SUPPLEMENTARY INFORMATION

Size: px
Start display at page:

Download "SUPPLEMENTARY INFORMATION"

Transcription

1 DOI: /ncb2774 Figure S1 TRF2 dosage modulates the tumorigenicity of mouse and human tumor cells. (a) Left: immunoblotting with antibodies directed against the Myc tag of the transduced TRF2 forms after the lentiviral infection of BJ-HELT cells. Right: immunoblotting of endogenous TRF2 in cells infected with a lentivirus expressing scramble shrna (shctrl) and an shrna directed against TERF2 (shterf2). Results of one representative experiment are shown. (b) Modulation of TRF2 expression in B16F10 cells. After the lentiviral transduction of B16F10 with lentivirus expressing TRF2 WT, the level of expression of the GFP tag was analyzed by flow cytometry and (c) the level of expression of mterf2 after transduction of B16F10 cells with mtrf2-expressing or mterf2 shrna-expressing lentivirus was determined by RT-qPCR and expressed relative to GAPDH. Results of one representative experiment are shown. (d) Nude mice were injected intravenously with infected BJ-EHLT Ras mc at 1x10 5 cells/mouse. The mean (SE) number of lung nodules on day 50 is indicated. Arrows indicate metastatic nodules. Data from one experiment with n=6 mice per condition are shown and source data are presented in Table S5 (Statistics Source Data). p-values were determined using the Mann-Whitney test. (e) Derivatives of the A375 melanoma cell line injection into nude mice for tumor take. Tumor take was assessed based on palpability; the results are expressed as the percentage of tumor-free mice at the indicated time points after cell injection. n=7 mice per condition, results of one representative experiment are shown and data for two independent experiments are presented in Table S5 (Statistics Source Data). (f) The tumor volume (mean +/- s.d.) was determined and representative images of the tumors are presented in (g). Scale bar represent 1 cm; p-values were determined using the Mann-Whitney test (*p < 0.05; **p < 0.005; ***p < 0.001). 1

2 Figure S2 Partial TRF2 inhibition in BJ-HELTRas cells does not trigger NF-κB, DNA damage and stress response. (a) Anchorage independent growth assay performed 2 weeks pos-infection. Five thousand cells were seeded and the colonies counted three weeks subsequently. Data represent the mean +/- s.d. of n=3 independent experiments and source data are provided in Table S5 (Statistics Source Data). *p<0.05 p-values were determined using the Mann-Whitney test. (b) An increasing number of cells from each sample were plated and colonies were numerated after 10 days. Data represent the mean +/- s.d. of n=3 independent experiments. (c) Growth properties of the indicated cell lines, shown as plots of cumulative population doubling versus the number of days postinfection. Data represent the mean of n=3 independent experiments and source data are provided in Table S5 (Statistics Source Data). (d) NF-κB gel shift analyses using nuclear extracts of the indicated cells. The probe used was a consensus sequence for the transcription factor NF-κB. A nuclear extract of Jurkat cells was used as a positive control. These experiments were performed using a Gelshift NFκB/Rel Family Kit (#37319; Active Motif, Carlsbad, CA). (e) Histology of BJ-HELTRas cells transduced with the indicated lentiviral vector analyzed 7 days after their subcutaneous injection. Biopsies from at least four different mice were analyzed, and at least four sections from each tumor were evaluated. The boxes in the SA-β-galactosidase images represent positive staining in hair follicle and sebaceous gland. See Supplementary Table 2 for quantification. The white bar represent 10 µm. (f) Staining of mouse skin before and after γ-ray irradiation showing the activation of CHK2 and ATM. Immunoblotting of proteins from two TRF2 dn BJ-HELTRas tumors formed in nude mice with anti-chk1 and -phospho-chk1 antibodies showing an absence of detectable DDR activation in contrast to cultured BJ-HELTRas cells treated with the DNA damaging agent campthotecin. The white bar represents 10 µm. All the information about antibodies is reported in Table S4. 2

