Rapid differentiation of human pluripotent stem cells into functional motor neurons by
|
|
|
- Mae Marsh
- 5 years ago
- Views:
Transcription
1 Supplementary Information Rapid differentiation of human pluripotent stem cells into functional motor neurons by mrnas encoding transcription factors Sravan Kumar Goparaju, Kazuhisa Kohda, Keiji Ibata, Atsumi Soma, Yukhi Nakatake, Tomohiko Akiyama, Shunichi Wakabayashi, Misako Matsushita, Miki Sakota, Hiromi Kimura, Michisuke Yuzaki, Shigeru B.H. Ko and Minoru S.H. Ko Supplementary tables Table S1 provides the electrophysiological characteristics of syn- 5TFs-derived neurons (day10) from TkDA3-4 ips cells; Table S2 provides the list of primers used for Reverse Transcription-PCR and Tail-PCR; Table S3 provides the list of antibodies, their sources, and dilutions used. Supplementary Figures Fig. S1 shows the kinetics of NGN2 protein expression in TkDA3-4 ips cells ectopically expressing syn-ngn2 mrna; Fig. S2 shows the induction of neurogenesis by syn-tf mrnas of Neurogenins and NeuroD families in human ES cells; Fig. S3a-b show the original blots of time course of NGN2 (and β-actin loading control) protein expression in lysates of human ES cells transfected with syn-ngn2 mrna (corresponding to Figure 1c); Fig. S4a-b show the original blots of time course of Emerald (and β-actin loading control) protein expression in lysates of human ES cells transfected with syn-emerald mrna (corresponding to Figure 1d); Fig. S5. qpcr analyses of motor neuron markers in human ips-derived neurons. Supplementary Movie M1 depicts the calcium transients in neuronal cells derived from ips cells. 1
2 Supplementary Table S1: Electrophysiological characteristics of syn-5tfs-derived neurons (Day10) from TkDA3-4 ips cells # of action potentials Resting membrane Rm Capacitance total potential (mv) (MΩ) (pf) n (%) 35 (100) 2 (5.7) 12 (34.3) 21 (60.0) ± ± ± 1.4 Data represent mean ± SEM. 2
3 Supplementary Table S2: Primers used in this study: For RT-PCR Gene Forward Primer (5 3 ) Reverse Primer (5 3 ) GAPDH ChAT HB9 Tail PCR GGTGGTCTCCTCTGA CTTCAACA ACTGGGTGTCTGAGT ACTGG CCTAAGATGCCCGA CTTCAACTC TAATACGACTCACTA TAGGG TTGGACCCTCGTACA GAAGCT GTGGTCGTTGAGGGCAATG TTGGAAGCCATTTTGACTAT GCCTTTTTGCTGCGTTTCCATTTC TTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTGCGTCGACACTAGTTCTAGA CCCTCACTTC Primers for QPCR Gene Forward Primer Reverse Primer ISL1 CAGGTTGTACGGGATCAAATGC CACACAGCGGAAACACTCGAT CHT1 AAGCCATCATAGTTGGTGGCCGAG AAGCCATCATAGTTGGTGGCCGAG HB9 GCACCAGTTCAAGCTCAACA TTTGCTGCGTTTCCATTTC ChAT TCATTAATTTCCGCCGTCTC GAGTCCCGGTTGGTGGAGT 3
4 Supplementary Table S3: Antibodies used in this study: Antibody Source Catalog # Dilution Species β-actin (13E5) CST :2000 Rabbit βiii-tubulin neuron spec. SDL.3D10 Sigma T8660 1:1500 Mouse βiii-tubulin CST :1000 Rabbit ChAT Millipore AB143 1:1000 Rabbit E-Cadherin (24E10) CST :500 Rabbit GFP (mix of 7.1 and 13.1 clones) Roche :1000 Mouse HB9 DSHB 81.5C10-s 1:50 Mouse ISL1 Abcam :1000 Rabbit Ki67 CST :1000 Rabbit MAP2 Sigma HM-2 1:1000 Mouse NeuN, Clone A60 Millipore MAB377 1:1000 Mouse NEUROGENIN2 CST :1000 Rabbit POU5F1 (OCT3/4) SCBT sc :1000 Mouse 4
5 0 min 20 min 30 min 40 min 50 min 60 min 90 min 120 min Supplementary Figure S1. Kinetics of NGN2 protein expression in TkDA3-4 ips cells ectopically expressing syn-ngn2 mrna. NGN2 protein expression was determined by using an antibody against NGN2. Nuclei (blue); NGN2 (pink). Scale bar indicates 200 µm. 5
6 Control ND1 ND2 NGN1 NGN2 NGN3 Supplementary Figure S2. Induction of neurogenesis by syn-tf mrnas of Neurogenins and NeuroD families in human ES cells. Neuronal differentiation induced by syn-mrnas encoding NeuroD1 (ND1), NeuroD2 (ND2), Neurogenin1 (NGN1), Neurogenin2 (NGN2), Neurogenin3 (NGN3) in SEES3 human ES cells at Day 7. Expression of neuron-specific βiii-tubulin (TUBB3) was measured by immunocytochemistry. Scale bars indicate 200 µm. 6
