|
|
|
- Milo Stephens
- 6 years ago
- Views:
Transcription
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23 Supplemental Tables Supplemental Table 1. Phenotypic profile of different HSC lines. Marker d0 mhsc d7 mhsc 8B LX2 CD11b 3.61% 2.21% 2.16% 3.77% F4/ % 2.05% 0.127% 1.44% Elastin 3.90% 2.95% 4.23% 3.30% FOXM1 98.7% 96.9% 99.7% 98.6% OPN 79.5% 80.8% 95.2% 92.9% MDR % 55.55% 4.02% 3.26% EPCAM 4.64% 9.34% 2.17% 3.30% CD % 24.36% 3.01% 5.03% FoxA2 90.0% 90.9% nd nd nd=not determined
24 Supplemental Table 2: Antibodies used for FACS analysis Name Host / isotype Source Catalog No. Desmin Rabbit IgG Abcam ab15200 Desmin Mouse IgG1 Abcam ab6322 ASMA (α-smooth muscle actin) ASMA (α-smooth muscle actin) GFAP (Glial fibrillary acidic protein) PPARϒ (Peroxisome proliferator-activated receptor gamma) Rabbit IgG Abcam ab32575 Mouse IgG2a DAKO M Rabbit IgG Sigma G4546 Rabbit IgG Abcam ab19481 Collagen Rabbit IgG Abcam ab292 Vimentin Rabbit IgG Novus Biologicals NBP Ki67 Rabbit IgG Abcam ab15580 Ptc (Patched 1) Goat IgG R&D Systems AF4105 Gli2 Rabbit IgG Genway Biotech HNF4α ( Hepatocyte nuclear factor 4 alpha) CEBPα ( CCAAT/enhancer binding protein alpha) Mouse IgG2a Abcam ab41898 Rabbit IgG Abcam ab40764 AFP (alpha-fetoprotein) Mouse IgG1 R&D Systems MAB1368 Krt8/18 (Cytokeratin 8+18) Mouse IgG1 Zymed Albumin Mouse IgG2a R&D Systems MAB1455 FN14 (Tweak receptor) Biotin Mouse IgG2b Nouvs Biologicals NBP Krt7 (Cytokeratin 7) Rabbit IgG Bioss bs-1744r Krt19 (Cytokeratin 19) HNF6 (Hepatocyte nuclear factor 6) Rat IgG2a Developmental Studies Hybridoma Bank TROMA-III-c Mouse IgG1 Abcam ab87420 SOX9 Rabbit IgG Millipore AB5535 Oct4 PE Rat IgG2a ebioscience Nanog Rabbit IgG Novus Biologicals NB
25 CD133 PE Rat IgG2a BioLegend CD44 PE Mouse IgG1 Abcam ab23396 CD44 PE Rat IgG2b BD Pharmingen CD24 Pacific Blue Rat IgG2b BioLegend CD11b FITC Rat IgG2b BioLegend F4/80 PE Rat IgG2a BioLegend Elastin Rabbit IgG Cedarlane Laboratories CL55041AP FOXM1 Mouse IgG2b Nouvs Biologicals H M02 MDR2 (Multidrug resistance protein 3) Mouse IgG2b Abcam ab24108 EPCAM (Epithelial cell adhesion molecule ) - PE Mouse IgG1 Abcam ab EPCAM PE Rat IgG2a BioLegend FOXA2 Mouse IgG2a Abcam ab60721