3 Figure S3 Partial TRF2 inhibition in various tumor cell lines does not uncap telomeres. (a) Chromatin immunoprecipitation experiments performed with BJ-HELT and RasV12 derivatives cell lines five days after infection with the indicated lentiviral vector using γ-h2ax and Myc antibodies and analyzed by slot-blotting hybridized with an Telo or an Alu probe. It is worth noting that we observed a significant binding of the TRF2 dn protein at telomeres, although less pronounced than the one of an equivalent amount of overexpressed myc-trf2. This was unanticipated since TRF2 dn does not contain a DNA binding domain and is believed to work by displacing the endogenous TRF2 molecules. The telomeric binding of TRF2 dn might be explained by an interaction with other shelterin components, data fromone experiment performed in triplicate, all values are plotted on the graph. (b,c) Multiplex fluorescence in situ hybridization analyses (M-FISH) establish that the lines transduced with pwpir-trf2 dn does not show an increased number of chromosome rearrangement, both clonal, i.e. shared by at least two cells, or non-clonal. M-FISH was performed using multi-fish probes (MetaSystems, GmbH) according to the manufacturers recommendations. Images of hybridized metaphases were captured with a CCD camera (Zeisss) coupled to a Zeiss Axioplan microscope and were processed with ISIS software (MetaSystems, GmbH). Data represent the mean +/- S.D. of n=30 metaphases from a single experiment are shown. (d) Telomere length measurement by a Southern procedure. Genomic DNA was digested with HinfI and RsaI and hybridized with a radiolabeled TTAGGG probe, data from 1 experiment are shown. (e) Immunoblotting analysis of shelterin components with the indicated antibodies. (f) Immunoblotting analysis of DNA damage, with the indicated antibodies after exposure to 5 Gy of ionizing radiation. All the information about antibodies is reported in Table S4. (g) Analysis of the phospho-(ser/thr) ATM/ATR substrates. (h) Quantification of the total number of 53BP1 foci per nucleus in the indicated cell lines 5 days post-infection or 5 hours after exposure to 5 Gy of ionizing radiation. Data represents mean+/-s.d. of n=30 nuclei assessed over 2 independent experiments, ***p< p-values were determined using ANOVA test. 3

4 Figure S4 IL-6 is necessary and sufficient to prevent growth inhibition upon TRF2 partial inhibition. (a,b) In the indicated situations, the clonogenic ability is determined as the number of viable colonies issued from the indicated number of plated cells. MOI = Multiplicity of Infection. vil-6 : lentiviral vector expressing full length IL-6; ve : control lentiviral vector not expressing IL-6. Data from 1 experiment performed in triplicate, all values are plotted on the graph. 4

5 Figure S5 The modulation of tumorigenicity by TRF2 dosage correlates with Natural Killer (NK) cell recruitment and activation. (a) Positive controls from the Matrigel assays. PBS alone or containing TNF-α, VEGF-α, SDF-1, and sphingosine-1-phosphate (S1P) was mixed with Matrigel prior to its injection into 5 mice. Five days later, the immune infiltration of the Matrigel plug was assessed using flow cytometry. The min to max box-and-whiskers graph represents the NK cell infiltration of n=5 mice from1 experiment. Data are also presented in Table S5 (Statistics Source Data). p-values were calculated using the Mann-Whitney test (*p < 0.05). (b) Representative FACS dot plots showing CD45 + and CD45 + CD3 + infiltration into the Matrigel plugs quantified in Fig. 5. The data are representative of n=2 independent experiments conducted with 5 mice each. (c) Biopsies from BJ-HELTRas tumor-bearing mice were analyzed by immunohistochemistry. Images showing immunofluorescence staining for NKp46 are shown. The white bar represents 20 µm. (d) Histology of BJ-HELTRas cells transduced with the indicated lentiviral vector and analyzed 7 days after their subcutaneous injection. See Supplementary Table 2 for quantification. All the information about antibodies is reported in Table S4. The white bar represents 10 µm. (e) The expression of TRF2 dn was assessed in tumors formed in NK1.1-treated mice by immunoblotting with anti-myc antibodies, which recognized Myc-tagged TRF2. (f) The percentage of tumor cells expressing TRF2 dn was assayed by tissue analysis with anti-myc antibodies. The values represent the mean percentage of Myc-positive cells from four tumors. Untreated refer to samples of TRF2 dn cells two days after their injection in mice that have not been treated with NK1.1 antibodies. The white bar represents 10 µm. (g) Mice were injected with BJ-HELTRas cells at cells/mouse on day 1. The mice were treated with anti-ifn-γ monoclonal antibodies (clone XMG 1.2) at 0.5 mg/mouse on days 0, 4, and 7. Tumor formation was assessed based on palpability; the results are expressed as the percentage of tumor-free mice at the indicated time points after cell injection following NK cell depletion. n=3 mice per condition. One of two independent experiments is shown. Data for both experiments are presented in Table S5 (Statistics Source Data). (h) Nude mice were injected with i.m. with BJ-HELTRas cells or TRF2 dn overexpressing BJ-HELTRas cells and treated or not with the ATM inhibitor KU After 5 days, microtumors were analyzed by immunohistochemistry for the phosphorylation of ATM, NKp46 infiltration and IFN-g expression. The white bar represents 10 µm. Data for n=2 independent experiments are presented in Table S5 (Statistics Source Data). Quantifications are presented in Figure 6f. 5