7 M hours Supplementary Figure S3a. Original blot of time course of NGN2 protein expression in lysates of human ES cells transfected with syn-ngn2 mrna (corresponding to upper panel of Figure 1c). M indicates molecular weight markers. NGN2 protein is indicated by an arrowhead. M hours Supplementary Figure S3b. Original blot of time course of β-actin protein expression (used as a loading control) in lysates of human ES cells transfected with syn-ngn2 mrna (corresponding to upper panel of Figure 1c). Stripped blot in Supplementary figure S3a was reprobed with an antibody against β-actin Left most lane shows molecular weight markers. β-actin protein is indicated by an arrowhead M indicates molecular weight markers. β-actin protein is indicated by an arrowhead. 7
8 M hours Supplementary Figure S4a. Original blot of time course of Emerald protein expression in lysates of human ES cells transfected with syn-emerald mrna (corresponding to upper panel of Figure 1d). M indicates molecular weight markers. Emerald protein is indicated by an arrowhead. M hours Supplementary Figure S4b. Original blot of time course of β-actin protein expression (used as a loading control) in lysates of human ES cells transfected with syn-emerald mrna (corresponding to lower panel of Figure 1d). Stripped blot in Supplementary figure S4a was reprobed with an antibody against β-actin Left most lane shows molecular weight markers. β-actin protein is indicated by an arrowhead. 8
9 Relative expression Relative expression Relative expression Relative expression ISL1 ChAT HB9 CHT Supplementary Figure S5. Quantitative RT-PCR (qpcr) analyses of motor neuron markers in human ips-derived neurons. qpcr was carried out using cdnas obtained from undifferentiated or syn-5tfs differentiated TkDA3-4 human ips cells at various time points. GAPDH was used as a reference gene and the mean of duplicate samples normalized to GAPDH expression was calculated. Relative expression to control TkDA3-4 human ips cells (Day 0) is shown. 9
10 Supplementary movie M1 Supplementary Movie M1. Movie depicting the calcium transients in syn-5tfs cocktailinduced neuronal cells (Day 7). Fluo-4 loaded cells stimulated with 40 Hz pulse. Uploaded as a separate Movie file. 10
Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and
Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and SSEA4 after 10 passages in mtesr 1 medium. (b) Schematic
Nature Biotechnology: doi: /nbt Supplementary Figure 1. Generation of NSCs from hpscs in SDC medium.
Supplementary Figure 1 Generation of NSCs from hpscs in SDC medium. (a) Q-PCR of pluripotent markers (OCT4, NANOG), neural markers (SOX1, PAX6, N-Cadherin), markers for the other germ layers (T, EOMES,
0.9 5 H M L E R -C tr l in T w is t1 C M
a. b. c. d. e. f. g. h. 2.5 C elltiter-g lo A ssay 1.1 5 M T S a s s a y Lum inescence (A.U.) 2.0 1.5 1.0 0.5 n s H M L E R -C tr l in C tr l C M H M L E R -C tr l in S n a il1 C M A bsorbance (@ 490nm
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION DOI: 1.138/NMAT3777 Biophysical regulation of epigenetic state and cell reprogramming Authors: Timothy L. Downing 1,2, Jennifer Soto 1,2, Constant Morez 2,3,, Timothee Houssin
HPV E6 oncoprotein targets histone methyltransferases for modulating specific. Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu,
1 HPV E oncoprotein targets histone methyltransferases for modulating specific gene transcription 3 5 Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu, Cheng-Ming Chiang, Sheng-Chung
(a) Immunoblotting to show the migration position of Flag-tagged MAVS
Supplementary Figure 1 Characterization of six MAVS isoforms. (a) Immunoblotting to show the migration position of Flag-tagged MAVS isoforms. HEK293T Mavs -/- cells were transfected with constructs expressing
Supplementary Data. Supplementary Table S1.