26 Supplemental Table 3. Sequence of primers used Gene Forward sequence Reverse Sequence AFP TCGTATTCCAACAGGAGG AGGCTTTTGCTTCACCAG Albumin GTGAGATCGCCCATCGGTA ACTCATCGGCAACACACGTC αsma GATGAAGCCCAGAGCAAGAG CTTTTCCATGTCGTCCCAGT BMP7 GTGGTCAACCCTCGGCACA GGCGTCTTGGAGCGATTCTG CD24 CAGGCAAATATGCAAAGGAGC CACATCCCAAATGCTGGGTT CD133 AGGAGATTGCCCTCTATGAGATCGG GCAGCCCACCAGAGGCATGA Col1α1 GAGCGGAGAGTACTGGATCG GCTTCTTTTCCTTGGGGTTC Cre TCTGGCAGTAAAAACTATCC ACAGCATTGCTGTCACTTGG CyclinD1 TAGGCCCTCAGCCTCACT CCACCCCTGGGATAAAGCAC Desmin TACACCTGCGAGATTGATGC ACATCCAAGGCCATCTTCAC Desmoplakin GCTGCACCGTCAACGACCA GCTGCATCCCTTCTCCGAATTT E-Cadherin GCCACCAGATGATGATACCC GCTGGCTCAAATCAAAGTCC Elastin TGGTATTGGTGGCATCGGTG AACTTTCCCAGGCTTTCCTCC FN14 GTGTTGGGATTCGGCTTGGT CCAGGCAGAAGTCGCTGTG FOXM1 CCCAAAGCCCAAGAAGTCCT ATCGGCTCACCTCCCTTTTC GAPDH GACCCCTTCATTGACCTCAAC CTTCTCCATGGTGGTGAAGA GFAP AGAACAACCTGGCTGCGTAT CCAGCGATTCAACCTTTCTC GLI1 CCTCCTCCTCTCATTCCACA CTCCCACAACAATTCCTGCT GLI2 CCCCATCACCATTCATAAGC CTGCTCCTGTGTCAGTCCAA HNF4α TCAACGACCGGCAGTACGAC CTGGCAGACCCTCCGAGAAG HNF6 ACTCAAGTCGGGTCGGGAGA TGGAGCCGCCCTCGTC IKKβ (wt) GTCATTTCCACAGCCTGA CCTTGTCCTATAGAAGCACAA IKKβ (mut) TAGTCCAACTGGCAGCGAATAC CGCCTAGGTAAGTGGCTGTCT Krt7 TAGAGTCCAGCATCGCAGAG CACAGGTCCCATTCCGTC Krt8/18 CGCCTGGCCAGCTACCTA GAGCCCTCAGGTCTTCGATG Krt19 CATGGTTCTTCTTCAGGTAGGC GCTGCAGATGACTTCAGAACC Nanog CTATCGCCTTGAGCCGTTGGCCT GAAGCAAGTGAGCCGCAGCCTT Oct4 GTGAGCCGTCTTTCCACCAGGC TGGTGGGGGTGAGAAGGCGAAG Osteopontin CTCCATCGTCATCATCATCG TGCACCCAGATCCTATAGCC Patch ATGCTCCTTTCCTCCTGAAACC TGAACTGGGCAGCTATGAAGTC PPARϒ AGGCCGAGAAGGAGAAGCTGTTG TGGCCACCTCTTTGCTCTGCTC ROSA/mut(Δflx) GGAGCGGGAGAAATGGATATG TCGACGGTATCGATAAGCTAG ROSA/flx GGAGCGGGAGAAATGGATATG AAGACCGCGAAGAGTTTGTC S9 GGGCCTGAAGATTGAGGATT CGGGCATGGTGAATAGATTT sfrp1 TACCACGGAAGCCTCTAAGC TCGCTTGCACAGAGATGTTC SOX9 CAGCAAGAACAAGCCACACGTCAA TTGTCCGTTCTTCACCGACTTCCT Smo GTCACTGTCCTCATCCCCTT CAAAACAGATGCCACTCACG Smo c /Smo n GAGGCCTGAGCCTTTTCTTT GAGCTTGGGTCACGTGTCCGGCAG SNAIL GAGGACAGTGGCAAAAGCTC TCGGATGTGCATCTTCAGAG Vimentin GCTTCTCTGGCACGTCTTGA CGCAGGGCATCGTTGTTC
SUPPLEMENTARY INFORMATION. Integrin alpha 11 in regulation of myofibroblasts phenotype: Implication for fibrotic diseases
SUPPLEMENTARY INFORMATION Integrin alpha 11 in regulation of myofibroblasts phenotype: Implication for fibrotic diseases Ruchi Bansal 1, Shigeki Nakagawa 2, Saleh Yazdani 1, Joop van Baarlen 3, Anu Venkatesh
Supplementary Fig. 1. Isolation and in vitro expansion of EpCAM + cholangiocytes. For collagenase perfusion, enzyme solution was injected from the
Supplementary Fig. 1. Isolation and in vitro expansion of EpCAM + cholangiocytes. For collagenase perfusion, enzyme solution was injected from the portal vein for digesting adult livers, whereas it was