6 Figure S6 TRF2 dysfunction in BJ-HELTRas cells does not alter the expression of NKG2D and DNAM-1 ligands and senescence-associated secretory proteins. (a) Analysis of the expression of NKG2D and DNAM-1 ligands on transformed human fibroblasts by flow cytometry. TRF2- or TRF2 dn - BJ-HELTRas cells were incubated at 4 C for 30 min with purified antibodies: anti-mic-a, MIC- B, ULBP-1, ULBP-2, ULBP-3, CD112 and CD155. All the informations about antibodies are reported in Table S4. Representative FACS histograms of 3 independent experiments. (b) The concentration of 24 cytokines was determined in the indicated CM by Luminex Technology using the Milliplex Human Cytokine/Chemokine panel (Millipore Corp., Billerica, MA). The experiment, including sample dilution, beads, antibodies, and cytokine standard preparation, was performed according to the specifications of the manufacturer and run on a Bio-Rad Bio-Plex System (Hercules, CA). Data represent the mean +/- standard deviation of n=3 independent experiments. 6

7 Figure S7 Cells used for assaying HS3ST4 expression did not show DDR activation. Western blot analysis of the phosphorylation of ATM and CHK1 in the samples of BJ-HELTRas cells either overexpressing or down-regulating TRF2 used for the HS3ST4 experiments of Figure 7. All the information about antibodies is reported in Table S4. 7

8 Figure S8 Quantification of CD3+, CD8+ and CD20+ cells in early stages of colon carcinogenesis. Patients assessed for NKp46 and TRF2 staining (Figure 8) where also scored for CD3+ (n=30 low grade adenoma; n=30 high grade adenoma and n=15 focal intramucous adenoma) (a), CD8+ (n=30 low grade adenoma; n=30 high grade adenoma and n=15 focal intramucous adenoma) (b) and CD20+ (n=8 low grade adenoma; n=8 high grade adenoma and n=8 focal intramucous adenoma) (c) infiltration. Data represents mean +/- s.d. of cell densities per mm 2. Data are presented in Table S5 (Statistics Source Data) for the Figure

9 3a 250 kd 100 kd 250 kd 100 kd 72 kd 55 kd 72 kd 55 kd 43 kd 72 kd 55 kd 43 kd 4a 4b Figure S9 Uncropped Western blots. The white boxes refer to the part of the blot presented in the main figure. 9

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated

More information

supplementary information

supplementary information DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using

More information

Supplementary Figure 1. Isolation of GFPHigh cells.

Supplementary Figure 1. Isolation of GFPHigh cells. Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding

More information

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1: Vector maps of TRMPV and TRMPVIR variants. Many derivatives of TRMPV have been generated and tested. Unless otherwise noted, experiments in this paper use

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid

More information

SANTA CRUZ BIOTECHNOLOGY, INC.

SANTA CRUZ BIOTECHNOLOGY, INC. TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same

More information

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab. / 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG

More information

Supplementary Figures Montero et al._supplementary Figure 1

Supplementary Figures Montero et al._supplementary Figure 1 Montero et al_suppl. Info 1 Supplementary Figures Montero et al._supplementary Figure 1 Montero et al_suppl. Info 2 Supplementary Figure 1. Transcripts arising from the structurally conserved subtelomeres

More information

Nature Immunology: doi: /ni Supplementary Figure 1

Nature Immunology: doi: /ni Supplementary Figure 1 Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact

More information

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

More information

Strategies for Assessment of Immunotoxicology in Preclinical Drug Development

Strategies for Assessment of Immunotoxicology in Preclinical Drug Development Strategies for Assessment of Immunotoxicology in Preclinical Drug Development Rebecca Brunette, PhD Scientist, Analytical Biology SNBL USA Preclinical Immunotoxicology The study of evaluating adverse effects

More information

Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 CSRP2 PFKP ADFP ADM C10orf10 GPI LOX PLEKHA2 WIPF1

Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 CSRP2 PFKP ADFP ADM C10orf10 GPI LOX PLEKHA2 WIPF1 Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 4.52E-18 PDK1 6.77E-18 CSRP2 4.42E-17 PFKP 1.23E-14 MSH2 3.79E-13 NARF_A 5.56E-13 ADFP 5.56E-13 FAM13A1 1.56E-12 FAM29A_A 1.22E-11 CA9 1.54E-11

More information

Cell culture. HeLa cells were cultured as monolayers in Dulbecco s Minimal Essential

Cell culture. HeLa cells were cultured as monolayers in Dulbecco s Minimal Essential Supporting Online Material Materials and methods Cell culture. HeLa cells were cultured as monolayers in Dulbecco s Minimal Essential Medium (Gibco BRL, Invitrogen Corporation, Carlsbad, CA, USA), supplemented

More information

Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation

Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation 1 2 3 4 5 SUPPLEMENTAL DATA Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation Magalí Nazar, Juan Pablo Nicola, María Laura

More information

Isolation, culture, and transfection of primary mammary epithelial organoids

Isolation, culture, and transfection of primary mammary epithelial organoids Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)

More information

TransAM Kits are DNA-binding ELISAs that facilitate the study of transcription factor activation in mammalian tissue and cell culture extracts.

