SUPPLEMENTARY INFORMATION
|
|
|
- Sheryl Allen
- 5 years ago
- Views:
Transcription
1 DOI: 1.138/ncb37 a mrna relative expression CTR NGPS OCT4 SOX2 KLF4 c-myc b BANF1 mrna levels plko.1 shbanf1 c Tra-1-6+ colonies 3 1 plko.1 shbanf1 d BANF1 locus Plasmid donor template 3kb loxp 3kb Fwd PGK-Neo loxp * Rev e Recombinant allele BAF NGPS-iPSC 1 2 M r (K) 5 37 CTR pbabe BANF1 NGPS pbabe BANF1 BAF f % Abnormal nuclei CTR NGPS NGPS edited g Tra-1-6+ colonies pbabe BANF1 CTR NGPS Soria-Valles et al. Supplementary Fig. 1 Supplementary Figure 1 Reversal of NGPS alterations through expression of wild-type BANF1. (a) qrt-pcr of OCT4, SOX2, KLF4 and c-myc in control and NGPS fibroblasts at day 3 of reprogramming. n = 3 independent experiments. (b) Control fibroblasts were transduced with a BANF1-specific shrna. qrt-pcr of BANF1 mrna was performed in plko.1 and shbanf1 transduced fibroblasts. mrna mean relative values are represented. n = 3 independent experiments, P =.2. (c) BANF1 down-regulation impedes cell reprogramming. plko.1 and shbanf1 transduced-fibroblasts were reprogrammed. Plot represents the number of Tra-1-6 positive colonies. n = 3 independent experiments, P =.1. (d) Scheme depicting the strategy followed for genome editing of NGPSiPSCs using CRISPR-Cas9 system. The purpose of this experiment was introducing through homologous-directed repair the BANF1 wild-type sequence in NGPS-iPSCs. (e) Two representative clones from NGPS-iPSCs were analyzed by PCR in order to detect the presence of the recombinant allele. Note that recombinant allele c.34g expression in NGPS-iPSCs notably increased the levels of BAF. Western blot analysis of BAF in edited NGPS fibroblasts (left). Western-blot analysis of BAF in control and NGPS fibroblasts transduced with a retroviral vector containing wild-type BANF1 transgene (right). A representative image is shown of 3 independent experiments. (f) Representative analysis of nuclear envelope abnormalities in fibroblasts derived from NGPS-corrected ipscs. n = 1 cells assessed in 3 independent preparations, P =.1 both comparisons. (g) NGPS fibroblasts transduced with wild-type BANF1 were reprogrammed into ipscs. The plot represents the number of Tra-1-6 positive colonies. n = 3 independent experiments, P =.1. Error bars indicate SEM (P<.1, two-tailed Student s t test). Unprocessed original scans of blots are shown in Supplementary Fig Macmillan Publishers Limited. All rights reserved
2 a CTR-iPSCs G C A T G C NGPS-iPSCs A C A T G T b OCT4 SOX2 HF ESC CTR N-I N-II NANOG GDF3 fwd rev fwd rev htert b -actin c Ectoderm Mesoderm Endoderm d Fibroblasts ipscs CTR N-I N-II CTR N-I N-II N-II n = 577 CpGs N-I CTR n = 474 CpGs 1 DNA methylation level Supplementary Figure 2 Detailed analysis of NGPS and control ipscs. (a) BANF1 c.34g>a mutation verified by DNA sequencing of NGPS-iPSCs. (b) RT-PCR analysis of pluripotency markers in representative clones from control and NGPS-iPSCs. RNA from human fibroblasts (HF) and hesc was used as a negative and positive control, respectively. (c) Representative series of hematoxylin-eosin (H&E) stained sections from teratomas produced from control, N-I and N-II-iPSCs are shown. All of them formed teratomas with tissues representing all three embryonic germ layers. Bar, 1 μm. (d) DNA methylation profiling of control and NGPS fibroblasts and ipscs. NGPS-iPSCs showed methylation patterns indistinguishable from control ipscs, erasing all the alterations shown by progeroid fibroblasts. Unprocessed original scans of PCRs are shown in Supplementary Fig Macmillan Publishers Limited. All rights reserved
3 GO map (GOrilla software) of hypermethylated genes in NGPS vs CTR GO map (GOrilla software) of hypomethylated genes in NGPS vs CTR Soria-Valles et al. Supplementary Fig. 3 Supplementary Figure 3 Gene Ontology analysis of epigenetic alterations in NGPS-fibroblasts. Genes that showed significant differences in methylation status in NGPS fibroblasts as compared with controls were analyzed through gene ontology for functional annotation. 3 Macmillan Publishers Limited. All rights reserved
