Humans Evolved in Response to a Challenge

Size: px
Start display at page:

Download "Humans Evolved in Response to a Challenge"

Transcription

1 Humans Evolved in Response to a Challenge Taxonomy, Phylogeny, and the Problem of Convergence Phylogenetic Trees Based on Molecular Data The Concept of Molecular Clocks DNA Hybridization as an Overall Method for Counting Mutations Traditional Versus Molecular Data for Hominoid Phylogeny Hominins Evolved Rapidly in Response to a Climate Change Exact Nature of Some Genetic Differences between Humans and Other Primates

2 Figure 2.2: Modern primate taxonomy.

3 Figure S3a: Carl von Linné ( ), aka Carolus Linnaeus, was a Swedish professor of botany, naturalist, and poet. He laid the foundations for the binomial nomenclature (genus, species) of organisms. His book Systema Naturae (10th ed., 1758) classified 4,400 animal and 7,700 plant species. The Lutheran archbishop of Uppsala accused him of impiety for placing the human among the primates.

4 Figure 3.1: The concept of a natural taxonomic tree

5 Defining Human Characteristics Habitual bipedalism, thumb fully opposable Exceptional brain size, ability to learn/solve problems Tool making Art, complex spoken languages Reproductive and sexual characteristics Family units within large communities Conspicuous female breasts, independently of nursing Concealed estrus, female receptivity throughout menstrual cycle Modesty Sexual intercourse in private, long lasting Interpretation: Monogamous family units are stabilized by sexual bonding, which promotes male confidence in paternity and willingness to help with raising children.

6 Hominoidea: Traditional taxonomic system From Turnbaugh et al. (1993)

7 Figure 2.2: Modern primate taxonomy.

8 Humans Evolved in Response to a Challenge Taxonomy, Phylogeny, and the Problem of Convergence Phylogenetic Trees Based on Molecular Data The Concept of Molecular Clocks DNA Hybridization as an Overall Method for Counting Mutations Traditional Versus Molecular Data for Hominoid Phylogeny Hominins Evolved Rapidly in Response to a Climate Change Exact Nature of Some Genetic Differences between Humans and Other Primates

9 Humans Evolved in Response to a Challenge Taxonomy, Phylogeny, and the Problem of Convergence Phylogenetic Trees Based on Molecular Data The Concept of Molecular Clocks DNA Hybridization as an Overall Method for Counting Mutations Traditional Versus Molecular Data for Hominoid Phylogeny Hominins Evolved Rapidly in Response to a Climate Change Exact Nature of Some Genetic Differences between Humans and Other Primates

10 Humans Evolved in Response to a Challenge Taxonomy, Phylogeny, and the Problem of Convergence Phylogenetic Trees Based on Molecular Data The Concept of Molecular Clocks DNA Hybridization as an Overall Method for Counting Mutations Traditional Versus Molecular Data for Hominoid Phylogeny Hominins Evolved Rapidly in Response to a Climate Change Exact Nature of Some Genetic Differences between Humans and Other Primates

11 Double-stranded DNA becomes singlestranded ( melts ), if warmed to near 90 0 C. When allowed to cool down, the single strands will hybridize again, with repetitive sequences (A, color) becoming doublestranded first. From Sci. Amer. Vol. 222/issue 4/page 25

12 Figure 3.2: The melting of double-stranded DNA by heat can be monitored by measuring its UV absorption, which increases as the DNA strands separate. The "melting curve, i.e. a plot of the percentage of single-stranded DNA vs. temperature, rises sharply between 85 and 90 o C.

13 Figure 3.3: Base pair mismatches in hybrid DNA cause a loss of hydrogen bonds and a resulting decrease in melting temperature.

14 Figure 3.4: T. The melting temperature of DNA decreases by a small differential ( T ) when some of the base pairs are mismatched, as in hybrid DNA from two species.!

15 Figure S3.b: Lowered melting points (Delta T 50 H) of hybrid DNA from combinations of hominoid species. From Sibley and Ahlquist (1984)

16 Figure 3.5: Hominoid taxonomy based on DNA hybridization data. The time calibration is based on fossil data indicating that the orangutan lineage diverged from African apes 17 million years ago (MYA). From Sibley and Ahlquist (1984)

17 Humans Evolved in Response to a Challenge Taxonomy, Phylogeny, and the Problem of Convergence Phylogenetic Trees Based on Molecular Data The Concept of Molecular Clocks DNA Hybridization as an Overall Method for Counting Mutations Traditional Versus Molecular Data for Hominoid Phylogeny Hominins Evolved Rapidly in Response to a Climate Change Exact Nature of Some Genetic Differences between Humans and Other Primates

18 Figure 3.6: The molecular tree (to the right) reflects the likely course of evolution. In this tree - the family Pongidae include only one extant species, Pongo pygmaeus, - humans share another family, the (Hominidae), with all African great apes, - the last common ancestor of humans and non-human primates is more recent. - humans and their fossil ancestors are placed in an infrafamily (Hominini).

19 Fig. 3.6: The traditional and molecular taxonomic trees of the Hominoidea can be reconciled by assuming that è humans and all great apes are genetically similar è an unusually large fraction of the DNA mutations of the Hominini (yellow line) had major phenotypic effects that were positively selected for.

20 Fig. 3.6: To reconcile the traditional and molecular taxonomic trees of the Hominoidea, è there must be mutations that have major phenotypic effects. Are there such mutations?