TransAM Kits are DNA-binding ELISAs that facilitate the study of transcription factor activation in mammalian tissue and cell culture extracts. Transcription Factor ELISAs TransAM sensitive quantitative transcription factor ELISAs TransAM Kits are DNA-binding ELISAs that facilitate the study of transcription factor activation in mammalian tissue

More information

Description: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto

Description: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tables Title of file for HTML: Supplementary Movie 1 Description: Nuclear morphology and dynamics

More information

RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit

RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit Catalog #: TFEH-p65 User Manual Mar 13, 2017 3607 Parkway Lane, Suite 200 Norcross, GA 30092 Tel: 1-888-494-8555 (Toll Free) or 770-729-2992,

More information

7.06 Cell Biology EXAM #2 March 20, 2003

7.06 Cell Biology EXAM #2 March 20, 2003 7.06 Cell Biology EXAM #2 March 20, 2003 This is an open book exam, and you are allowed access to books, a calculator, and notes but not computers or any other types of electronic devices. Please write

More information

Rejuvenation of the muscle stem cell population restores strength to injured aged muscles

Rejuvenation of the muscle stem cell population restores strength to injured aged muscles Rejuvenation of the muscle stem cell population restores strength to injured aged muscles Benjamin D Cosgrove, Penney M Gilbert, Ermelinda Porpiglia, Foteini Mourkioti, Steven P Lee, Stephane Y Corbel,

More information

7.06 Problem Set #3, Spring 2005

7.06 Problem Set #3, Spring 2005 7.06 Problem Set #3, Spring 2005 1. The Drosophila compound eye is composed of about 800 units called ommatidia. Each ommatidium contains eight photoreceptor neurons (R1 through R8), which develop in a

More information

Nature Methods: doi: /nmeth Supplementary Figure 1. Retention of RNA with LabelX.

Nature Methods: doi: /nmeth Supplementary Figure 1. Retention of RNA with LabelX. Supplementary Figure 1 Retention of RNA with LabelX. (a) Epi-fluorescence image of single molecule FISH (smfish) against GAPDH on HeLa cells expanded without LabelX treatment. (b) Epi-fluorescence image

More information

special offers from your protein biology resource

special offers from your protein biology resource special offers from your protein biology resource Pop open your cells, extract your proteins, purify, quantify and express them. Seeking knowledge about proteins with Thermo Scientific Protein Research

More information

Gaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo

Gaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo Gaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo Rampyari Raja Walia and Bakhos A. Tannous 1 2 1 Pluristem Innovations, 1453

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting.

Nature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting. Supplementary Figure 1 Zranb1 gene targeting. (a) Schematic picture of Zranb1 gene targeting using an FRT-LoxP vector, showing the first 6 exons of Zranb1 gene (exons 7-9 are not shown). Targeted mice

More information

Supplemental Materials. Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans

Supplemental Materials. Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans Supplemental Materials Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans Madhusudhan Budatha, Shayzreen Roshanravan, Qian Zheng, Cecilia Weislander, Shelby L. Chapman,

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/1137999/dc1 Supporting Online Material for Disrupting the Pairing Between let-7 and Enhances Oncogenic Transformation Christine Mayr, Michael T. Hemann, David P. Bartel*

More information

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. ZBTB20 expression in the developing DRG. ZBTB20 expression in the developing DRG was detected by immunohistochemistry using anti-zbtb20 antibody 9A10 on

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 PCR-genotyping of the three mouse models used in this study and controls for behavioral experiments after semi-chronic Pten inhibition. a-c. DNA from App/Psen1 (a), Pten tg (b) and

More information

Supplemental Information. Loss of MicroRNA-7 Regulation Leads. to a-synuclein Accumulation and. Dopaminergic Neuronal Loss In Vivo

Supplemental Information. Loss of MicroRNA-7 Regulation Leads. to a-synuclein Accumulation and. Dopaminergic Neuronal Loss In Vivo YMTHE, Volume 25 Supplemental Information Loss of MicroRNA-7 Regulation Leads to a-synuclein Accumulation and Dopaminergic Neuronal Loss In Vivo Kirsty J. McMillan, Tracey K. Murray, Nora Bengoa-Vergniory,

More information

Species predicted to react based on 100% sequence homology: Chicken, Bovine, Dog.