4 a b c HFs ipsc i ipsc +i d mrna relative expression g Tra-1-6+ colonies DOT1L relative expression 1 5 pbabe -i OCT IκBα-SR IKK2-KI +i NANOG e Relative cell number Tra-1-6+ colonies 3 1 pbabe IκBα-SR IKK2-KI plko.1 shbanf CTR 5 Series1 Series2 IKK2-CA 3 Series3 Tax Days f mrna relative expression OCT4 SOX2 NANOG GDF3 htert b -actin DOT1L YY1 * * NANOG LIN28A pbabe BANF1 NGPS-edited. CTR IKK2-CA Tax Soria-Valles et al. Supplementary Fig. 4 Supplementary Figure 4 regulation of somatic cell reprogramming. (a) NGPS-fibroblasts were transduced either with pbabe-empty vector, IκBα-SR or IKK-kinase inactive (KI) and reprogrammed into ipscs. Plot represents the number of Tra-1-6 positive colonies. Triplicates were done for each condition and mean values are represented. pbabe versus SR, P =.1; pbabe versus IKK2-KI, P =.2. (b) Control fibroblasts expressing a BANF1-specific shrna were transduced either with pbabe, IκBα-SR or IKK2-KI and reprogrammed. Plot represents the number of Tra-1-6 positive colonies. n = 3, pbabe versus SR, P =.1; pbabe versus IKK2-KI, P =.1. (c) ipscs derived from i-treated cultures express pluripotency-associated markers in a similar extent to untreated ipscs. RT-PCR results from representative clones are shown. RNA from human fibroblasts was used as negative control. (d) qrt-pcr of OCT-4 and NANOG in ipscs derived in the presence of inhibitors. n = 3 independent experiments. (e) Relative proliferative values of control-, IKK2-CA or Taxtransduced fibroblasts. (f) qrt-pcr of DOT1L (BANF1, P =.8; NGPSedited, P =.6), YY1 (BANF1, P =.9; NGPS-edited, P =.7), NANOG (BANF1, P =.2; NGPS-edited, P =.3) and LIN28A (BANF1, P =.4; NGPS-edited, P =.3) in NGPS corrected fibroblasts. n = 3 independent experiments. (g) qrt-pcr of DOT1L in control and IKK2-CA (P =.5) or Tax-transduced fibroblasts is shown (P =.3). n = 3 independent experiments. For the experiments with ipscs, at least three different clones were analyzed for each genotype and representative results are shown. Error bars indicate SEM (*P<.5; P<.1, twotailed Student s t test). Unprocessed original scans of PCRs are shown in Supplementary Fig Macmillan Publishers Limited. All rights reserved
5 a b c Relative cell number CTR NGPS NGPS-edited NGPS NGPS-edited SA-β-Gal % SA-β-Gal positive cells CTR NGPS NGPS edited % BrdU positive nuclei CTR NGPS NGPS edited d CTR pbabe CTR BANF1 e pbabe BANF1 f pbabe BANF1 SA-β-Gal NGPS pbabe NGPS BANF Relative cell number Days pbabe BANF1 % SA-β-Gal positive cells % BrdU positive nuclei CTR NGPS CTR NGPS Supplementary Figure 5 Premature senescence in NGPS fibroblasts. (a) Relative proliferation values of control, NGPS and Cas9-edited NGPS fibroblasts. (b) SA-β-gal staining in the same cells. Percentage of cells with positive staining is represented. n = 1 cells assessed in 3 independent fields (also hereafter in similar experiments). P =.2. Bar, μm. (c) Percentage of cells with positive nuclear staining of anti-brdu antibody. P =.2. (d) Relative proliferation values of control and NGPS fibroblasts transduced with pbabe or BANF1 are represented. CTR versus NGPS, P =.1; pbabe versus BANF1, P =.2. (e) SA-β-gal staining in the same cells. CTR versus NGPS, P =.2; pbabe versus BANF1, P =.2. Bar, μm. (f) Percentage of cells with positive nuclear staining of anti-brdu antibody. Error bars indicate SEM (P<.1, two-tailed Student s t test). 5 Macmillan Publishers Limited. All rights reserved
6 a P-p53 p53 p21 p16 c e Oct-1 CTR NGPS pbabe SR pbabe SR p16 pbabe IκBα-SR M r (K) 5 37 plko.1 shbanf1 -shp53 +shp53 M r (K) b IκBα-SR pbabe 1 5 H 2 O 2 % SA-β-Gal positive cells % BrdU positive nuclei d Tra-1-6+ colonies pbabe IκBα-SR pbabe IκBα-SR NGPS shp53 IκBα-SR shp53/sr Supplementary Figure 6 regulation of p53-mediated senescence. (a) Western-blot analyses of p53, p21 and p16 proteins in control and NGPS fibroblasts transduced with pbabe or IκBα-superrepressor. was used as a loading control. A representative image is shown of 3 independent experiments. (b) Senescence induction with hydrogen peroxide (.1 mm for 2 h) in control fibroblasts transduced with pbabe or IκBα-SR. Percentages of SA-β-gal (P =.1) and anti-brdu positive cells (P =.2) are depicted and representative pictures from SA-β-gal staining are shown. n = 1 cells assessed in 3 independent fields (also hereafter in similar experiments). Bar, μm. (c) p16 western-blot analyses in hydrogen peroxide-treated control fibroblasts. was used as a loading control. (d) NGPS fibroblasts transduced with TP53 shrna and IκBα-SR were reprogrammed into ipscs. Plot represents the number of Tra-1-6 positive colonies. n = 3 independent experiments for each condition and mean values are represented. NGPS versus shp53, P =.5; shp53 versus SR, P =.4. (e) Specific down-regulation of TP53 in NGPS fibroblasts did not affect activation. EMSA in control fibroblasts transduced with BANF1 shrna in the presence or absence of TP53 shrna. Oct-1 probe was used as an endogenous control. Error bars indicate SEM (P<.1, two-tailed Student s t test). Unprocessed original scans of blots are shown in Supplementary Fig Macmillan Publishers Limited. All rights reserved