Supplementary Data Supplementary Table S1. Primer Sequences for Real-Time Reverse Transcription-Polymerase Chain Reaction Gene Forward 5?3 Reverse 3?5 Housekeeping gene 36B4 TCCAGGCTTTGGGCATCA CTTTATCAGCTGCACATCACTCAGA
Regulation of axonal and dendritic growth by the extracellular calcium-sensing
Regulation of axonal and dendritic growth by the extracellular calcium-sensing receptor (CaSR). Thomas N. Vizard, Gerard W. O Keeffe, Humberto Gutierrez, Claudine H. Kos, Daniela Riccardi, Alun M. Davies
Resveratrol inhibits epithelial-mesenchymal transition of retinal. pigment epithelium and development of proliferative vitreoretinopathy
Resveratrol inhibits epithelial-mesenchymal transition of retinal pigment epithelium and development of proliferative vitreoretinopathy Keijiro Ishikawa, 1,2 Shikun He, 2, 3 Hiroto Terasaki, 1 Hossein
Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of
Supplementary Information Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of Syntaxin 1 and SNAP-25 in Neuron Survival Lisheng Peng, Huisheng Liu, Hongyu Ruan, William H. Tepp, William H. Stoothoff,
(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower
Supplementary Figures S1. (A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: ; lower arrow: KO) and (B) q-pcr analysis with Lin- cells, The white vertical line in panel A indicates that
Sarker et al. Supplementary Material. Subcellular Fractionation
Supplementary Material Subcellular Fractionation Transfected 293T cells were harvested with phosphate buffered saline (PBS) and centrifuged at 2000 rpm (500g) for 3 min. The pellet was washed, re-centrifuged
Supplementary figures (Zhang)
Supplementary figures (Zhang) Supplementary figure 1. Characterization of hesc-derived astroglia. (a) Treatment of astroglia with LIF and CNTF increases the proportion of GFAP+ cells, whereas the percentage
Supplementary information for: Ten-Eleven Translocation-2 (Tet2) Is Involved in Myogenic Differentiation of Skeletal Myoblast Cells in
Supplementary information for: Ten-Eleven Translocation-2 (Tet2) Is Involved in Myogenic Differentiation of Skeletal Myoblast Cells in Vitro Xia Zhong*, Qian-Qian Wang*, Jian-Wei Li, Yu-Mei Zhang, Xiao-Rong
MeCP2. MeCP2/α-tubulin. GFP mir1-1 mir132
Conservation Figure S1. Schematic showing 3 UTR (top; thick black line), mir132 MRE (arrow) and nucleotide sequence conservation (vertical black lines; http://genome.ucsc.edu). a GFP mir1-1 mir132 b GFP
Stargazin regulates AMPA receptor trafficking through adaptor protein. complexes during long term depression
Supplementary Information Stargazin regulates AMPA receptor trafficking through adaptor protein complexes during long term depression Shinji Matsuda, Wataru Kakegawa, Timotheus Budisantoso, Toshihiro Nomura,
SUPPLEMENTARY INFORMATION. Prolyl isomerase Pin1 and protein kinase HIPK2 cooperate to promote
SUPPLEMENTARY INFORMATION Prolyl isomerase Pin1 and protein kinase HIPK2 cooperate to promote cortical neurogenesis by suppressing Groucho/TLE:Hes1-mediated inhibition of neuronal differentiation Running
Supplemental material
Supplemental material THE JOURNAL OF CELL BIOLOGY Taylor et al., http://www.jcb.org/cgi/content/full/jcb.201403021/dc1 Figure S1. Representative images of Cav 1a -YFP mutants with and without LMB treatment.