Species predicted to react based on 100% sequence homology: Chicken, Bovine, Dog. 1 of 5 11/1/2013 10:25 PM Product Pathways - Jak/Stat Pathway Phospho-Stat3 (Tyr705) Antibody #9131 Have you tried your application using our XP monoclonal antibodies? Try products: 9145 PhosphoSitePlus

More information

Int. J. Mol. Sci. 2016, 17, 1259; doi: /ijms

Int. J. Mol. Sci. 2016, 17, 1259; doi: /ijms S1 of S5 Supplementary Materials: Fibroblast-Derived Extracellular Matrix Induces Chondrogenic Differentiation in Human Adipose-Derived Mesenchymal Stromal/Stem Cells in Vitro Kevin Dzobo, Taegyn Turnley,

More information

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with

More information

GSI Equine IL-10 ELISA Kit- Cell Lysate DataSheet

GSI Equine IL-10 ELISA Kit- Cell Lysate DataSheet IL-10, also known as human cytokine synthesis inhibitory factor (CSIF), is an antiinflammatory cytokine that is produced by T cells, NK cells, mast cells and macrophages (1,2,3). It is capable of inhibiting

More information

To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well

To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well Supplemental Information: Supplemental Methods: Cell culture To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well in 96 well Primaria plates in GNS media and incubated at

More information

Direct Cell Counting Assays for Immuno Therapy

Direct Cell Counting Assays for Immuno Therapy Direct Cell Counting Assays for Immuno Therapy Cytotoxicity assays play a central role in studying the function of immune effector cells such as cytolytic T lymphocytes (CTL) and natural killer (NK) cells.

More information

SUPPLEMENTARY INFORMATION. Transcriptional output transiently spikes upon mitotic exit

SUPPLEMENTARY INFORMATION. Transcriptional output transiently spikes upon mitotic exit SUPPLEMENTARY INFORMATION Transcriptional output transiently spikes upon mitotic exit Viola Vaňková Hausnerová 1, 2, Christian Lanctôt 1* 1 BIOCEV and Department of Cell Biology, Faculty of Science, Charles

More information

Multiplex Fluorescence Assays for Adherence Cells without Trypsinization

Multiplex Fluorescence Assays for Adherence Cells without Trypsinization Multiplex Fluorescence Assays for Adherence Cells without Trypsinization The combination of a bright field and three fluorescent channels allows the Celigo to perform many multiplexed assays. A gating

More information

Supplementary Figure 1: MYCER protein expressed from the transgene can enhance

Supplementary Figure 1: MYCER protein expressed from the transgene can enhance Relative luciferase activity Relative luciferase activity MYC is a critical target FBXW7 MYC Supplementary is a critical Figures target 1-7. FBXW7 Supplementary Material A E-box sequences 1 2 3 4 5 6 HSV-TK

More information

Figure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA.

Figure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA. Summary of Supplemental Information Figure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA. Figure S2: rrna removal procedure is effective for clearing out

More information

Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets.

Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets. Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets. Scale bar represent 100 nm. The sizes of EVs from MDA-MB-231-D3H1 (D3H1),

More information

Immunofluorescence images of different core histones and different histone exchange assay.

Immunofluorescence images of different core histones and different histone exchange assay. Molecular Cell, Volume 51 Supplemental Information Enhanced Chromatin Dynamics by FACT Promotes Transcriptional Restart after UV-Induced DNA Damage Christoffel Dinant, Giannis Ampatziadis-Michailidis,

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

ab Hypoxic Response Human Flow Cytometry Kit

ab Hypoxic Response Human Flow Cytometry Kit ab126585 Hypoxic Response Human Flow Cytometry Kit Instructions for Use For measuring protein levels by flow cytometry: hypoxia-inducible factor 1-alpha (HIF1A) and BCL2/adenovirus E1B 19 kda proteininteracting

More information

Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and

Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and SSEA4 after 10 passages in mtesr 1 medium. (b) Schematic

More information

Supplementary Figure. S1

Supplementary Figure. S1 Supplementary Figure. S1 Supplementary Figure S1. Correlation of phagocytic ability measured with YG and YO beads. Fresh human monocytes (2 10 6 /ml) were labelled with APC conjugated anti CD14 mab alone

More information

Updated April 27, PRODUCT INSERT

Updated April 27, PRODUCT INSERT Updated April 27, 2009 1 PRODUCT INSERT Hypoxyprobe, Inc. 121 Middlesex Turnpike Burlington, MA 01803 USA www.hypoxyprobe.com Hypoxyprobe Gemini Kit Kit Contents: Solid pimonidazole HCl (Hypoxyprobe -1)

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Ex2 promotor region Cre IRES cherry pa Ex4 Ex5 Ex1 untranslated Ex3 Ex5 untranslated EYFP pa Rosa26 STOP loxp loxp Cre recombinase EYFP pa Rosa26 loxp 1 kb Interleukin-9 fate reporter

More information

EGFR (Phospho-Ser695)

EGFR (Phospho-Ser695) Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 EGFR (Phospho-Ser695) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02090 Please read the provided manual entirely

More information

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin

More information

ViewRNA ISH Cell Assays. Visualize RNA with single-molecule sensitivity and single-cell resolution

