accession number

More information

Supplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb.

Supplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb. Supplementary Figure 1 α-synuclein is truncated in PD and LBD brains. (a) Specificity of anti-n103 antibody. Anti-N103 antibody was coated on an ELISA plate and different concentrations of full-length

More information

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p5 activity H6 5 5 H58 A59 H6 H58 A59 anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα

More information

Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of

Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of Supplementary Information Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of Syntaxin 1 and SNAP-25 in Neuron Survival Lisheng Peng, Huisheng Liu, Hongyu Ruan, William H. Tepp, William H. Stoothoff,

More information

Anti-p62 C-terminal pab

Anti-p62 C-terminal pab Page 1 For Research Use Only. Not for use in diagnostic procedures. Anti-p62 C-terminal pab CODE No. CLONALITY Polyclonal ISOTYPE Guinea pig Ig, affinity purified QUANTITY 100 µl SOURCE IMMUNOGEN FORMURATION

More information

Supplemental Figure Legends:

Supplemental Figure Legends: Supplemental Figure Legends: Fig S1. GFP-ABRO1 localization. U2OS cells were infected with retrovirus expressing GFP- ABRO1. The cells were fixed with 3.6% formaldehyde and stained with antibodies against

More information

Data Sheet PD-1 / NFAT - Reporter - Jurkat Recombinant Cell Line Catalog #: 60535

Data Sheet PD-1 / NFAT - Reporter - Jurkat Recombinant Cell Line Catalog #: 60535 Data Sheet PD-1 / NFAT - Reporter - Jurkat Recombinant Cell Line Catalog #: 60535 Product Description Recombinant Jurkat T cell expressing firefly luciferase gene under the control of NFAT response elements

More information

Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice

Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice Supplementary Material Supplementary Methods Materials Spironolactone, aldosterone and β-glycerophosphate were

More information

Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR

Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR Supplementary Methods Antibodies Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR (Cat#2646), anti-igf1r (Cat#3018), anti-insr (Cat#3020), anti-akt (pan, Cat#4691), anti-phospho-akt

More information

SUPPLEMENTAL MATERIAL. Supplemental Methods:

SUPPLEMENTAL MATERIAL. Supplemental Methods: SUPPLEMENTAL MATERIAL Supplemental Methods: Immunoprecipitation- As we described but with some modifications [22]. As part of another ongoing project, lysate from human umbilical vein endothelial cells

More information

MeCP2. MeCP2/α-tubulin. GFP mir1-1 mir132

MeCP2. MeCP2/α-tubulin. GFP mir1-1 mir132 Conservation Figure S1. Schematic showing 3 UTR (top; thick black line), mir132 MRE (arrow) and nucleotide sequence conservation (vertical black lines; http://genome.ucsc.edu). a GFP mir1-1 mir132 b GFP

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature09732 Supplementary Figure 1: Depletion of Fbw7 results in elevated Mcl-1 abundance. a, Total thymocytes from 8-wk-old Lck-Cre/Fbw7 +/fl (Control) or Lck-Cre/Fbw7 fl/fl (Fbw7 KO) mice

More information

RPCI 001 v.003 In vitro Intracellular Cytokine Staining With and Without Stimulation

RPCI 001 v.003 In vitro Intracellular Cytokine Staining With and Without Stimulation Immune Tolerance Network RPCI 001 v.003 Author: Paul Wallace and Earl Timm, Director, RPCI Laboratory of Flow Cytometry Approved by: Paul Wallace, Director, RPCI Laboratory of Flow Cytometry 1.0 Title

More information

Yeast Nuclei Isolation Kit

Yeast Nuclei Isolation Kit Yeast Nuclei Isolation Kit Catalog Number KA3951 50 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 General Information...

More information

High throughput screening: Huh-7 cells were seeded into 96-well plate (2000

High throughput screening: Huh-7 cells were seeded into 96-well plate (2000 1 SUPPLEMENTARY INFORMATION METHODS 6 7 8 9 1 11 1 1 1 1 16 17 18 19 High throughput screening: Huh-7 cells were seeded into 96-well plate ( cells/well) and infected with MOI of DENV-. One hour post-infection

More information

Regulation of autophagic activity by ζ proteins associated with class III. phosphatidylinositol-3 kinase. Mercedes Pozuelo Rubio

Regulation of autophagic activity by ζ proteins associated with class III. phosphatidylinositol-3 kinase. Mercedes Pozuelo Rubio ONLINE SUPPORTING INFORMATION Regulation of autophagic activity by 14-3-3ζ proteins associated with class III phosphatidylinositol-3 kinase Mercedes Pozuelo Rubio entro Andaluz de Biología Molecular y

More information

Technical Bulletin. Multiple Methods for Detecting Apoptosis on the BD Accuri C6 Flow Cytometer. Introduction