21 Figure S3.c: Loss of embryonic function in the Ultrabithorax gene of the fruit fly Drosophila melanogaster Top left and right: wild-type. Note club-shaped balancer organs (halteres) on third thoracic segment. Bottom: Loss of Ultrabithorax gene activity causes the replacement of the third thoracic segment (incl. halteres) with a duplication of the second thoracic segment (incl. wings).

22 (a) (b) Fig. S3.d: Abnormal self-assembly of hemoglobin molecules in humans with sickle cell anemia. (d) (c) a) SEM of normal red blood cell (b) SEM of sickled red blood cell (c) Electron micrograph of fiber formed by hemoglobin S (tetramer carrying two β globins with the 6 val glu substitution) (d) Model of self-assembled hemoglobin S. Each circle represents a hemoglobin S tetramer.

23 Fig. 3.6: To reconcile the traditional and molecular taxonomic trees of the Hominoidea, è there must have been circumstances that left the common ancestors of the Panini and the Hominini in a state of poor adaptation.

24 Humans Evolved in Response to a Challenge Taxonomy, Phylogeny, and the Problem of Convergence Phylogenetic Trees Based on Molecular Data The Concept of Molecular Clocks DNA Hybridization as an Overall Method for Counting Mutations Traditional Versus Molecular Data for Hominoid Phylogeny Hominins Evolved Rapidly in Response to a Climate Change Exact Nature of Some Genetic Differences between Humans and Other Primates

25 Figure 3.7: Sahelanthropus chadensis Dated 6-7 million years ago, and found in the Djurab desert of Chad/Central Africa, this skull is the oldest bona fide hominin fossil so far.

26 Figure 3.8: About 10-5 mya, a climate change in Africa replaced much tropical forest with open habitats. The resulting change in natural selection facilitated the rapid evolution of hominins (From Lewin, 1993a).

27 Humans Evolved in Response to a Challenge Taxonomy, Phylogeny, and the Problem of Convergence Phylogenetic Trees Based on Molecular Data The Concept of Molecular Clocks DNA Hybridization as an Overall Method for Counting Mutations Traditional Versus Molecular Data for Hominoid Phylogeny Hominins Evolved Rapidly in Response to a Climate Change Exact Nature of Some Genetic Differences between Humans and Other Primates

28 Mutations that are Well Conserved in Hominin Lineage In coding regions ASPM + : encodes microtubule-associated protein. Loss of function inhibits brain growth. FOXP2 + : encodes transcription factor. Loss of function causes speech impairment. In gene expression Lac + gene expressed beyond weaning in human populations herding mammals.

29 Figure 3.9: Genes and phenotypic traits." Gene a, affecting more than one trait, is pleiotropic. Trait 2, being affected by more than one gene, is polygenic.

30 Humans Evolved in Response to a Challenge Taxonomy, Phylogeny, and the Problem of Convergence Phylogenetic Trees Based on Molecular Data The Concept of Molecular Clocks DNA Hybridization as an Overall Method for Counting Mutations Traditional Versus Molecular Data for Hominoid Phylogeny Hominins Evolved Rapidly in Response to a Climate Change Exact Nature of Some Genetic Differences between Humans and Other Primates

31 80 0 C 95 0 C 80 0 C Tracer & Driver. If radiolabeled single-sequence (ss) DNA ( tracer DNA, red) from species X is mixed with excess unlabeled ss DNA ( driver DNA, blue) from species Y, then any given labeled strand is more likely to hybridize with a complementary unlabeled strand than with a complementary labeled strand. Most of the radioactivity will then be present (and measured) in hybrid DNA. From Sci. Amer. Vol. 222/ Issue 4

Units 4: How Does Life Change and Respond to Challenges Over Time?

Units 4: How Does Life Change and Respond to Challenges Over Time? Units 4: How Does Life Change and Respond to Challenges Over Time? Area of Study 1: How Are Species Related? Area of Study 2: How Do Humans Impact on Biological Processes? Area of Study 3: Practical Investigation

More information

RNA ID missing Word ID missing Word DNA ID missing Word

RNA ID missing Word ID missing Word DNA ID missing Word Table #1 Vocab Term RNA ID missing Word ID missing Word DNA ID missing Word Definition Define Base pairing rules of A=T and C=G are used for this process DNA duplicates, or makes a copy of, itself. Synthesis

More information

Problem Set 2

Problem Set 2 ame: 2006 7.012 Problem Set 2 Due before 5 PM on FRIDAY, September 29, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YUR ASWERS THIS PRITUT. 1. You are doing a genetics experiment with

More information

They are similar to one another but different from other species: They are capable of breeding: Artificial classification: Natural classification:

They are similar to one another but different from other species: They are capable of breeding: Artificial classification: Natural classification: Classification Scientists estimate that the numbers of species on Earth are from 10 million to 100 million. Classification is the organisation of living organisms into groups. This process is based on

More information

CHAPTER 21 GENOMES AND THEIR EVOLUTION

CHAPTER 21 GENOMES AND THEIR EVOLUTION GENETICS DATE CHAPTER 21 GENOMES AND THEIR EVOLUTION COURSE 213 AP BIOLOGY 1 Comparisons of genomes provide information about the evolutionary history of genes and taxonomic groups Genomics - study of

More information

Goal 3. Friday, May 10, 13

Goal 3. Friday, May 10, 13 Goal 3 Bio.3.1 Explain how traits are determined by the structure and function of DNA. Bio.3.2 Understand how the environment, and/or the interaction of alleles, influences the expression of genetic traits.