ViewRNA ISH Cell Assays. Visualize RNA with single-molecule sensitivity and single-cell resolution ViewRNA ISH Cell Assays Visualize RNA with single-molecule sensitivity and single-cell resolution ViewRNA ISH Cell Assays Analyze sample heterogeneity Study noncoding RNAs, including mirna and lncrna,

More information

American Society of Cytopathology Core Curriculum in Molecular Biology

American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology Chapter 3 Molecular Techniques Separation and Detection, Part

More information

Center Drive, University of Michigan Health System, Ann Arbor, MI

Center Drive, University of Michigan Health System, Ann Arbor, MI Leukotriene B 4 -induced reduction of SOCS1 is required for murine macrophage MyD88 expression and NFκB activation Carlos H. Serezani 1,3, Casey Lewis 1, Sonia Jancar 2 and Marc Peters-Golden 1,3 1 Division

More information

Tumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor

Tumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor Tumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor Nicholas Love 11/28/01 A. What is p21? Introduction - p21 is a gene found on chromosome 6 at 6p21.2 - this gene

More information

Roche Molecular Biochemicals Technical Note No. LC 10/2000

Roche Molecular Biochemicals Technical Note No. LC 10/2000 Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce

More information

Supplementary File 3: DNA and RNA isolation

Supplementary File 3: DNA and RNA isolation Supplementary File 3: DNA and RNA isolation Q-CROC-02 Biopsy protocol For the purposes of this protocol, four needle core biopsies (NCBs) of lymph node tissue are isolated from each patient using a 16G

More information

Immunological Techniques

Immunological Techniques Midterm Extra Office Hours Take Regular Office Hours: Tuesdays 11-12 Extra office hours: Wed, Feb 7 12-1pm Thurs, Feb 8 11am-12 Fri, Feb 9 2-4pm I WILL NOT BE HOLDING OFFICE HOURS ON TUESDAY Feb 13!! Dina,

More information

PARP-1 (cleaved) Human In-Cell ELISA Kit (IR)

PARP-1 (cleaved) Human In-Cell ELISA Kit (IR) ab110215 PARP-1 (cleaved) Human In-Cell ELISA Kit (IR) Instructions for Use For the quantitative measurement of Human PARP-1 (cleaved) concentrations in cultured adherent and suspension cells. This product

More information

Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on

Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on Supplemental Material Detailed Methods Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on 5µg/mL human fibronectin coated plates in DMEM supplemented with 10% FBS and penicillin/streptomycin

More information

TCTP directly regulates ATM activity to control genome stability and organ development in Drosophila melanogaster

TCTP directly regulates ATM activity to control genome stability and organ development in Drosophila melanogaster Received 25 Apr 213 Accepted 21 Nov 213 Published 19 Dec 213 TCTP directly regulates ATM activity to control genome stability and organ development in Drosophila melanogaster Sung-Tae Hong 1 & Kwang-Wook

More information

INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807

INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807 INOS Colorimetric Cell-Based ELISA Kit Catalog #: OKAG00807 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only. Not Intended

More information

Confocal immunofluorescence microscopy

Confocal immunofluorescence microscopy Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,

More information

Automated Imaging and Dual-Mask Analysis of γh2ax Foci to Determine DNA Damage on an Individual Cell Basis

Automated Imaging and Dual-Mask Analysis of γh2ax Foci to Determine DNA Damage on an Individual Cell Basis A p p l i c a t i o n N o t e Automated Imaging and Dual-Mask Analysis of γh2ax Foci to Determine DNA Damage on an Individual Cell Basis Brad Larson, BioTek Instruments, Inc., Winooski, VT USA Asha Sinha

More information

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution... vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface

More information

Regulation of Synaptic Structure and Function by FMRP- Associated MicroRNAs mir-125b and mir-132

Regulation of Synaptic Structure and Function by FMRP- Associated MicroRNAs mir-125b and mir-132 Neuron, Volume 65 Regulation of Synaptic Structure and Function by FMRP- Associated MicroRNAs mir-125b and mir-132 Dieter Edbauer, Joel R. Neilson, Kelly A. Foster, Chi-Fong Wang, Daniel P. Seeburg, Matthew

More information

Supplemental Material for

Supplemental Material for Supplemental Material for TXI TELNGIECTSI MUTTED (TM)-MEDITED DN DMGE RESPONSE IN OXIDTIVE STRESS-INDUCED VSCULR ENDOTHELIL CELL SENESCENCE Hong Zhan 1, Toru Suzuki 1,2, Kenichi izawa 1, Kiyoshi Miyagawa,

More information

Systematic Analysis of single cells by PCR

Systematic Analysis of single cells by PCR Systematic Analysis of single cells by PCR Wolfgang Mann 27th March 2007, Weihenstephan Overview AmpliGrid Technology Examples DNA Forensics Single Cell Sequencing Polar Body Diagnostics Single Cell RT