7 a CTR.Fibs CTR.MSCs NGPS.Fibs NGPS.MSCs b GRO CXCR4 TNF-α IL-6 IL-11 sfrp-1 IL12Rb FGF11 GFRA2 CD4 SOST -3 3 Protein levels (log2) CTR NGPS -1 1 Protein levels (log2) NDF GRO Fibronectin TIMP-2 MIP-3a GCSF IL-1a IGFBP-6 FGFb IFN-γ MMP-14 IGFBP-7 Angiogenin TNF-β IL- Cathepsin B IGFBP-2 IL-13 SCF IL-6 TNFRII NGFR MIF CXCL11 MCP-2 PAI-1 IL-8 GM-CSF upar TNF-alpha TIMP-1 Soria-Valles et al. Supplementary Fig. 7 Supplementary Figure 7 NGPS senescence-associated secretory phenotype. (a) Heat map represents unsupervised hierarchical clustering of top-altered secreted protein levels in NGPS and control fibroblasts and MSCs (n=2). Data are displayed as Log2-transformed expression signals. (b) Heat map represents alterations in proteins annotated as members of the senescence-associated secretory phenotype. Data are displayed as Log2-transformed expression signals. 7 Macmillan Publishers Limited. All rights reserved
8 a Oct-1 -ATMi +ATMi b P-ATM plko.1 shbanf M r (K) plko.1 shbanf1 -ATMi +ATMi Oct-1 c Oct-1 pbabe BANF1 f d Oct-1 NGPS NGPS edited Fibs. CTR vs ipscs CTR P-ATM pbabe BANF1 M r (K) e Zmpste24 +/+ -/- -/- RelA +/+ +/+ +/- RelA g h i Zmpste24 -/- -/- +/+ j DOT1Li Mean mucosa thickness (μm) 1 Zmpste24 +/+ -/- -/- DOT1Li Zmpste24 +/+ -/- -/- DOT1Li Average villus length (μm) 4 Zmpste24 -/- -/- +/+ DOT1Li Zmpste24 +/+ -/- -/- DOT1Li k MSC CFUs 3 -DOT1Li M r (K) DOT1Li Supplementary Figure 8 Upstream regulation and effectors of reprogramming barrier. (a) ATM blockade prevented activation in NGPS fibroblasts. EMSA in NGPS fibroblasts in the presence or absence of ATM inhibitor. Oct-1 probe was used as an endogenous control. (b) Phospho-ATM western-blot analysis in control fibroblasts transduced either with BANF1 shrna or the empty vector. Right panel, EMSA in control fibroblasts transduced with shbanf1 in the presence or absence of ATMi. (c)(d) The expression of wild-type BANF1 prevented ATM and activation in NGPS cells. (e) Western-blot analysis of RelA in murine fibroblasts from the indicated genotypes. was used as a loading control. Mean relative mrna levels are represented. (f) Enrichment score plot shown was obtained from GSEA analysis of control fibroblasts and ipsc transcriptional profiles (P<.5). (g) Mice were treated with two different DOT1L inhibitors (epz-4777 and epz-5676) and, as both inhibitors achieved a similar biological effect, experimental data were pooled. Ki-67 immunohistochemistry of skin from 3-month-old wild-type, untreated and DOT1Li-treated Zmpste24-deficient mice. Bar, 3 μm. (h) Representative photographs of spleen and thymus from 3-month-old wild-type, untreated and DOT1Li-treated Zmpste24-deficient mice. (i)(j) Prevention of inflammation-associated alterations in intestinal mucosa. Representative hematoxylin-eosin (H&E) staining micrographs are shown from wild-type, untreated and DOT1Li-treated Zmpste24-deficient mice. Mean mucosa thickness (P =.6) and villus (P =.5) length were quantified and represented. Bar, 1 μm. n = 4 independent animals for each condition. (k) Colony forming assay in BM-MSCs from untreated and DOT1Li-treated Zmpste24 -/- mice. P =.5. n = 3-untreated and 4-DOT1Li treated (epz- 4777, 2 mice and epz-5676, 2 mice) Zmpste24-deficient mice. Error bars indicate SEM. P<.1, two-tailed Student s t test). Representative images are shown in western-blot analyses from 3 independent experiments. Unprocessed original scans of blots are shown in Supplementary Fig Macmillan Publishers Limited. All rights reserved
9 Fig. 2a p16 KDa Lmnb1 75KDa 5KDa 5KDa Fig. 3c Fig. 4i P-IKK2 1KDa 75KDa 5KDa KDa KDa H3K79me2 Fig. 5f Fig. 6b 25 KDa P-ATM P-IKK2 1KDa 75KDa P-ATM 25 KDa IKBA 5KDa Fig. 6b Fig. 7a 5KDa P-IKK2 1KDa 75KDa 25 KDa P-ATM Supplementary Figure 9 Unprocessed images of western-blot, EMSA and PCR analyses. 9 Macmillan Publishers Limited. All rights reserved
10 Fig. 7a Fig. 8b IKBA 5KDa KDa KDa H3K79me2 5KDa Supplementary Fig. 1e 5KDa BAF KDa 1KDa 5KDa BAF KDa 1KDa Supplementary Figure 9 continued 1 Macmillan Publishers Limited. All rights reserved
11 Supplementary Fig. 6a P-P53 5KDa P53 5KDa P21 25KDa KDa P16 KDa Supplementary Fig. 6c Supplementary Fig. 8b,d KDa P16 5KDa 25 KDa P-ATM Supplementary Fig. 8e RelA 25KDa KDa 5KDa Supplementary Figure 9 continued 11 Macmillan Publishers Limited. All rights reserved