SUPPLEMENTARY INFORMATION
doi:.38/nature08267 Figure S: Karyotype analysis of ips cell line One hundred individual chromosomal spreads were counted for each of the ips samples. Shown here is an spread at passage 5, predominantly
Nature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Schematic and results of screening the combinatorial antibody library for Sox2 replacement activity. A single batch of MEFs were plated and transduced with doxycycline inducible
supplementary information
DOI: 10.1038/ncb1977 Figure S1 a. Immunofluorescence analysis of IFT20 localization in PBL costained with anti-β-tubulin antibodies. b. Immunofluorescence analysis of IFT20 localization in Jurkat cells,
Supplementary Data. Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells
Supplementary Data Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells Mouse induced pluripotent stem cells (ipscs) were cultured
Supplemental Information Control of apico-basal epithelial polarity by the microtubule minus-end binding protein CAMSAP3 and spectraplakin ACF7
Supplemental Information Control of apico-basal epithelial polarity by the microtubule minus-end binding protein CAMSAP3 and spectraplakin ACF7 Ivar Noordstra, Qingyang Liu, Wilco Nijenhuis, Shasha Hua,
gacgacgaggagaccaccgctttg aggcacattgaaggtctcaaacatg
Supplementary information Supplementary table 1: primers for cloning and sequencing cloning for E- Ras ggg aat tcc ctt gag ctg ctg ggg aat ggc ttt gcc ggt cta gag tat aaa gga agc ttt gaa tcc Tpbp Oct3/4
all samples of a band with a molecular weight close to that expected for the endogenous!-
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1 : Specificity of anti-!-arrestin Abs and levels of!-arrestin in WHIM wt leukocytes. (A and B) HEK 293T cells were transiently transfected using the reagent
monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal antibody was examined in
Supplementary information Supplementary figures Supplementary Figure 1 Determination of the s pecificity of in-house anti-rhbdd1 mouse monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
Supplementary Figure 1
Supplementary Figure 1 Virus infection induces RNF128 expression. (a,b) RT-PCR analysis of Rnf128 (RNF128) mrna expression in mouse peritoneal macrophages (a) and THP-1 cells (b) upon stimulation with
Supplementary Figure Legends
Supplementary Figure Legends Figure S1 gene targeting strategy for disruption of chicken gene, related to Figure 1 (f)-(i). (a) The locus and the targeting constructs showing HpaI restriction sites. The
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation
Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured
Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured in 90-Pa 3D fibrin gels for 5 days in the presence
Supplementary Figure S1: (A) Schematic representation of the Jarid2 Flox/Flox
Supplementary Figure S1: (A) Schematic representation of the Flox/Flox locus and the strategy used to visualize the wt and the Flox/Flox mrna by PCR from cdna. An example of the genotyping strategy is
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/3/11/e1701679/dc1 Supplementary Materials for Directed differentiation of human pluripotent stem cells to blood-brain barrier endothelial cells Tongcheng Qian,
Supplementary Figure 1.
Supplementary Figure 1. (A) UCSC Genome Browser view of region immediately downstream of the NEUROG3 start codon. All candidate grna target sites which meet the G(N 19 )NGG constraint are aligned to illustrate
TRIM31 is recruited to mitochondria after infection with SeV.
Supplementary Figure 1 TRIM31 is recruited to mitochondria after infection with SeV. (a) Confocal microscopy of TRIM31-GFP transfected into HEK293T cells for 24 h followed with SeV infection for 6 h. MitoTracker
Supplementary Figure S1. The tetracycline-inducible CRISPR system. A) Hela cells stably
Supplementary Information Supplementary Figure S1. The tetracycline-inducible CRISPR system. A) Hela cells stably expressing shrna sequences against TRF2 were examined by western blotting. shcon, shrna
X2-C/X1-Y X2-C/VCAM-Y. FRET efficiency. Ratio YFP/CFP
FRET efficiency.7.6..4.3.2 X2-C/X1-Y X2-C/VCAM-Y.1 1 2 3 Ratio YFP/CFP Supplemental Data 1. Analysis of / heterodimers in live cells using FRET. FRET saturation curves were obtained using cells transiently
USP19 modulates autophagy and antiviral immune responses by. deubiquitinating Beclin-1