More information

mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet

mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet Details

More information

mir-24-mediated down-regulation of H2AX suppresses DNA repair

mir-24-mediated down-regulation of H2AX suppresses DNA repair Supplemental Online Material mir-24-mediated down-regulation of H2AX suppresses DNA repair in terminally differentiated blood cells Ashish Lal 1,4, Yunfeng Pan 2,4, Francisco Navarro 1,4, Derek M. Dykxhoorn

More information

FBH1 Catalyzes Regression of Stalled Replication Forks

FBH1 Catalyzes Regression of Stalled Replication Forks Cell Reports Supplemental Information FBH1 Catalyzes Regression of Stalled Replication Forks Kasper Fugger, Martin Mistrik, Kai J. Neelsen, Qi Yao, Ralph Zellweger, Arne Nedergaard Kousholt, Peter Haahr,

More information

Protein Purification Products. Complete Solutions for All of Your Protein Purification Applications

Protein Purification Products. Complete Solutions for All of Your Protein Purification Applications Protein Purification Products Complete Solutions for All of Your Protein Purification Applications FLAG-Tagged Protein Products EXPRESS with the pcmv-dykddddk Vector Set Fuse your protein of interest to

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

Gene Therapy for Cystic Fibrosis Lung Disease MTERMS 2012

Gene Therapy for Cystic Fibrosis Lung Disease MTERMS 2012 Gene Therapy for Cystic Fibrosis Lung Disease MTERMS 2012 Gene Medicine Group: Oxford University Deborah Gill Steve Hyde UK Cystic Fibrosis Gene Therapy Consortium Edinburgh University To develop a clinical

More information

MSD Immuno-Dot-Blot Assays. A division of Meso Scale Diagnostics, LLC.

MSD Immuno-Dot-Blot Assays. A division of Meso Scale Diagnostics, LLC. MSD Immuno-Dot-Blot Assays Example: High Throughput Western Blots Replacements Traditional Western Blots High content Molecular weight and immunoreactivity Labor and protein intensive Inherently low throughput

More information

3.1.4 DNA Microarray Technology

3.1.4 DNA Microarray Technology 3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns

More information

NEW! CHOgro Expression System

NEW! CHOgro Expression System NEW! CHOgro Expression System At Mirus Bio, we know it s all about expression. Introducing the new CHOgro Expression System, a transient transfection platform that finally gets high protein titers with

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

The MAP Kinase Family

The MAP Kinase Family The MAP Kinase Family Extracellular stimuli Classical MAP kinases Atypical MAP kinases MAPKKK MLK1/2/3/7; LZK RAF-1/A/B TAK1; TPL2 c-mos MEKK1-4; DLK ASK1/2; MLTK TAO1/2 ASK1 TAK1 MEKK1-4 MEKK2/3 TPL2???

More information

Supplemental Information. Neutrophil-Derived IL-1b Impairs the Efficacy. of NF-kB Inhibitors against Lung Cancer

Supplemental Information. Neutrophil-Derived IL-1b Impairs the Efficacy. of NF-kB Inhibitors against Lung Cancer Cell Reports, Volume 16 Supplemental Information Neutrophil-Derived IL-1b Impairs the Efficacy of NF-kB Inhibitors against Lung Cancer Allyson G. McLoed, Taylor P. Sherrill, Dong-Sheng Cheng, Wei Han,

More information

Real-time 96-well antibody internalization assays using IncuCyte FabFluor Red Antibody Labeling Reagent

Real-time 96-well antibody internalization assays using IncuCyte FabFluor Red Antibody Labeling Reagent Nicola Bevan, Tim Dale, Del Trezise Essen BioScience Welwyn Garden City, Hertfordshire, UK Introduction Monoclonal antibodies are now widely used as anti-cancer, antiinflammatory and anti-viral therapeutic

More information

ViraDuctin Lentivirus Transduction Kit

ViraDuctin Lentivirus Transduction Kit Product Manual ViraDuctin Lentivirus Transduction Kit Catalog Number LTV-200 40 transductions (24-well plate) FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction The rate at which lentiviral

More information

TransIT -Lenti Transfection Reagent

TransIT -Lenti Transfection Reagent Quick Reference Protocol, SDS and Certificate of Analysis available at mirusbio.com/6600 INTRODUCTION Lentivirus is an enveloped, single-stranded RNA virus from the Retroviridae family capable of infecting

More information

HCT116 SW48 Nutlin: p53

HCT116 SW48 Nutlin: p53 Figure S HCT6 SW8 Nutlin: - + - + p GAPDH Figure S. Nutlin- treatment induces p protein. HCT6 and SW8 cells were left untreated or treated for 8 hr with Nutlin- ( µm) to up-regulate p. Whole cell lysates