12 Figs. 3c, 6b, 7a Fig. 7a Supplementary Figs. 6e, 8 Supplementary Fig. 8c,d Oct-1 Oct-1 Fig. 4g BS1 YY1 BS2 BS2 IκBα YY1 BS1 Supplementary Figure 9 continued 12 Macmillan Publishers Limited. All rights reserved
13 Supplementary Fig. 2b OCT4 NANOG GDF3 htert b -actin SOX2 Supplementary Fig. 1e Supplementary Fig. 4c OCT4 SOX2 NANOG GDF3 htert Supplementary Figure 9 continued 13 Macmillan Publishers Limited. All rights reserved
14 Supplementary Table Legends Supplementary Table 1 DNA methylation values and annotation of differentially methylated CpGs in fibroblasts from cases N-I and N-II as compared to the control sample. Supplementary Table 2 Top-altered proteins in supernatants from NGPS and control fibroblasts and MSCs Macmillan Publishers Limited. All rights reserved
Nature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Schematic and results of screening the combinatorial antibody library for Sox2 replacement activity. A single batch of MEFs were plated and transduced with doxycycline inducible
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2239 Hepatocytes (Endoderm) Foreskin fibroblasts (Mesoderm) Melanocytes (Ectoderm) +Dox rtta TetO CMV O,S,M,K & N H1 hes H7 hes H9 hes H1 hes-derived EBs H7 hes-derived EBs H9 hes-derived
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation
Supplementary Figure 1.
Supplementary Figure 1. Quantification of western blot analysis of fibroblasts (related to Figure 1) (A-F) Quantification of western blot analysis for control and IR-Mut fibroblasts. Data are expressed
At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in
Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm
Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate
Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated
Electromagnetic Fields Mediate Efficient Cell Reprogramming Into a Pluripotent State
Electromagnetic Fields Mediate Efficient Cell Reprogramming Into a Pluripotent State Soonbong Baek, 1 Xiaoyuan Quan, 1 Soochan Kim, 2 Christopher Lengner, 3 Jung- Keug Park, 4 and Jongpil Kim 1* 1 Lab
Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency.
Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency. (a) Transfection of different concentration of GAS5-overexpressing
monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal antibody was examined in
Supplementary information Supplementary figures Supplementary Figure 1 Determination of the s pecificity of in-house anti-rhbdd1 mouse monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal
Supplementary Data. Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells
Supplementary Data Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells Mouse induced pluripotent stem cells (ipscs) were cultured
Disease Clinical features Genotype
Disease Clinical features Genotype Alpha 1 Antitrypsin deficiency (A1ATD) Patient 1 65 year old caucasian male, liver transplant recipient, explant biopsy confirmed A1ATD induced liver cirrhosis Patient
Supplementary Figure 1. Characterization of hipscs derived from primary human fibroblasts. a,b. Morphology of hipscs. hipscs exhibit hesc-like
Supplementary Figure 1. Characterization of hipscs derived from primary human fibroblasts. a,b. Morphology of hipscs. hipscs exhibit hesc-like morphology in co-culture with mouse embryonic feeder fibroblasts
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/4/9/eaat5401/dc1 Supplementary Materials for GLK-IKKβ signaling induces dimerization and translocation of the AhR-RORγt complex in IL-17A induction and autoimmune
T-iPSC. Gra-iPSC. B-iPSC. TTF-iPSC. Supplementary Figure 1. Nature Biotechnology: doi: /nbt.1667
a T-iPSC Gra-iPSC B-iPSC TTF-iPSC Ectoderm Endoderm Mesoderm b Nature Biotechnology: doi:.38/nbt.667 Supplementary Figure Klf4 transgene expression Oct4 transgene expression.7 Fold GAPDH.6.5.4.3 Fold GAPDH
Nature Biotechnology: doi: /nbt.4166
Supplementary Figure 1 Validation of correct targeting at targeted locus. (a) by immunofluorescence staining of 2C-HR-CRISPR microinjected embryos cultured to the blastocyst stage. Embryos were stained
SUPPLEMENTARY INFORMATION
SUPPLEMENTRY INFORMTION DOI:.38/ncb Kdmb locus kb Long isoform Short isoform Long isoform Jmj XX PHD F-box LRR Short isoform XX PHD F-box LRR Target Vector 3xFlag Left H Neo Right H TK LoxP LoxP Kdmb Locus
Flow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences).