USP19 modulates autophagy and antiviral immune responses by deubiquitinating Beclin-1 Shouheng Jin 1,2,, Shuo Tian 1,, Yamei Chen 1,, Chuanxia Zhang 1,2, Weihong Xie, 1 Xiaojun Xia 3,4, Jun Cui 1,3* &
Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4
SUPPLEMENTARY FIGURE LEGENDS Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4 directly up-regulates the expression of NIPP1 and CCNF that together inhibit protein phosphatase
Biology Open (2015): doi: /bio : Supplementary information
Fig. S1. Verification of optimal conditions for the generation of LIF-dependent inscs Representative images (from five repeat experiments) of human primary fibroblasts undergoing reprogramming for 21 days
Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice
Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice Supplementary Material Supplementary Methods Materials Spironolactone, aldosterone and β-glycerophosphate were
Supporting Information
Supporting Information Stavru et al. 0.073/pnas.357840 SI Materials and Methods Immunofluorescence. For immunofluorescence, cells were fixed for 0 min in 4% (wt/vol) paraformaldehyde (Electron Microscopy
Supplementary Figure 1 a. d 0.8 CON LPS PAN. 2nd ab nephrin podocin CON LPS PAN. upar. -tubulin. upar. upar / -tubulin CON LPS PAN
Supplementary Figure 1 a Efferent arteriole Podocytes Afferent arteriole FP Endothelium GBM Glomerular filtration barrier b 188kD HEK + GFP HEK + GFP-Nphs1 Differentiated Podocytes HEK + GFP HEK + GFP-Nphs2
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Effect of timing of DE dissociation and RA concentration on lung field specification in hpscs. (a) Effect of duration of endoderm induction on expression of
A population of Nestin expressing progenitors in the cerebellum exhibits increased tumorigenicity
A population of Nestin expressing progenitors in the cerebellum exhibits increased tumorigenicity Peng Li 1,2, Fang Du 1, Larra W. Yuelling 1, Tiffany Lin 3, Renata E. Muradimova 1, Rossella Tricarico
Supplementary Information
Supplementary Information Supplementary Figure S1 (a) P-cRAF colocalizes with LC3 puncta. Immunofluorescence (IF) depicting colocalization of P-cRAF (green) and LC3 puncta (red) in NIH/3T3 cells treated
Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured
Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured under static conditions. Cells were seeded in the chamber area of the device and cultured overnight without medium perfusion.
Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1
Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1 a His-ORMDL3 ~ 17 His-ORMDL3 GST-ORMDL3 - + - + IPTG GST-ORMDL3 ~ b Integrated Density (ORMDL3/ -actin) 0.4 0.3 0.2 0.1
Isolation, culture, and transfection of primary mammary epithelial organoids
Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)
SUPPLEMENTARY INFORMATION. LIN-28 co-transcriptionally binds primary let-7 to regulate mirna maturation in C. elegans
SUPPLEMENTARY INFORMATION LIN-28 co-transcriptionally binds primary let-7 to regulate mirna maturation in C. elegans Priscilla M. Van Wynsberghe 1, Zoya S. Kai 1, Katlin B. Massirer 2-4, Victoria H. Burton
Primers used for PCR of conductin, SGK1 and GAPDH have been described in (Dehner et al,
Supplementary METHODS Flow Cytometry (FACS) For FACS analysis, trypsinized cells were fixed in ethanol, rehydrated in PBS and treated with 40μg/ml propidium iodide and 10μ/ml RNase for 30 min at room temperature.
Supplementary Figure 1: Expression of RNF8, HERC2 and NEURL4 in the cerebellum and knockdown of RNF8 by RNAi (a) Lysates of the cerebellum from rat
Supplementary Figure 1: Expression of RNF8, HERC2 and NEURL4 in the cerebellum and knockdown of RNF8 by RNAi (a) Lysates of the cerebellum from rat pups at P6, P14, P22, P30 and adult (A) rats were subjected
Supplementary Figure S1
Supplementary Figure S1 Supplementary Figure S1. CD11b expression on different B cell subsets in anti-snrnp Ig Tg mice. (a) Highly purified follicular (FO) and marginal zone (MZ) B cells were sorted from
p53 is activated in response to disruption of the pre-mrna splicing machinery.
p53 is activated in response to disruption of the pre-mrna splicing machinery. Nerea Allende-Vega, Saurabh Dayal, Usha Agarwala, Alison Sparks, Christophe Bourdon and Mark K. Saville. Jean- Supplementary
Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators.
Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators. (a) A graphic depiction of the approach to determining the stability of
Supplemental Table 1 Primers used in study. Human. Mouse
Supplemental Table 1 Primers used in study Human Forward primer region(5-3 ) Reverse primer region(5-3 ) RT-PCR GAPDH gagtcaacggatttggtcgt ttgattttggagggatctcg Raftlin atgggttgcggattgaacaagttaga ctgaggtataacaccaacgaatttcaggc
Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and
Determining positive selection gates for LRCs and nonlrcs Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and shape of the Gaussian distributions. For
Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
Supplementary Figure 1
Supplementary Figure 1 Supplementary Fig. 1 shrna mediated knockdown of ZRSR2 in K562 and 293T cells. (a) ZRSR2 transcript levels in stably transduced K562 cells were determined using qrt-pcr. GAPDH was
Supplementary information.
Supplementary information. Construction of JMJD3 plasmids and other vectors plasmid, pfksd346, encoding the ORF of human JMJD3 (KI346) was obtained from the Kazusa DN Research Institute, Japan. Sequence
Supplementary Figure 1. ips_3y+mir-302b. ips_3y+mir-372. ips_3y+mir-302b + mir-372. ips_4y. ips_4y+mir-302b. ips_4y + mir-372
Supplementary Figure 1 ips_3y+mir-32b ips_3y+ ips_3y+mir-32b + ips_4y ips_4y+mir-32b ips_4y + Nature Biotechnology: doi:1.138/nb.t.1862 TRA-1-6 DAPI Oct3/4 Supplementary Figure 1: ips cells derived from
J. Cell Sci. 128: doi: /jcs : Supplementary Material. Supplemental Figures. Journal of Cell Science Supplementary Material
Supplemental Figures Figure S1. Trio controls endothelial barrier function. (A) TagRFP-shTrio constructs were expressed in ECs. Western blot shows efficient Trio knockdown in TagRFP-expressing ECs. (B)
Supplementary Figure 1.
Supplementary Figure 1. Quantification of western blot analysis of fibroblasts (related to Figure 1) (A-F) Quantification of western blot analysis for control and IR-Mut fibroblasts. Data are expressed
Chemically defined conditions for human ipsc derivation and culture
Nature Methods Chemically defined conditions for human ipsc derivation and culture Guokai Chen, Daniel R Gulbranson, Zhonggang Hou, Jennifer M Bolin, Victor Ruotti, Mitchell D Probasco, Kimberly Smuga-Otto,
Supporting Online Material for
www.sciencemag.org/cgi/content/full/1154040/dc1 Supporting Online Material for Selective Blockade of MicroRNA Processing by Lin-28 Srinivas R. Viswanathan, George Q. Daley,* Richard I. Gregory* *To whom
Supplementary Information. A novel human endogenous retroviral protein inhibits cell-cell fusion. Supplementary Figures:
Supplementary Information A novel human endogenous retroviral protein inhibits cell-cell fusion Jun Sugimoto, Makiko Sugimoto, Helene Bernstein, Yoshihiro Jinno and Danny J. Schust Supplementary Figures:
SUPPLEMENTARY INFORMATION
(Supplementary Methods and Materials) GST pull-down assay GST-fusion proteins Fe65 365-533, and Fe65 538-700 were expressed in BL21 bacterial cells and purified with glutathione-agarose beads (Sigma).
Supplemental Figure 1
Supplemental Figure 1 A B 50 * 40 30 20 10 0 NeurofilamentM/βactin Relative expression control D neurogenic cond. PPARγ/ Relative expression C PPARγ Hprt OilRedO adipogenic cond. control 125 * 100 75 50
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified by primers used for mrna expression analysis. Gray
Supplemental Figure 1 (Figure S1), related to Figure 1 Figure S1 provides evidence to demonstrate Nfatc1Cre is a mouse line that directed gene
Developmental Cell, Volume 25 Supplemental Information Brg1 Governs a Positive Feedback Circuit in the Hair Follicle for Tissue Regeneration and Repair Yiqin Xiong, Wei Li, Ching Shang, Richard M. Chen,
Supplementary Figure 1. Adipogenic protein expression in WT and KO MEFs after 7 days of adipogenic differentiation.
Merkestein et al. Supplementary Figure 1 A PLIN WT FTO KO 72 kda FABP4 17 kda HSC70 72 kda B Supplementary Figure 1. Adipogenic protein expression in WT and KO MEFs after 7 days of adipogenic differentiation.