More information

Biology EOC Questions

Biology EOC Questions Biology EOC Questions 1 Coyotes eat proteins in food. The proteins break down due to enzymes produced in the stomach of the coyote. The production of these enzymes then causes more enzymes to be released

More information

Investigating Common Descent: Formulating Explanations and Model

Investigating Common Descent: Formulating Explanations and Model Name Investigating Common Descent: Formulating Explanations and Model Background: Common Descent This activity has extensive historical roots. Few question the idea that Charles Darwin's Origin of Species

More information

CS 262 Lecture 14 Notes Human Genome Diversity, Coalescence and Haplotypes

CS 262 Lecture 14 Notes Human Genome Diversity, Coalescence and Haplotypes CS 262 Lecture 14 Notes Human Genome Diversity, Coalescence and Haplotypes Coalescence Scribe: Alex Wells 2/18/16 Whenever you observe two sequences that are similar, there is actually a single individual

More information

From DNA to Protein: Genotype to Phenotype

From DNA to Protein: Genotype to Phenotype 12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each

More information

Teacher Resource CD: A Closer Look at Plants. Students know that as multicellular organisms develop, their cells differentiate.

Teacher Resource CD: A Closer Look at Plants. Students know that as multicellular organisms develop, their cells differentiate. Inquiry Investigations Kingdoms of Life MODULE 1294372 Grades: 7-10 Frey Scientific 80 Northwest Boulevard Nashua, NH 03063-4067 1-800-225-3739 www.freyscientific.com www.freyscientific.com/inquiryinvestigations

More information

DNA Replication: Paper Clip Activity

DNA Replication: Paper Clip Activity DNA Replication: Paper Clip Activity Name Hour: Date: Quick Review: Each DNA molecule has a unique structure that makes it different from other DNA molecules (Remember A chromosome is condensed DNA and

More information

Higher Unit 1: DNA and the Genome Topic 1.1 The Structure and Organisation of DNA

Higher Unit 1: DNA and the Genome Topic 1.1 The Structure and Organisation of DNA Higher Unit : DNA and the Genome Topic. The Structure and Organisation of DNA. Which of the following diagrams shows the correct structure of DNA? 2. A section of double stranded DNA was found to have

More information

Name: Date: Living Environment Period:

Name: Date: Living Environment Period: Name: Living Environment Date: Period: Heredity & DNA 1. Arrange the following structures from largest to smallest. a chromosome a nucleus a gene 2. The diagram below represents a portion of a molecule

More information

Population- group of individuals of the SAME species that live in the same area Species- a group of similar organisms that can breed and produce

Population- group of individuals of the SAME species that live in the same area Species- a group of similar organisms that can breed and produce Dr. Bertolotti Essential Question: Population- group of individuals of the SAME species that live in the same area Species- a group of similar organisms that can breed and produce FERTILE offspring Allele-

More information

University of York Department of Biology B. Sc Stage 2 Degree Examinations

University of York Department of Biology B. Sc Stage 2 Degree Examinations Examination Candidate Number: Desk Number: University of York Department of Biology B. Sc Stage 2 Degree Examinations 2016-17 Evolutionary and Population Genetics Time allowed: 1 hour and 30 minutes Total

More information

Genetics T H E S T U D Y O F H E R E D I T Y

Genetics T H E S T U D Y O F H E R E D I T Y Genetics T H E S T U D Y O F H E R E D I T Y Basic Vocabulary Genetics: The science of heredity Heredity The passing of physical characteristics (traits) from parents to offspring How does an organism

More information

Genomics and Biotechnology

Genomics and Biotechnology Genomics and Biotechnology Expansion of the Central Dogma DNA-Directed-DNA-Polymerase RNA-Directed- DNA-Polymerase DNA-Directed-RNA-Polymerase RNA-Directed-RNA-Polymerase RETROVIRUSES Cell Free Protein

More information

From DNA to Protein: Genotype to Phenotype

From DNA to Protein: Genotype to Phenotype 12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each

More information

Name: TOC#. Data and Observations: Figure 1: Amino Acid Positions in the Hemoglobin of Some Vertebrates

Name: TOC#. Data and Observations: Figure 1: Amino Acid Positions in the Hemoglobin of Some Vertebrates Name: TOC#. Comparing Primates Background: In The Descent of Man, the English naturalist Charles Darwin formulated the hypothesis that human beings and other primates have a common ancestor. A hypothesis

More information

Anthro 101: Human Biological Evolution. Lecture 3: Genetics & Inheritance. Prof. Kenneth Feldmeier feldmekj.weebly.

Anthro 101: Human Biological Evolution. Lecture 3: Genetics & Inheritance. Prof. Kenneth Feldmeier feldmekj.weebly. Anthro 101: Human Biological Evolution Lecture 3: Genetics & Inheritance Prof. Kenneth Feldmeier feldmekj@lavc.edu feldmekj.weebly.com What is Genetics??? Spend a few minutes discussing Genetics.. Genetics

More information

GENETICS: BIOLOGY HSA REVIEW

GENETICS: BIOLOGY HSA REVIEW GENETICS: BIOLOGY HSA REVIEW HSA Review A. Matching: On the lines provided, write the letter of the definition of each term. a. genetics f. gamete b. trait g. probability c. hybrid h. Punnett square d.