Mice C57BL/6-Ly5.1 or -Ly5.2 congenic mice were used for LSK transduction and competitive repopulation assays. Animal care was in accordance with the guidelines of Keio University for animal and recombinant
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3562 In the format provided by the authors and unedited. Supplementary Figure 1 Glucose deficiency induced FH-ATF2 interaction. In b-m, immunoblotting or immunoprecipitation analyses were
SUPPLEMENTARY INFORMATION
doi:.38/nature08267 Figure S: Karyotype analysis of ips cell line One hundred individual chromosomal spreads were counted for each of the ips samples. Shown here is an spread at passage 5, predominantly
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3164 Supplementary Figure 1 Validation of effective Gnas deletion and epithelial thickness. a, Representative genotyping in mice treated or not with tamoxifen to show Gnas deletion. To
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION DOI: 1.138/NMAT3777 Biophysical regulation of epigenetic state and cell reprogramming Authors: Timothy L. Downing 1,2, Jennifer Soto 1,2, Constant Morez 2,3,, Timothee Houssin
SUPPLEMENTARY INFORMATION
Supplementary Figure a 3 factors 4 factors Nanog-GFP phase b c.5 Endogenous Oct3/4 2 Total Oct3/4.5 Relative expression (ES = ).5.5 6 3 Endogenous Sox2 Nanog Relative expression (ES = ) 5 25 2 Total Sox2
Figure S1. Generation of HspA4 -/- mice. (A) Structures of the wild-type (Wt) HspA4 -/- allele, targeting vector and targeted allele are shown together with the relevant restriction sites. The filled rectangles
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3206 Supplementary Figure 1 Autophagy-related gene expression in murine and human intestinal tumors. (a) Representative LC3 immunostaining in colonic adenoma and adjacent non tumoral tissue
Supplementary Figure 1
Supplementary Figure 1 Supplementary Fig. 1 shrna mediated knockdown of ZRSR2 in K562 and 293T cells. (a) ZRSR2 transcript levels in stably transduced K562 cells were determined using qrt-pcr. GAPDH was
Isolation of human ips cells using EOS lentiviral vectors to select for pluripotency
nature methods Isolation of human ips cells using EOS lentiviral vectors to select for pluripotency Akitsu Hotta, Aaron Y L Cheung, Natalie Farra, Kausalia Vijayaragavan, Cheryle A Séguin, Jonathan S Draper,
Supplementary Methods
Supplementary Methods Microarray Data Analysis Gene expression data were obtained by hybridising a total of 24 samples from 6 experimental groups (n=4 per group) to Illumina HumanHT-12 Expression BeadChips.
SUPPLEMENTARY INFORMATION
doi: 1.138/nature875 a promoter firefly luciferase CNS b Supplementary Figure 1. Dual luciferase assays on enhancer activity of CNS1, 2, and 3. a. promoter sequence was inserted upstream of firefly luciferase
Nature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Generation of the AARE-Gene system construct. (a) Position and sequence alignment of AAREs extracted from human Trb3, Chop or Atf3 promoters. AARE core sequences are boxed in grey.
Nature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting.
Supplementary Figure 1 Zranb1 gene targeting. (a) Schematic picture of Zranb1 gene targeting using an FRT-LoxP vector, showing the first 6 exons of Zranb1 gene (exons 7-9 are not shown). Targeted mice
Nanog-Luc. R-Luc. 40 HA-Klf Relative protein level of Klf USP21. Vector USP2 USP21 *** *** *** ***
:Flag Relative protein level of Relative protein level of : Flag Vec 21LV 21SV 2 : HA HA- HA- HA- HA-Klf4 Relative mrna expression Relative protein level of Relative protein level of Relative protein level
Supplementary Table, Figures and Videos
Supplementary Table, Figures and Videos Table S1. Oligonucleotides used for different approaches. (A) RT-qPCR study. (B) qpcr study after ChIP assay. (C) Probes used for EMSA. Figure S1. Notch activation
Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured
Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured in 90-Pa 3D fibrin gels for 5 days in the presence
Supplementary Figure Legends. Figure-S1 Molecular basis of ASS1 deficiency in myxofibrosarcoma: (A)
Supplementary Figure Legends Figure-S1 Molecular basis of ASS1 deficiency in myxofibrosarcoma: (A) High-resolution oligonucleotide-based array comparative genomic hybridization shows normal DNA copy number
SUPPLEMENTARY INFORMATION
Supplementary Figure S1 Colony-forming efficiencies using transposition of inducible mouse factors. (a) Morphologically distinct growth foci appeared from rtta-mefs 6-8 days following PB-TET-mFx cocktail
Supplementary Data. Flvcr1a TCTAAGGCCCAGTAGGACCC GGCCTCAACTGCCTGGGAGC AGAGGGCAACCTCGGTGTCC
Supplementary Data Supplementary Materials and Methods Measurement of reactive oxygen species accumulation in fresh intestinal rings Accumulation of reactive oxygen species in fresh intestinal rings was
Supplementary Fig. 1. A, Upper panel shows schematic molecular representation of mutation- and SNP-replacement with FANCA-c-HDAdV in FANCA-corrected
Supplementary Fig. 1. A, Upper panel shows schematic molecular representation of mutation- and SNP-replacement with FANCA-c-HDAdV in FANCA-corrected FA-iPSC line (C-FA-iPSCs). Lower panels show the sequencing
Supplementary Figure 1. Characterization of the POP2 transcriptional and post-transcriptional regulatory elements. (A) POP2 nucleotide sequence
1 5 6 7 8 9 10 11 1 1 1 Supplementary Figure 1. Characterization of the POP transcriptional and post-transcriptional regulatory elements. (A) POP nucleotide sequence depicting the consensus sequence for
Supplementary Figure 1
Supplementary Figure 1 Virus infection induces RNF128 expression. (a,b) RT-PCR analysis of Rnf128 (RNF128) mrna expression in mouse peritoneal macrophages (a) and THP-1 cells (b) upon stimulation with
The RRPA knock-in allele was generated by homologous recombination in TC1 ES cells.