The following fluorochrome-conjugated antibodies were used: FITC and Alexa Fluor 700
Flow cytometry analysis and cell sorting The following fluorochrome-conjugated antibodies were used: FITC and Alexa Fluor 700 anti-cd5. (), APC-Cy7 anti-epcam (G.; Biolegend, San Diego, CA), PE-Cy7 anti-cd31
Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and
Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and SSEA4 after 10 passages in mtesr 1 medium. (b) Schematic
ELISPOT and FLUOROSPOT kits
ELISPOT and FLUOROSPOT kits Interleukins Interferons Granzymes and perforins TNF superfamily ligands and receptors Apoptosis markers And many more... ELISPOT and FLUOROSPOT: a cell-based assay to assess
H3K27me3 Does Not Orchestrate the Expression of Lineage-Specific
Stem Cell Reports, Volume 7 Supplemental Information H3K27me3 Does Not Orchestrate the Expression of Lineage-Specific Markers in hesc-derived Hepatocytes In Vitro Jolien Vanhove, Mariaelena Pistoni, Marc
Cycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney
1 Supplementary text and data for: 2 3 4 5 Cycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney Authors: David A. D. Munro 1*, Peter Hohenstein 2, and Jamie A.
Title. CitationThe Journal of clinical investigation, 124(5): Issue Date Doc URL. Type. Additional There Information
Title Laminins affect T cell trafficking and allograft fat Author(s)Warren, Kristi J.; Iwami, Daiki; Harris, Donald G.; CitationThe Journal of clinical investigation, 124(): 224- Issue Date 214--1 Doc
Smoothened is a master regulator of adult liver repair
Research article Smoothened is a master regulator of adult liver repair Gregory A. Michelotti, 1 Guanhua Xie, 1 Marzena Swiderska, 1 Steve S. Choi, 1 Gamze Karaca, 1 Leandi Krüger, 1 Richard Premont, 1
SynAbs S.A. Driving mab innovation for the IVD & BioPharma R&D markets
SynAbs S.A. Driving mab innovation for the IVD & BioPharma R&D markets February 20, 2016 SynAbs in a nutshell (1/2) Rat monoclonal antibodies, service and catalog Innovative guinea pig monoclonals! Mouse
Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl
Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl, loxp sites flanking exons 3-6 (red arrowheads) were introduced into
Supplemental Information Inventory
Cell Stem Cell, Volume 6 Supplemental Information Distinct Hematopoietic Stem Cell Subtypes Are Differentially Regulated by TGF-β1 Grant A. Challen, Nathan C. Boles, Stuart M. Chambers, and Margaret A.