More information

Quiz will begin at 10:00 am. Please Sign In

Quiz will begin at 10:00 am. Please Sign In Quiz will begin at 10:00 am Please Sign In You have 15 minutes to complete the quiz Put all your belongings away, including phones Put your name and date on the top of the page Circle your answer clearly

More information

DNA RNA Protein Trait Protein Synthesis (Gene Expression) Notes Proteins (Review) Proteins make up all living materials

DNA RNA Protein Trait Protein Synthesis (Gene Expression) Notes Proteins (Review) Proteins make up all living materials DNA RNA Protein Trait Protein Synthesis (Gene Expression) Notes Proteins (Review) Proteins make up all living materials Proteins are composed of amino acids there are 20 different amino acids Different

More information

Which Process Is The First Step In Making A Protein From Dna Instructions >>>CLICK HERE<<<

Which Process Is The First Step In Making A Protein From Dna Instructions >>>CLICK HERE<<< Which Process Is The First Step In Making A Protein From Dna Instructions How do the instructions in DNA reach the ribosomes in the cytoplasm? RNA is needed for Then it helps build the protein. RNA is

More information

UNIT MOLECULAR GENETICS AND BIOTECHNOLOGY

UNIT MOLECULAR GENETICS AND BIOTECHNOLOGY UNIT MOLECULAR GENETICS AND BIOTECHNOLOGY Standard B-4: The student will demonstrate an understanding of the molecular basis of heredity. B-4.1-4,8,9 Effective June 2008 All Indicators in Standard B-4

More information

Evolution of Populations

Evolution of Populations Chapter 23. Evolution of Populations 1 Populations evolve Natural selection acts on individuals differential survival survival of the fittest differential reproductive success bear more offspring Populations

More information

SOLUZIONE DEL LEARN BY DOING

SOLUZIONE DEL LEARN BY DOING Sadava, Hillis, Heller, Berenbaum La nuova biologia.blu SOLUZIONE DEL LEARN BY DOING Di seguito sono riportate le soluzioni degli esercizi delle sezioni Learn by doing, esercizi con approccio CLIL dei

More information

Jay McTighe and Grant Wiggins,

Jay McTighe and Grant Wiggins, Course: Integrated Science 3/4 Unit #3: (DNA & RNA) Instructions for Life Stage 1: Identify Desired Results Enduring Understandings: Students will understand that Nearly all human traits, even many diseases,

More information

Outline. Structure of DNA DNA Functions Transcription Translation Mutation Cytogenetics Mendelian Genetics Quantitative Traits Linkage

Outline. Structure of DNA DNA Functions Transcription Translation Mutation Cytogenetics Mendelian Genetics Quantitative Traits Linkage Genetics Outline Structure of DNA DNA Functions Transcription Translation Mutation Cytogenetics Mendelian Genetics Quantitative Traits Linkage Chromosomes are composed of chromatin, which is DNA and associated

More information

Evolution is a process of change through time. A change in species over time.

Evolution is a process of change through time. A change in species over time. Theory of Evolution What is Evolution? Evolution is a process of change through time. A change in species over time. Theories of evolution provide an explanation for the differences and similarities in

More information

Unit 6: Genetics & Molecular Genetics Assessment

Unit 6: Genetics & Molecular Genetics Assessment Unit 6: Genetics & Molecular Genetics Assessment 1. NA replication takes place in the nucleus of eukaryotic cells during interphase. An enzyme called NA helicase relaxes the helix in certain places and

More information

What is Genetics? Genetics The study of how heredity information is passed from parents to offspring. The Modern Theory of Evolution =

What is Genetics? Genetics The study of how heredity information is passed from parents to offspring. The Modern Theory of Evolution = What is Genetics? Genetics The study of how heredity information is passed from parents to offspring The Modern Theory of Evolution = Genetics + Darwin s Theory of Natural Selection Gregor Mendel Father

More information

Activity 3.3.1: How is DNA Passed through the Generations?

Activity 3.3.1: How is DNA Passed through the Generations? Activity 3.3.1: How is DNA Passed through the Generations? Introduction In the previous activities, you learned that Anna Garcia lived with a life altering disease called sickle cell anemia. Unlike the

More information

Anthro 101: Human Biological Evolution. Lecture 3: Genetics & Inheritance. Prof. Kenneth Feldmeier feldmekj.weebly.

Anthro 101: Human Biological Evolution. Lecture 3: Genetics & Inheritance. Prof. Kenneth Feldmeier feldmekj.weebly. Anthro 101: Human Biological Evolution Lecture 3: Genetics & Inheritance Prof. Kenneth Feldmeier feldmekj@lavc.edu feldmekj.weebly.com What is Genetics??? Genetics is the scientific study of heredity.