Supplemental Materials Materials & Methods Generation of RRPA and RAPA Knock-in Mice The RRPA knock-in allele was generated by homologous recombination in TC1 ES cells. Targeted ES clones in which the
Supplementary Figure 1. Gating strategy for flow cytometry analysis of mouse aorta. Cell suspensions from mouse aorta digested with enzyme cocktail
Supplementary Figure 1. Gating strategy for flow cytometry analysis of mouse aorta. Cell suspensions from mouse aorta digested with enzyme cocktail were stained with propidium iodide (PI), anti-cd45 (FITC),
supplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
Supplementary Figure 1. Generation of B2M -/- ESCs. Nature Biotechnology: doi: /nbt.3860
Supplementary Figure 1 Generation of B2M -/- ESCs. (a) Maps of the B2M alleles in cells with the indicated B2M genotypes. Probes and restriction enzymes used in Southern blots are indicated (H, Hind III;
Protocol Using the Reprogramming Ecotropic Retrovirus Set: Mouse OSKM to Reprogram MEFs into ips Cells
STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of mouse embryonic fibroblast (MEF) cells into induced pluripotent stem (ips) cells in a 6-well format. Transduction
Supplementary Figure 1. Reintroduction of HDAC1 in HDAC1-/- ES cells reverts the
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Reintroduction of HDAC1 in HDAC1-/- ES cells reverts the phenotype of HDAC1-/- teratomas. 3x10 6 HDAC1 reintroduced (HDAC1-/-re) and empty vector infected
Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).
1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well
Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4
SUPPLEMENTARY FIGURE LEGENDS Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4 directly up-regulates the expression of NIPP1 and CCNF that together inhibit protein phosphatase
CFTR-null wt CFTR-null 1.0. Probe: Neo R. Figure S1
A. B. 4.0 3.0 2.0 1.0 4.0 3.0 2.0 1.0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 Probe: Neo R CFTR-null wt CFTR-null Figure S1 A. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 10kb 8kb CFTR-null wt B. Probe: CFTR
Supplementary Figure 1.
Supplementary Figure 1. (A) UCSC Genome Browser view of region immediately downstream of the NEUROG3 start codon. All candidate grna target sites which meet the G(N 19 )NGG constraint are aligned to illustrate
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. Functional assays of hepatocyte-like cells induced from H1 hescs (a) P450 and AAT staining, PAS staining, LDL uptake assay, and ICG uptake and release assay
The p53-puma axis suppresses ipsc generation
The p53-puma axis suppresses ipsc generation Yanxin Li, Haizhong Feng, Haihui Gu, Dale W. Lewis, Youzhong Yuan, Lei Zhang, Hui Yu, Peng Zhang, Haizi Cheng, Weimin Miao, Weiping Yuan, Shi-Yuan Cheng, Susanne
Supplementary Figure 1. Phenotype and genotype of cultured and transplanted S1 KCST (A) Brightfield and mcherry fluorescence images of the spheres
Supplementary Figure 1. Phenotype and genotype of cultured and transplanted S1 KCST (A) Brightfield and mcherry fluorescence images of the spheres generated from the CD133-positive cells infected with
Human induced Pluripotent Stem Cell (ipsc) Line: GM23225*B
Certificate of Analysis NIGMS Human tic Cell Repository Human induced Pluripotent Stem Cell (ipsc) Line: GM23225*B Diagnosis Mutation Reprogramming method Publication(s) describing ipsc line establishment
Supplementary Figure 1
Supplementary Figure 1 Ex2 promotor region Cre IRES cherry pa Ex4 Ex5 Ex1 untranslated Ex3 Ex5 untranslated EYFP pa Rosa26 STOP loxp loxp Cre recombinase EYFP pa Rosa26 loxp 1 kb Interleukin-9 fate reporter
Supplementary Figure S1. The tetracycline-inducible CRISPR system. A) Hela cells stably
Supplementary Information Supplementary Figure S1. The tetracycline-inducible CRISPR system. A) Hela cells stably expressing shrna sequences against TRF2 were examined by western blotting. shcon, shrna
SUPPLEMENTARY FIG. S9. Morphology and DNA staining of cipsc-differentiated trophoblast cell-like cell. Scale bar: 100 mm. SUPPLEMENTARY FIG. S10.