GENESDEV/2007/ Supplementary Figure 1 Elkabetz et al.,
GENESDEV/2007/089581 Supplementary Figure 1 Elkabetz et al., GENESDEV/2007/089581 Supplementary Figure 2 Elkabetz et al., GENESDEV/2007/089581 Supplementary Figure 3 Elkabetz et al., GENESDEV/2007/089581
Int. J. Mol. Sci. 2016, 17, 1259; doi: /ijms
S1 of S5 Supplementary Materials: Fibroblast-Derived Extracellular Matrix Induces Chondrogenic Differentiation in Human Adipose-Derived Mesenchymal Stromal/Stem Cells in Vitro Kevin Dzobo, Taegyn Turnley,
Mayumi Egawa, Kaori Mukai, Soichiro Yoshikawa, Misako Iki, Naofumi Mukaida, Yohei Kawano, Yoshiyuki Minegishi, and Hajime Karasuyama
Immunity, Volume 38 Supplemental Information Inflammatory Monocytes Recruited to Allergic Skin Acquire an Anti-inflammatory M2 Phenotype via Basophil-Derived Interleukin-4 Mayumi Egawa, Kaori Mukai, Soichiro
Supplemental Information. Tissue Mechanics Orchestrate Wnt-Dependent. Human Embryonic Stem Cell Differentiation
Cell Stem Cell, Volume 19 Supplemental Information Tissue Mechanics Orchestrate Wnt-Dependent Human Embryonic Stem Cell Differentiation Laralynne Przybyla, Johnathon N. Lakins, and Valerie M. Weaver Supplemental
Initial genotyping of all new litters was performed by Transnetyx (Memphis,
SUPPLEMENTAL INFORMATION MURILLO ET AL. SUPPLEMENTAL EXPERIMENTAL PROCEDURES Mouse Genotyping Initial genotyping of all new litters was performed by Transnetyx (Memphis, USA). Assessment of LoxPpα recombination
Yoshida et al. Extra-hepatic PDGFB, Delivered by Platelets, Promotes Activation of Hepatic Stellate Cells and Biliary Fibrosis in Mice
Yoshida et al. Extra-hepatic PDGFB, Delivered by Platelets, Promotes Activation of Hepatic Stellate Cells and Biliary Fibrosis in Mice SUPPLEMENTARY MATERIAL PDGF receptor β is upregulated across experimental
Make High Quality Affordable
Protein Antibody Gene Kit Cell Lysate Fc receptor Antibody Cancer antigen ed NK-Cell le as Cancer-Cell Perfo r i n a n d G r a n zy r me e Make Quality Affordable Fc receptor Function and s Function:,
Antibodies to Animal Cells and Serum Proteins
ANTIBODIES TO ANIMAL CELLS AND SERUM PROTEINS Antibodies to Animal Cells and Serum Proteins Antibodies to Animal Cellular Antigens Antibodies to Mouse Brain Antibodies to Animal Serum Proteins INTERNATIONAL
Product Datasheet. Acetylcholinesterase/ACHE Antibody (HR2) NB Unit Size: 200uL. Store at -20C. Avoid freeze-thaw cycles.
Product Datasheet Acetylcholinesterase/ACHE Antibody (HR2) NB300-528 Unit Size: 200uL Store at -20C. Avoid freeze-thaw cycles. Publications: 1 Protocols, Publications, Related Products, Reviews, Research
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3575 In the format provided by the authors and unedited. Supplementary Figure 1 Validation of key reagents and assays a, top, IHC with antibody recognizing specifically
Development of new method to enrich human ipsc-derived renal progenitors using cell
Supplementary information Development of new method to enrich human ipsc-derived renal progenitors using cell surface markers Azusa Hoshina 1, Tatsuya Kawamoto 2, Shin-Ichi Sueta 1, Shin-Ichi Mae 1, Toshikazu
efluor Organic Dyes 450/50 BP Fluorescence Intensity Wavelength (nm)
efluor Organic Dyes efluor Organic Dyes Catalog No. Description Clone Application Anti-Mouse efluor 450 Products 48-0042 Anti-mouse CD4 RM4-5 Flow Cytometry 48-0081 Anti-mouse CD8 53-6.7 Flow Cytometry
Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation
Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation Shu Liu 1, Zhongwen Xie 2, Qingwei Zhao 2, Huan Pang
FL cell isolation and sorting
FL cell isolation and sorting Mononuclear cells obtained from FL were blocked with an anti-cd16/32 (93) antibody (BioLegend), followed by predepletion of differentiated hematopoietic cells with automacs
Supplemental Materials and Methods
Supplemental Materials and Methods 125 I-CXCL12 binding assay KG1 cells (2 10 6 ) were preincubated on ice with cold CXCL12 (1.6µg/mL corresponding to 200nM), CXCL11 (1.66µg/mL corresponding to 200nM),
Supplementary Material. Levels of S100B protein drive the reparative process in acute muscle injury and muscular dystrophy
Supplementary Material Levels of protein drive the reparative process in acute muscle injury and muscular dystrophy Francesca Riuzzi 1,4 *, Sara Beccafico 1,4 *, Roberta Sagheddu 1,4, Sara Chiappalupi
Guided differentiation of ES cell into mesenchymal stem cell
Guided differentiation of ES cell into mesenchymal stem cell Takumi Era Division of Molecular Neurobiology Institute of Molecular Embryology and Genetics, Kumamoto University Differentiation pathways of
Nature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 Validation of the monoclonal antibody to mouse ACKR1 and expression of ACKR1 by BM hematopoietic cells. (a to d) Comparison of immunostaining of BM cells by anti-mouse ACKR1 antibodies:
Supplemental Materials. Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans
Supplemental Materials Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans Madhusudhan Budatha, Shayzreen Roshanravan, Qian Zheng, Cecilia Weislander, Shelby L. Chapman,
Isolation, culture, and transfection of primary mammary epithelial organoids
Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)
Application Note AN001
Testing hybridoma supernatants with the Spots On Dots Antibody Screening Kit Application Note AN1 Table of Contents Overview... 2 Figure 1. Screening of hybridomas raised against peptide antigens... 3
BD Biosciences Stem Cell Research Reagents Product List
BD Biosciences Stem Cell Research Reagents Product List For Research Use Only. Not for use in diagnostic or therapeutic procedures. Table of Contents Stem Cell Research Reagents Human Stem Cell Markers
Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using
Supplementary Methods Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using the Qiagen RNeasy Mini Kit, according to the manufacturer s protocol with on-column DNase digestion
How to run Alpha assay: How to setup an Alpha assay Make your own assay!
How to run Alpha assay: How to setup an Alpha assay Make your own assay! 1 2009 PerkinElmer AlphaLISA kits - recommendations before starting the assay Samples: Phenol red and hemoglobin: choose AlphaLISA
Supporting Information
Supporting Information Cieslewicz et al. 10.1073/pnas.1312197110 SI Results Human and mouse lesions of atherosclerosis contain both M1 and M2 macrophage phenotypes (1, 2). Previous work has suggested the
Post-expansion antibody delivery, after epitope-preserving homogenization.
Supplementary Figure 1 Post-expansion antibody delivery, after epitope-preserving homogenization. (a, b) Wide-field fluorescence images of Thy1-YFP-expressing mouse brain hemisphere slice before expansion
Supplementary Table 1. Primary antibodies used in this study.