More information

GENETICS 1 Classification, Heredity, DNA & RNA. Classification, Objectives At the end of this sub section you should be able to: Heredity, DNA and RNA

GENETICS 1 Classification, Heredity, DNA & RNA. Classification, Objectives At the end of this sub section you should be able to: Heredity, DNA and RNA Classification, Heredity, DNA and Objectives At the end of this sub section you should be able to: RNA Heredity and Variation Gene Expression DNA structure DNA Profiling Protein Synthesis 1. Discuss the

More information

Lecture 20: Drosophila melanogaster

Lecture 20: Drosophila melanogaster Lecture 20: Drosophila melanogaster Model organisms Polytene chromosome Life cycle P elements and transformation Embryogenesis Read textbook: 732-744; Fig. 20.4; 20.10; 20.15-26 www.mhhe.com/hartwell3

More information

Measuring Evolution of Populations

Measuring Evolution of Populations Measuring Evolution of Populations 5 Agents of evolutionary change Mutation Gene Flow Non-random mating Genetic Drift Selection Populations & gene pools Concepts u a population is a localized group of

More information

This is DUE: Tuesday, March 1, 2011 Come prepared to share your findings with your group.

This is DUE: Tuesday, March 1, 2011 Come prepared to share your findings with your group. Biology 160 NAME: Reading Guide 12: Population Dynamics, Humans, Part II This is DUE: Tuesday, March 1, 2011 Come prepared to share your findings with your group. *As before, please turn in only the Critical

More information

Honors Biology Semester 2 Final Exam Review Guide

Honors Biology Semester 2 Final Exam Review Guide Honors Biology Semester 2 Final Exam Review Guide As the final exam approaches, so should your preparation for the test. You should review all old exams given this semester: Cell Cycle, DNA, Genetics,

More information

Adaptive Molecular Evolution. Reading for today. Neutral theory. Predictions of neutral theory. The neutral theory of molecular evolution

Adaptive Molecular Evolution. Reading for today. Neutral theory. Predictions of neutral theory. The neutral theory of molecular evolution Adaptive Molecular Evolution Nonsynonymous vs Synonymous Reading for today Li and Graur chapter (PDF on website) Evolutionary EST paper (PDF on website) Neutral theory The majority of substitutions are

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:138/nature10532 a Human b Platypus Density 0.0 0.2 0.4 0.6 0.8 Ensembl protein coding Ensembl lincrna New exons (protein coding) Intergenic multi exonic loci Density 0.0 0.1 0.2 0.3 0.4 0.5 0 5 10

More information

Anthro 101: Human Biological Evolution. Lecture 3: Genetics & Inheritance. Prof. Kenneth Feldmeier feldmekj.weebly.

Anthro 101: Human Biological Evolution. Lecture 3: Genetics & Inheritance. Prof. Kenneth Feldmeier feldmekj.weebly. Anthro 101: Human Biological Evolution Lecture 3: Genetics & Inheritance Prof. Kenneth Feldmeier feldmekj@lavc.edu feldmekj.weebly.com What is Genetics??? Genetics is the scientific study of heredity.

More information

Average % If you want to complete quiz corrections for extra credit you must come after school Starting new topic today. Grab your clickers.

Average % If you want to complete quiz corrections for extra credit you must come after school Starting new topic today. Grab your clickers. Average 50.83% If you want to complete quiz corrections for extra credit you must come after school Starting new topic today. Grab your clickers. Evolution AP BIO Pacing Evolution Today Mutations Gene

More information

How does the human genome stack up? Genomic Size. Genome Size. Number of Genes. Eukaryotic genomes are generally larger.

How does the human genome stack up? Genomic Size. Genome Size. Number of Genes. Eukaryotic genomes are generally larger. How does the human genome stack up? Organism Human (Homo sapiens) Laboratory mouse (M. musculus) Mustard weed (A. thaliana) Roundworm (C. elegans) Fruit fly (D. melanogaster) Yeast (S. cerevisiae) Bacterium

More information

Mutation. ! Mutation occurs when a DNA gene is damaged or changed in such a way as to alter the genetic message carried by that gene

Mutation. ! Mutation occurs when a DNA gene is damaged or changed in such a way as to alter the genetic message carried by that gene Mutations Mutation The term mutation is derived from Latin word meaning to change.! Mutation occurs when a DNA gene is damaged or changed in such a way as to alter the genetic message carried by that gene!

More information

SCIENCE Assessment. Updates for Biology End-of-Course (EOC) Exam

SCIENCE Assessment. Updates for Biology End-of-Course (EOC) Exam SCIENCE Assessment Updates for 2014 Biology End-of-Course (EOC) Exam Updates for 2014, Biology EOC Page 1 Student Sample Pages Student Name: Updates for 2014, Biology EOC Page 5 Directions: Answer questions

More information

Replication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?

Replication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?

More information

of heritable factor ). 1. The alternative versions of genes are called alleles. Chapter 9 Patterns of Inheritance

of heritable factor ). 1. The alternative versions of genes are called alleles. Chapter 9 Patterns of Inheritance Chapter 9 Biology and Society: Our Longest-Running Genetic Experiment: Dogs Patterns of Inheritance People have selected and mated dogs with preferred traits for more than 15,000 years. Over thousands

More information

CHAPTER 21 LECTURE SLIDES

CHAPTER 21 LECTURE SLIDES CHAPTER 21 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.