Supplementary Data SUPPLEMENTARY FIG. S1. Lentivirus-infected canine fibroblasts show YFP expression. (A, B) Uninfected canine skin fibroblasts (CSFs); (C, D) infected CSFs; (E, F) uninfected CTFs; (G,
Isolation, culture, and transfection of primary mammary epithelial organoids
Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)
SUPPLEMENTAL MATERIAL
SUPPLEMENTAL MATERIAL MATERIALS AND METHODS Generation of TSPOΔ/Δ murine embryonic fibroblasts Embryos were harvested from 13.5-day pregnant TSPOfl/fl mice. After dissection to eviscerate and remove the
Supplementary Table S1
Primers used in RT-qPCR, ChIP and Bisulphite-Sequencing. Quantitative real-time RT-PCR primers Supplementary Table S1 gene Forward primer sequence Reverse primer sequence Product TRAIL CAACTCCGTCAGCTCGTTAGAAAG
administration of tamoxifen. Bars show mean ± s.e.m (n=10-11). P-value was determined by
Supplementary Figure 1. Chimerism of CD45.2 + GFP + cells at 1 month post transplantation No significant changes were detected in chimerism of CD45.2 + GFP + cells between recipient mice repopulated with
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11070 Supplementary Figure 1 Purification of FLAG-tagged proteins. a, Purification of FLAG-RNF12 by FLAG-affinity from nuclear extracts of wild-type (WT) and two FLAG- RNF12 transgenic
supplementary information
Figure S1 ZEB1 full length mrna. (a) Analysis of the ZEB1 mrna using the UCSC genome browser (http://genome.ucsc.edu) revealed truncation of the annotated Refseq sequence (NM_030751). The probable terminus
Supplementary Figures and Figure legends
Supplementary Figures and Figure legends 3 Supplementary Figure 1. Conditional targeting construct for the murine Satb1 locus with a modified FLEX switch. Schematic of the wild type Satb1 locus; the conditional
Supplementary Figure 1 Characterization of OKSM-iNSCs
Supplementary Figure 1 Characterization of OKSM-iNSCs (A) Gene expression levels of Sox1 and Sox2 in the indicated cell types by microarray gene expression analysis. (B) Dendrogram cluster analysis of
Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
Supplementary Information
Supplementary Information MicroRNA-212/132 family is required for epithelial stromal interactions necessary for mouse mammary gland development Ahmet Ucar, Vida Vafaizadeh, Hubertus Jarry, Jan Fiedler,
Regulation of transcription by the MLL2 complex and MLL complex-associated AKAP95
Supplementary Information Regulation of transcription by the complex and MLL complex-associated Hao Jiang, Xiangdong Lu, Miho Shimada, Yali Dou, Zhanyun Tang, and Robert G. Roeder Input HeLa NE IP lot:
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Endogenous gene tagging to study subcellular localization and chromatin binding. a, b, Schematic of experimental set-up to endogenously tag RNAi factors using the CRISPR Cas9 technology,
hesc Otx2 B-T Sox17 Actin M r (K)
DOI:.38/ncb357 In the format provided by the authors and unedited. a Nanog OCT b hesc hipsc hipsc SSEA TRA -6 c hesc hipsc Nanog OCT Otx hesc SSEA TRA -6 B-T d f Sox7 M r (K) M r (K) Actin Actin e OCR
TRANSGENIC ANIMALS. transient. stable. - Two methods to produce transgenic animals:
Only for teaching purposes - not for reproduction or sale CELL TRANSFECTION transient stable TRANSGENIC ANIMALS - Two methods to produce transgenic animals: 1- DNA microinjection 2- embryonic stem cell-mediated
John Gurdon was testing the hypothesis of genomic equivalence or that when cells divide they retain a full genomic compliment.
1. (15 pts) John Gurdon won the 2012 Nobel Prize in Physiology or Medicine for work he did in the 1960 s. What was the major developmental hypothesis he set out to test? What techniques did he development
Supplementary Fig S1: Bone marrow macrophages and liver Kupffer cells increase IL-1 in response to adenosine signaling. (a) Murine bone marrow
Supplementary Fig S1: Bone marrow macrophages and liver Kupffer cells increase IL-1 in response to adenosine signaling. (a) Murine bone marrow derived macrophages (BMDM) were primed with LPS for 16 hrs,
SUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3342 EV O/E 13 4 B Relative expression 1..8.6.4.2 shctl Pcdh2_1 C Pcdh2_2 Number of shrns 12 8 4 293T mterc +/+ G3 mterc -/- D % of GFP + cells 1 8 6 4 2 Per2 p=.2 p>
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2774 Figure S1 TRF2 dosage modulates the tumorigenicity of mouse and human tumor cells. (a) Left: immunoblotting with antibodies directed against the Myc tag of the transduced TRF2 forms
Supplemental Data. Hu et al. Plant Cell (2017) /tpc
1 2 3 4 Supplemental Figure 1. DNA gel blot analysis of homozygous transgenic plants. (Supports Figure 1.) 5 6 7 8 Rice genomic DNA was digested with the restriction enzymes EcoRⅠ and BamHⅠ. Lanes in the
WT Day 90 after injections
Supplementary Figure 1 a Day 1 after injections Day 9 after injections Klf5 +/- Day 1 after injections Klf5 +/- Day 9 after injections BLM PBS b Day 1 after injections Dermal thickness (μm) 3 1 Day 9 after
Isolation of single-base genome-edited human ips cells without
Nature Methods Isolation of single-base genome-edited human ips cells without antibiotic selection Yuichiro Miyaoka, Amanda H. Chan, Luke M. Judge, Jennie Yoo, Miller Huang, Trieu D. Nguyen, Paweena P.
Nature Genetics: doi: /ng.2949
Supplementary Figure 1. Abnormal differentiation in vivo and colony growth in vitro of B cells with triplication of chr.21 orthologs. (a) (Top) B220 and CD43 staining of bone marrow from Ts1Rhr and wild-type
Schematic representation of the endogenous PALB2 locus and gene-disruption constructs
Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying
Supplementary Data. Supplementary Table S1.