Supporting Information
Supporting Information Tal et al. 10.1073/pnas.0807694106 SI Materials and Methods VSV Infection and Quantification. Infection was carried out by seeding 5 10 5 MEF cells per well in a 6-well plate and
Stabilization of the Transcription Factor Foxp3 by the Deubiquitinase USP7 Increases Treg-Cell-Suppressive Capacity
Immunity, Volume 39 Supplemental Information Stabilization of the Transcription Factor Foxp3 by the Deubiquitinase USP7 Increases Treg-Cell-Suppressive Capacity Jorg van Loosdregt, Veerle Fleskens, Juan
SUPPLEMENTARY FIGURES AND VIDEOS
SUPPLEMENTARY FIGURES AND VIDEOS Supplementary Figure 1. Generation of Human Intestinal Organoids (HIOs). (a) Method for generating HIOs through directed differentiation of human pluripotent stem cells.
GENESDEV/2007/ Supplementary Figure 1 Elkabetz et al.,
GENESDEV/2007/089581 Supplementary Figure 1 Elkabetz et al., GENESDEV/2007/089581 Supplementary Figure 2 Elkabetz et al., GENESDEV/2007/089581 Supplementary Figure 3 Elkabetz et al., GENESDEV/2007/089581
Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated
Supplementary Figure Legends Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated with either vehicle (left; n=3) or CCl 4 (right; n=3) were co-immunostained for NRP-1 (green)
SUPPLEMENTARY FIG. S9. Morphology and DNA staining of cipsc-differentiated trophoblast cell-like cell. Scale bar: 100 mm. SUPPLEMENTARY FIG. S10.
Supplementary Data SUPPLEMENTARY FIG. S1. Lentivirus-infected canine fibroblasts show YFP expression. (A, B) Uninfected canine skin fibroblasts (CSFs); (C, D) infected CSFs; (E, F) uninfected CTFs; (G,
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. Functional assays of hepatocyte-like cells induced from H1 hescs (a) P450 and AAT staining, PAS staining, LDL uptake assay, and ICG uptake and release assay
Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas.
Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Target Gene Non-target / Control BTG2 BRCA1 NFE2L2 Target Sequence ON-TARGET plus Non-targeting sirna # 1 (Cat# D-001810-01-05) sirna1: GAACCGACAUGCUCCCGGA
PI3K/mTORC2 regulates TGFβ/Activin signalling by modulating Smad2/3
Supplementary Information PI3K/mTORC2 regulates TGFβ/Activin signalling by modulating Smad2/3 activity via linker phosphorylation Jason S.L. Yu, 1 Thamil Selvee Ramasamy, 1,2 Nick Murphy, 1 Marie Holt,
Electromagnetic Fields Mediate Efficient Cell Reprogramming Into a Pluripotent State
Electromagnetic Fields Mediate Efficient Cell Reprogramming Into a Pluripotent State Soonbong Baek, 1 Xiaoyuan Quan, 1 Soochan Kim, 2 Christopher Lengner, 3 Jung- Keug Park, 4 and Jongpil Kim 1* 1 Lab
Sox9 and NFIA Coordinate a Transcriptional Regulatory
Neuron, Volume 74 Supplemental Information Sox9 and NFIA Coordinate a Transcriptional Regulatory Cascade during the Initiation of Gliogenesis Peng Kang, Hyun Kyoung Lee, Stacey Glasgow, Meggie Finley,
hnrnp C promotes APP translation by competing with FMRP for APP mrna recruitment to P bodies
hnrnp C promotes APP translation by competing with for APP mrna recruitment to P bodies Eun Kyung Lee 1, Hyeon Ho Kim 1, Yuki Kuwano 1, Kotb Abdelmohsen 1, Subramanya Srikantan 1, Sarah S. Subaran 2, Marc
Inhibition of Twist1 mediated invasion by Chk2 promotes premature senescence in p53 defective cancer cells
Inhibition of Twist1 mediated invasion by Chk2 promotes premature senescence in p53 defective cancer cells Debasis Nayak, a,1 Anmol Kumar, b Souneek Chakraborty, a,1 Reyaz ur Rasool, a,1 Hina Amin, a Archana
Supplementary Table S1
Primers used in RT-qPCR, ChIP and Bisulphite-Sequencing. Quantitative real-time RT-PCR primers Supplementary Table S1 gene Forward primer sequence Reverse primer sequence Product TRAIL CAACTCCGTCAGCTCGTTAGAAAG
Regulation of Synaptic Structure and Function by FMRP- Associated MicroRNAs mir-125b and mir-132
Neuron, Volume 65 Regulation of Synaptic Structure and Function by FMRP- Associated MicroRNAs mir-125b and mir-132 Dieter Edbauer, Joel R. Neilson, Kelly A. Foster, Chi-Fong Wang, Daniel P. Seeburg, Matthew
Generation of ips-derived model cells for analyses of hair shaft differentiation
Supplementary Material Generation of ips-derived model cells for analyses of hair shaft differentiation Takumi Kido, Tomoatsu Horigome, Minori Uda, Naoki Adachi, Yohei Hirai Department of Biomedical Chemistry,
A novel tool for monitoring endogenous alpha-synuclein transcription by NanoLuciferase
A novel tool for monitoring endogenous alpha-synuclein transcription by NanoLuciferase tag insertion at the 3 end using CRISPR-Cas9 genome editing technique Sambuddha Basu 1, 3, Levi Adams 1, 3, Subhrangshu
Fig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector.