Technical Bulletin. Multiple Methods for Detecting Apoptosis on the BD Accuri C6 Flow Cytometer. Introduction March 212 Multiple Methods for Detecting Apoptosis on the BD Accuri C6 Flow Cytometer Contents 1 Introduction 2 Annexin V 4 JC-1 5 Caspase-3 6 APO-BrdU and APO-Direct Introduction Apoptosis (programmed

More information

Supplemental Figure 1

Supplemental Figure 1 Supplemental Figure 1 A IL-12p7 (pg/ml) 7 6 4 3 2 1 Medium then TLR ligands MDP then TLR ligands Medium then TLR ligands + MDP MDP then TLR ligands + MDP B IL-12p4 (ng/ml) 1.2 1..8.6.4.2. Medium MDP Medium

More information

Supporting Information

Supporting Information Supporting Information Casson et al. 10.1073/pnas.1421699112 Sl Materials and Methods Macrophage Infections. In experiments where macrophages were primed with LPS, cells were pretreated with 0.5 μg/ml

More information

Supplementary methods

Supplementary methods Supplementary methods Cell culture, infection, transfection, and RNA interference HEK293 cells and its derivatives were grown in DMEM supplemented with 10% FBS. Various constructs were introduced into

More information

Supporting Information

Supporting Information Supporting Information Tal et al. 10.1073/pnas.0807694106 SI Materials and Methods VSV Infection and Quantification. Infection was carried out by seeding 5 10 5 MEF cells per well in a 6-well plate and

More information

RNP-IP (Modified Method)-Getting Majority RNA from RNA Binding Protein in the Cytoplasm Fengzhi Liu *

RNP-IP (Modified Method)-Getting Majority RNA from RNA Binding Protein in the Cytoplasm Fengzhi Liu * RNP-IP (Modified Method)-Getting Majority RNA from RNA Binding Protein in the Cytoplasm Fengzhi Liu * School of Biomedical Sciences, Thomas Jefferson University, Philadelphia, USA *For correspondence:

More information

Alt-R CRISPR-Cpf1 System:

Alt-R CRISPR-Cpf1 System: user guide Alt-R CRISPR-Cpf1 System: Delivery of ribonucleoprotein complexes in HEK-293 cells using the Amaxa Nucleofector System See what more we can do for you at www.idtdna.com. For Research Use Only

More information

Supplementary Information. A novel human endogenous retroviral protein inhibits cell-cell fusion. Supplementary Figures:

Supplementary Information. A novel human endogenous retroviral protein inhibits cell-cell fusion. Supplementary Figures: Supplementary Information A novel human endogenous retroviral protein inhibits cell-cell fusion Jun Sugimoto, Makiko Sugimoto, Helene Bernstein, Yoshihiro Jinno and Danny J. Schust Supplementary Figures:

More information

NucView TM 488 Caspase-3 Assay Kit for Live Cells

NucView TM 488 Caspase-3 Assay Kit for Live Cells NucView TM 488 Caspase-3 Assay Kit for Live Cells Catalog Number: 30029 (100-500 assays) Contact Information Address: Biotium, Inc. 3423 Investment Blvd. Suite 8 Hayward, CA 94545 USA Telephone: (510)

More information

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12119 SUPPLEMENTARY FIGURES AND LEGENDS pre-let-7a- 1 +14U pre-let-7a- 1 Ddx3x Dhx30 Dis3l2 Elavl1 Ggt5 Hnrnph 2 Osbpl5 Puf60 Rnpc3 Rpl7 Sf3b3 Sf3b4 Tia1 Triobp U2af1 U2af2 1 6 2 4 3

More information

Supplemental Information. Pacer Mediates the Function of Class III PI3K. and HOPS Complexes in Autophagosome. Maturation by Engaging Stx17

Supplemental Information. Pacer Mediates the Function of Class III PI3K. and HOPS Complexes in Autophagosome. Maturation by Engaging Stx17 Molecular Cell, Volume 65 Supplemental Information Pacer Mediates the Function of Class III PI3K and HOPS Complexes in Autophagosome Maturation by Engaging Stx17 Xiawei Cheng, Xiuling Ma, Xianming Ding,

More information

Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas.

Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Target Gene Non-target / Control BTG2 BRCA1 NFE2L2 Target Sequence ON-TARGET plus Non-targeting sirna # 1 (Cat# D-001810-01-05) sirna1: GAACCGACAUGCUCCCGGA

More information

Long-lived protein degradation assay

Long-lived protein degradation assay Long-lived protein degradation assay Shun Kageyama, Takashi Ueno, Masaaki Komatsu METHOD Pulse and chase 1. Seed cells in 24-well plates in regular medium supplemented with 10% (v/v) heat-inactivated FBS

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Han et al., http://www.jcb.org/cgi/content/full/jcb.201311007/dc1 Figure S1. SIVA1 interacts with PCNA. (A) HEK293T cells were transiently

More information

Isolation, culture, and transfection of primary mammary epithelial organoids

Isolation, culture, and transfection of primary mammary epithelial organoids Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)

More information

Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators.

Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators. Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators. (a) A graphic depiction of the approach to determining the stability of

More information

USER GUIDE. Introduction. Catalog No. C10423, C10723

USER GUIDE. Introduction. Catalog No. C10423, C10723 USER GUIDE CellEvent Caspase-3/7 Green Detection Reagent Catalog No. C10423, C10723 Pub. No. MAN0003556 Rev. B.0 Table 1. Contents and storage Material C10423 Amount C10723 Concentration Storage* CellEvent

More information

colorimetric sandwich ELISA kit datasheet

colorimetric sandwich ELISA kit datasheet colorimetric sandwich ELISA kit datasheet For the quantitative detection of human IL1-beta in serum, plasma and cell culture supernatants. general information Catalogue Number Product Name Species cross-reactivity

More information

SUPPLEMENTARY NOTE 3. Supplememtary Note 3, Wehr et al., Monitoring Regulated Protein-Protein Interactions Using Split-TEV 1

SUPPLEMENTARY NOTE 3. Supplememtary Note 3, Wehr et al., Monitoring Regulated Protein-Protein Interactions Using Split-TEV 1 SUPPLEMENTARY NOTE 3 Fluorescent Proteolysis-only TEV-Reporters We generated TEV reporter that allow visualizing TEV activity at the membrane and in the cytosol of living cells not relying on the addition

More information

Supplementary Figure 1. The chemical structure of compound A. Compound A has an amino terminal methyl alanine and compound B has an

Supplementary Figure 1. The chemical structure of compound A. Compound A has an amino terminal methyl alanine and compound B has an Supplemental Data IAP Antagonists Target ciap1 to Induce TNFα-Dependent Apoptosis James E. Vince, W. Wei-Lynn Wong, Nufail Khan, Rebecca Feltham, Diep Chau, Afsar U. Ahmed, Christopher A. Benetatos, Srinivas

More information

Supplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell

Supplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell Supplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell Supplementary Figures S1-S3 Supplementary Methods Supplementary Figure S1. Identification

More information

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative

More information

Supplemental Data Supplementary Figure Legends and Scheme Figure S1.

Supplemental Data Supplementary Figure Legends and Scheme Figure S1. Supplemental Data Supplementary Figure Legends and Scheme Figure S1. UTK1 inhibits the second EGF-induced wave of lamellipodia formation in TT cells. A and B, EGF-induced lamellipodia formation in TT cells,

More information

Supplementary Information: Materials and Methods. GST and GST-p53 were purified according to standard protocol after

Supplementary Information: Materials and Methods. GST and GST-p53 were purified according to standard protocol after Supplementary Information: Materials and Methods Recombinant protein expression and in vitro kinase assay. GST and GST-p53 were purified according to standard protocol after induction with.5mm IPTG for

More information

Four different active promoter genes were chosen, ATXN7L2, PSRC1, CELSR2 and

Four different active promoter genes were chosen, ATXN7L2, PSRC1, CELSR2 and SUPPLEMENTARY MATERIALS AND METHODS Chromatin Immunoprecipitation for qpcr analysis Four different active promoter genes were chosen, ATXN7L2, PSRC1, CELSR2 and IL24, all located on chromosome 1. Primer

More information

This Document Contains:

This Document Contains: This Document Contains: 1. In-Cell Western Protocol II. Cell Seeding and Stimulation Supplemental Protocol III. Complete Assay Example: Detailing the Seeding, Stimulation and Detection of the A431 Cellular

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Cell cycle distribution (%) 1 8 6 4 2 Cell Cycle G1 S G2 Viability (%) 5 4 3 2 1 Viability Supplementary Figure 1. Cell cycle distribution and viability during DSB repair measurements.

More information

Transcriptional regulation of BRCA1 expression by a metabolic switch: Di, Fernandez, De Siervi, Longo, and Gardner. H3K4Me3

Transcriptional regulation of BRCA1 expression by a metabolic switch: Di, Fernandez, De Siervi, Longo, and Gardner. H3K4Me3 ChIP H3K4Me3 enrichment.25.2.15.1.5 H3K4Me3 H3K4Me3 ctrl H3K4Me3 + E2 NS + E2 1. kb kb +82 kb Figure S1. Estrogen promotes entry of MCF-7 into the cell cycle but does not significantly change activation-associated

More information

TrkB knockdown cell lines (i.e., BBM1-KD and 361-KD cells) were prepared by

TrkB knockdown cell lines (i.e., BBM1-KD and 361-KD cells) were prepared by Supplemental Information Cell Culture TrkB knockdown cell lines (i.e., BBM1-KD and 361-KD cells) were prepared by transducing BBM1 or 361 cells with a lentivirus encoding shrna for TrkB. Transduction was

More information

Supporting information. Supplementary figures.

Supporting information. Supplementary figures. Supporting information. Supplementary figures. Figure S1. Vacuolar parasite content is independent of the number of vacuoles per cell. The datasets employed for Fig. 1B were examined to determine the number

More information

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG. Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination

More information