Supplementary Data Supplementary Table S1. Primer Sequences for Real-Time Reverse Transcription-Polymerase Chain Reaction Gene Forward 5?3 Reverse 3?5 Housekeeping gene 36B4 TCCAGGCTTTGGGCATCA CTTTATCAGCTGCACATCACTCAGA
Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and
Supplementary Figure Legend: Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and ATRIP protein peptides identified from our mass spectrum analysis were shown. Supplementary
Anti-ERK1/2, anti-p-erk1/2, anti-p38 anti-p-msk1 (Thr581) and anti-p-msk2
Supplementary methods Antibodies Anti-ERK1/2, anti-p-erk1/2, anti-p38 anti-p-msk1 (Thr581) and anti-p-msk2 polyclonal were from Cell Signalling and the anti-p-histone H3(Ser1) antibody was from Upstate.
b alternative classical none
Supplementary Figure. 1: Related to Figure.1 a d e b alternative classical none NIK P-IkBa Total IkBa Tubulin P52 (Lighter) P52 (Darker) RelB (Lighter) RelB (Darker) HDAC1 Control-Sh RelB-Sh NF-kB2-Sh
gacgacgaggagaccaccgctttg aggcacattgaaggtctcaaacatg
Supplementary information Supplementary table 1: primers for cloning and sequencing cloning for E- Ras ggg aat tcc ctt gag ctg ctg ggg aat ggc ttt gcc ggt cta gag tat aaa gga agc ttt gaa tcc Tpbp Oct3/4
CRISPR RNA-guided activation of endogenous human genes
CRISPR RNA-guided activation of endogenous human genes Morgan L Maeder, Samantha J Linder, Vincent M Cascio, Yanfang Fu, Quan H Ho, J Keith Joung Supplementary Figure 1 Comparison of VEGF activation induced
SUPPLEMENTARY INFORMATION
(Supplementary Methods and Materials) GST pull-down assay GST-fusion proteins Fe65 365-533, and Fe65 538-700 were expressed in BL21 bacterial cells and purified with glutathione-agarose beads (Sigma).
A Novel Platform to Enable the High-Throughput Derivation and Characterization of Feeder-Free Human ipscs
Supplementary Information A Novel Platform to Enable the High-Throughput Derivation and Characterization of Feeder-Free Human ipscs Bahram Valamehr, Ramzey Abujarour, Megan Robinson, Thuy Le, David Robbins,
(a) Immunoblotting to show the migration position of Flag-tagged MAVS
Supplementary Figure 1 Characterization of six MAVS isoforms. (a) Immunoblotting to show the migration position of Flag-tagged MAVS isoforms. HEK293T Mavs -/- cells were transfected with constructs expressing
Supplemental Materials. Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans
Supplemental Materials Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans Madhusudhan Budatha, Shayzreen Roshanravan, Qian Zheng, Cecilia Weislander, Shelby L. Chapman,
We designed the targeting vector in such a way that the first exon was flanked by two LoxP sites and
Mice We designed the targeting vector in such a way that the first exon was flanked by two LoxP sites and an Frt flanked neo cassette (Fig. S1A). Targeted BA1 (C57BL/6 129/SvEv) hybrid embryonic stem cells
Chemically defined conditions for human ipsc derivation and culture
Nature Methods Chemically defined conditions for human ipsc derivation and culture Guokai Chen, Daniel R Gulbranson, Zhonggang Hou, Jennifer M Bolin, Victor Ruotti, Mitchell D Probasco, Kimberly Smuga-Otto,
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/3/146/ra80/dc1 Supplementary Materials for DNMT1 Stability Is Regulated by Proteins Coordinating Deubiquitination and Acetylation-Driven Ubiquitination Zhanwen
Sarker et al. Supplementary Material. Subcellular Fractionation
Supplementary Material Subcellular Fractionation Transfected 293T cells were harvested with phosphate buffered saline (PBS) and centrifuged at 2000 rpm (500g) for 3 min. The pellet was washed, re-centrifuged
Supplementary Methods
Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed
Regulation of axonal and dendritic growth by the extracellular calcium-sensing
Regulation of axonal and dendritic growth by the extracellular calcium-sensing receptor (CaSR). Thomas N. Vizard, Gerard W. O Keeffe, Humberto Gutierrez, Claudine H. Kos, Daniela Riccardi, Alun M. Davies
Allele-specific locus binding and genome editing by CRISPR at the
Supplementary Information Allele-specific locus binding and genome editing by CRISPR at the p6ink4a locus Toshitsugu Fujita, Miyuki Yuno, and Hodaka Fujii Supplementary Figure Legends Supplementary Figure
Table S1. Primers used in RT-PCR studies (all in 5 to 3 direction)
Table S1. Primers used in RT-PCR studies (all in 5 to 3 direction) Epo Fw CTGTATCATGGACCACCTCGG Epo Rw TGAAGCACAGAAGCTCTTCGG Jak2 Fw ATCTGACCTTTCCATCTGGGG Jak2 Rw TGGTTGGGTGGATACCAGATC Stat5A Fw TTACTGAAGATCAAGCTGGGG
DOI: 10.1038/ncb3259 A Ismail et al. Supplementary Figure 1 B 60000 45000 SSC 30000 15000 Live cells 0 0 15000 30000 45000 60000 FSC- PARR 60000 45000 PARR Width 30000 FSC- 15000 Single cells 0 0 15000
Supplementary information.
Supplementary information. Construction of JMJD3 plasmids and other vectors plasmid, pfksd346, encoding the ORF of human JMJD3 (KI346) was obtained from the Kazusa DN Research Institute, Japan. Sequence
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11272 Supplementary Figure 1. Experimental platform for epigenetic reversion of murine EpiSCs back to naïve ground state pluripotency. a, NGFP1 naïve-ipscs (40XY) expanded in 2i/LIF defined