Fig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector. (a) Western blotting analysis and (b) qpcr analysis of eif6 expression in HEK293 T cells transfected with either
Supplementary Figure S1 Evi/Wls and Wnt3 are overexpressed in epithelial cells in colon cancers. (a) Validation of the specificity of the Wnt3
Supplementary Figure S1 Evi/Wls and Wnt3 are overexpressed in epithelial cells in colon cancers. (a) Validation of the specificity of the Wnt3 antibody. HCT116 cells were reverse transfected with sicontrol
Firefly luciferase mutants as sensors of proteome stress
Nature Methods Firefly luciferase mutants as sensors of proteome stress Rajat Gupta, Prasad Kasturi, Andreas Bracher, Christian Loew, Min Zheng, Adriana Villella, Dan Garza, F Ulrich Hartl & Swasti Raychaudhuri
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: Supplementary Figure 1. dcas9-mq1 fusion protein induces de novo
Supplementary Materials for
www.advances.sciencemag.org/cgi/content/full/1/7/e1500454/dc1 Supplementary Materials for CRISPR-Cas9 delivery to hard-to-transfect cells via membrane deformation Xin Han, Zongbin Liu, Myeong chan Jo,
Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days,
Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days, respectively, and their mrnas were quantified by real time
Translation of HTT mrna with expanded CAG repeats is regulated by
Supplementary Information Translation of HTT mrna with expanded CAG repeats is regulated by the MID1-PP2A protein complex Sybille Krauß 1,*, Nadine Griesche 1, Ewa Jastrzebska 2,3, Changwei Chen 4, Désiree
Artificial niche microarrays for probing single-stem-cell fate in high throughput
Nature Methods Artificial niche microarrays for probing single-stem-cell fate in high throughput Samy Gobaa, Sylke Hoehnel, Marta Roccio, Andrea Negro, Stefan Kobel & Matthias P Lutolf Supplementary Figure
Supplemental Figure 1. The parthenogenetic activation of oocytes recovered from oviducts of gcnrg1 KO mice and wild type mice.
% (a) MII AII Pronucleus (b) 3 F-Actin / Tubulin / DAPI 1 WT KO Supplemental Figure 1. The parthenogenetic activation of oocytes recovered from oviducts of gcnrg1 KO mice and wild type mice. (a) Triple
SUPPLEMENTAL MATERIAL. Carvajal et al. Supplemental Table 1. List of quantitative PCR primers used for cdna analyses and
UPPLEMEAL MATERIAL Carvajal et al. upplemental Table 1. List of quantitative PCR primers used for cdna analyses and chromatin immunoprecipitation assays. Figure 1. DNA damage-induced transcriptional repression
Supplemental Figure 1 Human REEP family of proteins can be divided into two distinct subfamilies. Residues (single letter amino acid code) identical
Supplemental Figure Human REEP family of proteins can be divided into two distinct subfamilies. Residues (single letter amino acid code) identical in all six REEPs are highlighted in green. Additional
Nature Methods: doi: /nmeth Supplementary Figure 1. Schematics of SAM, dcas9-suntag and dcas9-vpr.
Supplementary Figure 1 Schematics of SAM, dcas9-suntag and dcas9-vpr. (a) Schematics of SAM. SAM consists of two chimeric proteins, dcas9 fused with VP64 and MS2-coat protein fused with p65 and HSF1 activator