More information

Mammalian DNA2 helicase/nuclease cleaves G-quadruplex DNA and is required for telomere integrity

Mammalian DNA2 helicase/nuclease cleaves G-quadruplex DNA and is required for telomere integrity Manuscript EMBO-2012-83769 Mammalian DNA2 helicase/nuclease cleaves G-quadruplex DNA and is required for telomere integrity Weiqiang Lin, Shilpa Sampathi, Huifang Dai, Changwei Liu, Mian Zhou, Jenny Hu,

More information

2. Sample dilution: Tissue lysate and cell lysate sample should be diluted at least 5-fold with 1x Sample Diluent Buffer.

2. Sample dilution: Tissue lysate and cell lysate sample should be diluted at least 5-fold with 1x Sample Diluent Buffer. Mouse IL-6 (Lysate) ELISA Kit Catalog No: CKM054 Size: 1 x 96 tests I. Introduction The Cell Sciences Mouse IL-6 ELISA (Enzyme-Linked Immunosorbent Assay) kit is an in vitro enzyme-linked immunosorbent

More information

Supplementary Data: Fig. 1S Detailed description of In vivo experimental design

Supplementary Data: Fig. 1S Detailed description of In vivo experimental design 1 2 Supplementary Data: Fig. 1S Detailed description of In vivo experimental design 3 4 5 6 7 8 9 Relative Expression Studies 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 The

More information

Protein/Cytokine Array Services

Protein/Cytokine Array Services Protein/Cytokine Array Services at the Analytical Instrumentation Core Boston University, AIC, DOM, BMC, BUMC 2015 Analytical Instrumentation Core Mission: The AIC supports investigators through both cutting-edge

More information

NTM486-04, NTM174-04,

NTM486-04, NTM174-04, Transfection of transformed human trabecular meshwork TM5, and primary human NTM210-05, NTM486-04, NTM174-04, and NTM153-00 cells with Metafectene Easy Adnan Dibas1A,C, Ming Jiang1A,C, Thomas Yorio1A,C.

More information

Nature Immunology: doi: /ni Supplementary Figure 1

Nature Immunology: doi: /ni Supplementary Figure 1 Supplementary Figure 1 PPAR-γ is dispensable for the development of tissue macrophages in the heart, kidneys, lamina propria and white adipose tissue. Plots show the expression of F4/80 and CD11b (a) or

More information

Custom Antibodies Services. GeneCust Europe. GeneCust Europe

Custom Antibodies Services. GeneCust Europe. GeneCust Europe GeneCust Europe Laboratoire de Biotechnologie du Luxembourg S.A. 2 route de Remich L-5690 Ellange Luxembourg Tél. : +352 27620411 Fax : +352 27620412 Email : info@genecust.com Web : www.genecust.com Custom

More information

TECHNICAL BULLETIN. JNK 1&2 Activity Assay Kit. Product Number CS0380 Storage Temperature 20 C

TECHNICAL BULLETIN. JNK 1&2 Activity Assay Kit. Product Number CS0380 Storage Temperature 20 C JNK 1&2 Activity Assay Kit Product Number CS0380 Storage Temperature 20 C TECHNICAL BULLETIN Product Description The c-jun N-terminal kinases (JNKs), also known as stress activated protein kinases (SAPKs),

More information

Reprogramming of Dermal Fibroblasts into Osteo-Chondrogenic Cells

Reprogramming of Dermal Fibroblasts into Osteo-Chondrogenic Cells Stem Cell Reports, Volume 8 Supplemental Information Reprogramming of Dermal Fibroblasts into Osteo-Chondrogenic Cells with Elevated Osteogenic Potency by Defined Transcription Factors Yinxiang Wang, Ming-Hoi

More information

For identifying inhibitors and activators of mitochondrial biogenesis in adherent cultured cells.

For identifying inhibitors and activators of mitochondrial biogenesis in adherent cultured cells. ab110216 MitoBiogenesis TM In-Cell ELISA Kit (IR) Instructions for Use For identifying inhibitors and activators of mitochondrial biogenesis in adherent cultured cells. This product is for research use

More information

A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish

A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish Developmental Cell Supplemental Information A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish Julien Ablain, Ellen M. Durand, Song Yang, Yi Zhou, and Leonard I. Zon % larvae

More information

Garth Hamilton, Karen S. Yee, Simon Scrace, and Eric O Neill

Garth Hamilton, Karen S. Yee, Simon Scrace, and Eric O Neill Current Biology, Volume 19 Supplemental Data ATM Regulates a RASSF1A-Dependent DNA Damage Response Garth Hamilton, Karen S. Yee, Simon Scrace, and Eric O Neill Supplemental Experimental Procedures Tissue

More information