More information

Station 1 DNA Evidence

Station 1 DNA Evidence Station 1 DNA Evidence Cytochrome-c is a protein found in the mitochondria that is used in cellular respiration. This protein consists of a chain of 104 amino acids. The chart below shows the amino acid

More information

Genetics 1 Star Test

Genetics 1 Star Test Name: ate: 1. The accompanying data table summarizes the results of an investigation in which seeds from the same plant were grown under different conditions of temperature and relative humidity. 2. The

More information

Review Quizzes Chapters 11-16

Review Quizzes Chapters 11-16 Review Quizzes Chapters 11-16 1. In pea plants, the allele for smooth seeds (S) is dominant over the allele for wrinkled seeds (s). In an experiment, when two hybrids are crossed, what percent of the offspring

More information

Lecture for Wednesday. Dr. Prince BIOL 1408

Lecture for Wednesday. Dr. Prince BIOL 1408 Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that

More information

Super Models. Deoxyribonucleic Acid (DNA) Molecular Model Kit. Copyright 2015 Ryler Enterprises, Inc. Recommended for ages 10-adult

Super Models. Deoxyribonucleic Acid (DNA) Molecular Model Kit. Copyright 2015 Ryler Enterprises, Inc. Recommended for ages 10-adult Super Models Deoxyribonucleic Acid (DNA) Molecular Model Kit Copyright 2015 Ryler Enterprises, Inc. Recommended for ages 10-adult! Caution: Atom centers and vinyl tubing are a choking hazard. Do not eat

More information

dominance neither trait is dominant; in a hybrid condition, there is a blending in the phenotype.

dominance neither trait is dominant; in a hybrid condition, there is a blending in the phenotype. Genetics NAME Period Date dominance neither trait is dominant; in a hybrid condition, there is a blending in the phenotype. - a condition when both alleles show up in

More information

The Genetic Code: Translation. Pre-class reading Chapter 17: Pages

The Genetic Code: Translation. Pre-class reading Chapter 17: Pages The Genetic Code: Translation Pre-class reading Chapter 17: Pages 336-348 Nomenclature needed: Translation RN (m, t, r) Signal peptide sequence Mutations Ribosomes + Polyribosomes Codon (triplet code)

More information

Chapter 02 The Molecular Nature of Genes

Chapter 02 The Molecular Nature of Genes Chapter 02 The Molecular Nature of Genes Multiple Choice Questions 1. Experiments conducted by Frederick Griffith laid the foundation for A. elucidation of mrna structure. B. DNA as the genetic material.

More information

Classical and Modern Genetics

Classical and Modern Genetics Classical and Modern Genetics Chapter 23 Great Idea: All living things use the same genetic code to guide the chemical reactions in every cell. 1 Chapter Outline Classical Genetics DNA and the Birth of

More information

Measuring Evolution of Populations. SLIDE SHOW MODIFIED FROM KIM

Measuring Evolution of Populations. SLIDE SHOW MODIFIED FROM KIM Measuring Evolution of Populations SLIDE SHOW MODIFIED FROM KIM FOGLIA@explorebiology.com 5 Agents of evolutionary change Mutation Gene Flow Non-random mating Genetic Drift Selection Populations & gene

More information

Lecture #8 2/4/02 Dr. Kopeny

Lecture #8 2/4/02 Dr. Kopeny Lecture #8 2/4/02 Dr. Kopeny Lecture VI: Molecular and Genomic Evolution EVOLUTIONARY GENOMICS: The Ups and Downs of Evolution Dennis Normile ATAMI, JAPAN--Some 200 geneticists came together last month

More information

Using Playing Cards To Simulate a Molecular Clock

Using Playing Cards To Simulate a Molecular Clock O N L I N E I N Q U I RY & I N V E S T I G AT I O N Using Playing Cards To Simulate a Molecular Clock Changes in DNA base-pair order may serve as an indicator of the time elapsed since divergence from

More information

Biology Semester Exam Study Guide--January 2016

Biology Semester Exam Study Guide--January 2016 Objective Response Reflection 3 = I totally know this! :) 2 = I remember this somewhat 1 = I don't remember this at all Explain the difference between independent and dependent variables. Explain what

More information

From Gene to Protein via Transcription and Translation i

From Gene to Protein via Transcription and Translation i How do genes influence our characteristics? From Gene to Protein via Transcription and Translation i A gene is a segment of DNA that provides the instructions for making a protein. Proteins have many different

More information

BIOL2. General Certificate of Education Advanced Subsidiary Examination January Unit 2 The variety of living organisms

BIOL2. General Certificate of Education Advanced Subsidiary Examination January Unit 2 The variety of living organisms Cherry Hill Tuition A Level Biology AQA Paper 12 Page 1 of 28 Centre Number Surname Candidate Number For Examiner s Use Other Names Candidate Signature Examiner s Initials General Certificate of Education

More information

Evolution of Populations (Ch. 17)

Evolution of Populations (Ch. 17) Evolution of Populations (Ch. 17) Doonesbury - Sunday February 8, 2004 Beak depth of Beak depth Where does Variation come from? Mutation Wet year random changes to DNA errors in gamete production Dry year

More information

Chapter 4. Modification of Mendelian Ratios

Chapter 4. Modification of Mendelian Ratios Chapter 4. Modification of Mendelian Ratios Inheritance Patterns are Often More Complex than Predicted by Simple Mendelian Genetics The relationship between genotype and phenotype is rarely as simple as

More information

The Process of Molecular Phylogenetics

The Process of Molecular Phylogenetics The Process of Molecular Phylogenetics I. Exercise #1 Molecular phylogenetics using a pseudogene Below are four gene sequences. These are taken from four animals that are believed to have recent shared

More information

Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein?

Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein? Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein? Messenger RNA Carries Information for Protein Synthesis from the DNA to Ribosomes Ribosomes Consist

More information

What is molecular evolution? BIOL2007 Molecular Evolution. Modes of molecular evolution. Modes of molecular evolution

What is molecular evolution? BIOL2007 Molecular Evolution. Modes of molecular evolution. Modes of molecular evolution BIOL2007 Molecular Evolution What is molecular evolution? Evolution at the molecular level Kanchon Dasmahapatra k.dasmahapatra@ucl.ac.uk Modes of molecular evolution INDELS: insertions and deletions Modes

More information

From Gene to Protein Transcription and Translation i

From Gene to Protein Transcription and Translation i From Gene to Protein Transcription and Translation i How do the genes in our DNA influence our characteristics? A gene is a segment of DNA that provides the instructions for making a protein. Proteins

More information

Chapter 11: Regulation of Gene Expression

Chapter 11: Regulation of Gene Expression Chapter Review 1. It has long been known that there is probably a genetic link for alcoholism. Researchers studying rats have begun to elucidate this link. Briefly describe the genetic mechanism found

More information

AP Biology Assessment 2

AP Biology Assessment 2 AP Biology Assessment 2 DATE OF ADMINISTRATION: JANUARY 8 12, 2017 TOPICS COVERED: ALL TOPICS THROUGH BASIC GENETICS In the second assessment, the focus will be on all topics through basic Mendelian Genetics.

More information

Report. Students who. were able to. Question 2c. abbreviations. pencil. shading. Question 1 % A. Comments. requires. cycles, (haploid) egg,

Report. Students who. were able to. Question 2c. abbreviations. pencil. shading. Question 1 % A. Comments. requires. cycles, (haploid) egg, Biology GA : Written examination GENERAL COMMENTS It was pleasing to see the majority of students attempt each question on the Biology 2 examination. The more able students weree able to apply their knowledge

More information

Ah, Lou! There really are differences between us!

Ah, Lou! There really are differences between us! Name Per Ah, Lou! There really are differences between us! Introduction The human genome (the total sum of our genetic makeup) is made up of approximately 6 billion base pairs distributed on 46 chromosomes.

More information

Genetics and Evolution. Mary Susan Mardon

Genetics and Evolution. Mary Susan Mardon Genetics and Evolution Mary Susan Mardon Nucleotides Building blocks of DNA and RNA. Each nucleotide contains: phosphate group. deoxyribose (DNA), ribose (RNA) nitrogen base. * adenine * cytosine * thymine

More information

Keystone Biology Remediation B2: Genetics

Keystone Biology Remediation B2: Genetics Keystone Biology Remediation B2: Genetics Assessment Anchors: to describe and/or predict observed patterns of inheritance (i.e. dominant, recessive, codominance, incomplete dominance, sex-linked, polygenic,

More information

5 FINGERS OF EVOLUTION

5 FINGERS OF EVOLUTION MICROEVOLUTION Student Packet SUMMARY EVOLUTION IS A CHANGE IN THE GENETIC MAKEUP OF A POPULATION OVER TIME Microevolution refers to changes in allele frequencies in a population over time. NATURAL SELECTION

More information

Genetics and Heredity Power Point Questions

Genetics and Heredity Power Point Questions Name period date assigned date due date returned Genetics and Heredity Power Point Questions 1. Heredity is the process in which pass from parent to offspring. 2. is the study of heredity. 3. A trait is

More information

. Definition The passing down of characteristics from generation to generation resulting in continuity and variation within a species

. Definition The passing down of characteristics from generation to generation resulting in continuity and variation within a species Section 3: The Basics of genetics. Definition The passing down of characteristics from generation to generation resulting in continuity and variation within a species Important Terms. Genes A specific

More information

Protein Synthesis Honors Biology

Protein Synthesis Honors Biology Protein Synthesis What do we know? Metabolism is controlled by enzymes enzymes are proteins DNA contains the genetic information to build proteins. DNA is only in the nucleus. Ribosomes are not. How then

More information

Function DNA. Basic Shape: TOC#10. Bio 10 - Lecture 10: DNA Structure and Muta7ons. Zannie Dallara 1

Function DNA. Basic Shape: TOC#10. Bio 10 - Lecture 10: DNA Structure and Muta7ons. Zannie Dallara 1 DNA Function Main Function: DNA s major function is to code for proteins. 1. Storage of genetic information 2. Self-duplication & inheritance. 3. Expression of the genetic message. How: Information is

More information

Chapter 11 Complex Inheritance and Human Heredity

Chapter 11 Complex Inheritance and Human Heredity Chapter 11 Complex Inheritance and Human Heredity 11.1 Basic Patterns of Human Inheritance o The inheritance of a trait over can be shown in a o Pedigrees can help us to track and understand Genetic Disorders

More information

COMPETITOR NAMES: TEAM NAME: TEAM NUMBER:

COMPETITOR NAMES: TEAM NAME: TEAM NUMBER: COMPETITOR NAMES: TEAM NAME: TEAM NUMBER: Section 1:Crosses In a fictional species of mice, with species name Mus SciOlyian, fur color is controlled by a single autosomal gene. The allele for brown fur

More information

(b) Draw a genetic linkage map showing map distances between met, thi, and pur.

(b) Draw a genetic linkage map showing map distances between met, thi, and pur. Botany 132 Final exam 2002 Name Please show all of your work in answering the questions below. 1. F- bacterial cells of genotype met - thi - pur - were conjugated with F+ cells with the genotype met +

More information

mrna for protein translation

mrna for protein translation Biology 1B Evolution Lecture 5 (March 5, 2010), Genetic Drift and Migration Mutation What is mutation? Changes in the coding sequence Changes in gene regulation, or how the genes are expressed as amino

More information

What is RNA? Another type of nucleic acid A working copy of DNA Does not matter if it is damaged or destroyed

What is RNA? Another type of nucleic acid A working copy of DNA Does not matter if it is damaged or destroyed RNA Section 3.1 What is RNA? Another type of nucleic acid A working copy of DNA Does not matter if it is damaged or destroyed Used to direct the production of proteins that determines an organisms characteristics

More information

VCE Biology Units 3 and

VCE Biology Units 3 and VCE Biology Units 3 and 4 2015 The following is from the Biology Victorian Certificate of Education Study Design 2013 2016. Units 1 to 4: Key Skills Investigate and inquire scientifically formulate questions

More information

7.03 Final Exam Review 12/19/2006

7.03 Final Exam Review 12/19/2006 7.03 Final Exam Review 12/19/2006 1. You have been studying eye color mutations in Drosophila, which normally have red eyes. White eyes is a recessive mutant trait that is caused by w, a mutant allele

More information

Chapter 13. How Populations Evolve. Lectures by Edward J. Zalisko

Chapter 13. How Populations Evolve. Lectures by Edward J. Zalisko Chapter 13 How Populations Evolve PowerPoint Lectures for Campbell Essential Biology, Fifth Edition, and Campbell Essential Biology with Physiology, Fourth Edition Eric J. Simon, Jean L. Dickey, and Jane

More information

AP Biology. Extending Mendelian genetics. Chapter 14. Beyond Mendel s Laws of Inheritance. Incomplete dominance. Incomplete dominance.

AP Biology. Extending Mendelian genetics. Chapter 14. Beyond Mendel s Laws of Inheritance. Incomplete dominance. Incomplete dominance. female / eggs Chapter 14. Beyond Mendel s Laws of Inheritance Extending Mendelian genetics Mendel worked with a simple system peas are genetically simple most traits are controlled by a single gene each

More information

From Gene to Protein Transcription and Translation i

From Gene to Protein Transcription and Translation i How do genes influence our characteristics? From Gene to Protein Transcription and Translation i A gene is a segment of DNA that provides the instructions for making a protein. Proteins have many different

More information

Proofreading and Correction

Proofreading and Correction How about a mistake? Just as we make mistakes, so can the replication process Wrong bases may be inserted into the new DNA Nucleotide bases may be damaged (ie. By radiation) When this happens, mutations

More information

Arguments of Evolution Mutations and Natural Selection

Arguments of Evolution Mutations and Natural Selection Does Nature Have the Power to Create New Biological Forms? Arguments of Evolution Mutations and Natural Selection Dr. Raúl Esperante Geoscience Research Institute Loma Linda Darwin s evolution In Darwin

More information

Physical Anthropology 1 Milner-Rose

Physical Anthropology 1 Milner-Rose Physical Anthropology 1 Milner-Rose Chapter 3 Genetics: Reproducing Life and Producing Variation Our Origins By Clark Spencer Larsen Natural Selection operates on the levels of the 1. living, behaving

More information

Biology From gene to protein

Biology From gene to protein Biology 205 5.3.06 From gene to protein Shorthand abbreviation of part of the DNA sequence of the SRY gene >gi 17488858 ref XM_010627.4 Homo sapiens SRY (sex determining region Y chromosome) GGCATGTGAGCGGGAAGCCTAGGCTGCCAGCCGCGAGGACCGCACGGAGGAGGAGCAGG

More information

2 nd Term Final. Revision Sheet. Students Name: Grade: 9 A/B. Subject: Biology. Teacher Signature. Page 1 of 12

2 nd Term Final. Revision Sheet. Students Name: Grade: 9 A/B. Subject: Biology. Teacher Signature. Page 1 of 12 2 nd Term Final Revision Sheet Students Name: Grade: 9 A/B Subject: Biology Teacher Signature Page 1 of 12 Nour Al Maref International School Riyadh, Saudi Arabia Biology Worksheet (2 nd Term) Chapter-7

More information

Subterm 2 Final Review Guide

Subterm 2 Final Review Guide Name: Date: Period: Subterm 2 Final Review Guide *** This review guide is only some of what you should know for the final. Make sure you study ALL of your notes and any diagrams that are appropriate (Pedigrees,

More information

Name: Review HW 20 Mendelian Genetics and Humn Inheritance

Name: Review HW 20 Mendelian Genetics and Humn Inheritance Name: Review HW 20 Bio AP Mendelian Genetics and Humn Inheritance 1. Four genes on a chromosome C are mapped and their crossover frequencies were determined. Genes Crossover Frequency K and J 10 J and

More information

Chapter Extending Mendelian Genetics. Incomplete Dominance. Incomplete Dominance. R = red R = white. Incomplete Dominance (alt)

Chapter Extending Mendelian Genetics. Incomplete Dominance. Incomplete Dominance. R = red R = white. Incomplete Dominance (alt) female / eggs Colonie High AP Biology Chapter 12.2 12.3 Beyond Mendel s Laws of Inheritance Etending Mendelian Genetics Mendel worked with a simple system peas are genetically simple most traits are controlled

More information