Supplementary Table 1. Primary antibodies used in this study. Antibodies Mouse monoclonal Antibody(Ab) Working dilution Oct4 1:2 Pax6 1:1 Company Notes 1 Santa Cruz Biotechnology Use only Cy3 2nd antibody
Nanoparticle labeling identifies slow cycling human endometrial stromal cells
Xiang et al. Stem Cell Research & Therapy 2014, 5:84 RESEARCH Nanoparticle labeling identifies slow cycling human endometrial stromal cells Lina Xiang 1, Rachel W S Chan 1,2*, Ernest H Y Ng 1,2 and William
SOX2 antibody - Embryonic Stem Cell Marker (ab15830) datasheet
-Embryonic Stem Cell Marker (ab15830) 1/8 ページ d Products: Stem Cells >> Germline Stem Cells >> Embryonic Germ Cells SOX2 antibody - Embryonic Stem Cell Marker (ab15830) datasheet Product Name Product type
The best and brightest
Labeling and Detection The best and brightest Alexa Fluor 488 dye Labeling and Detection A superior alternative to FITC Brighter conjugate fluorescence Unequalled photostability Perfect spectral match
CF Dyes Next Generation Fluorescent Dyes Secondary antibody
CF Dyes Next Generation Fluorescent Dyes Secondary antibody OZYME 10 AVENUE AMPÈRE - CS 30268-78053 ST QUENTIN EN YVELINES CEDEX Tél. : 01 34 60 24 24 - Fax : 01 34 60 92 12 - www.ozyme.fr/info CF Dyes
Understanding secondary antibodies
Understanding secondary antibodies IgG Fragment antigen binding antibodies and isotypes D2 D2 F(ab ) 2 after pepsin cleavage www.abcam.com/secondary_antibody Antibody structure and F(ab) antibodies The
Isolation and Analysis of Pluripotent, Neural, and Hematopoietic Stem Cells
Isolation and Analysis of Pluripotent, Neural, and Hematopoietic Stem Cells Christian Carson BD Biosciences R&D Scientist Stem Cell 23-10679-00 Overview Introduction Challenges in stem cell research Antibody
Supporting Information
Supporting Information Barthel et al../pnas. SI Materials and Methods Cell Lines, Native Tissues, and Mice. Human bone-metastatic PCa PC- cells, human colon cancer (CCa) LST and HT- cells, human melanoma
Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion
Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin
Purification Kits. Fast and Convenient PROSEP -A and PROSEP-G Spin Column Kits for Antibody Purification DATA SHEET
 Montage Antibody Purification Kits Fast and Convenient PROSEP -A and PROSEP-G Spin Column Kits for Antibody Purification DATA SHEET Available with immobilized Protein A or Protein G Easy-to-use Antibody
Immunoprecipitation Protocol
Immunoprecipitation Protocol Immunoprecipitation is a general method to obtain the enrichment of a specific protein from tissue lysate and cell lysate. It can be used to purify a specific protein, to identify
Table S1. Primer sequences
Table S1. Primer sequences Primers for quantitative PCR Tgf 1 Forward Tgf 1 Reverse Tgf 2Forward Tgf 2Reverse Tgf 3 Forward Tgf 3 Reverse Tgf r1 Forward Tgf r1 Reverse Tgf r2 Forward Tgf r2 Reverse Thbs1
Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand
SUPPLEMENTAL FIGURES Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand C. Ravelli et al. FIGURE S. I Figure S. I: Gremlin
Manuscript Skeletal muscle Heat shock protein 60 increases after endurance training and induces peroxisome proliferator-activated
Supplementary informations Manuscript Skeletal muscle Heat shock protein 60 increases after endurance training and induces peroxisome proliferator-activated receptor gamma coactivator 1 α1 expression Rosario
Supplementary Figure. S1
Supplementary Figure. S1 Supplementary Figure S1. Correlation of phagocytic ability measured with YG and YO beads. Fresh human monocytes (2 10 6 /ml) were labelled with APC conjugated anti CD14 mab alone
Directed Differentiation of Human Induced Pluripotent Stem Cells. into Fallopian Tube Epithelium
Directed Differentiation of Human Induced Pluripotent Stem Cells into Fallopian Tube Epithelium Nur Yucer 1,2, Marie Holzapfel 2, Tilley Jenkins Vogel 2, Lindsay Lenaeus 1, Loren Ornelas 1, Anna Laury
Cytomics in Action: Cytokine Network Cytometry
Cytomics in Action: Cytokine Network Cytometry Jonni S. Moore, Ph.D. Director, Clinical and Research Flow Cytometry and PathBioResource Associate Professor of Pathology & Laboratory Medicine University
BD Pharmingen ELISA Products. Kits, Cytometric Bead Arrays, ELISPOT Reagent Sets, BD OptEIA BD OptEIA. Sets, and Matched Antibody Pairs
BD Pharmingen ELISA Products Cytometric Bead Arrays, ELISPOT Reagent Sets, BD OptEIA BD OptEIA Sets, and Matched Antibody Pairs Kits, BD Biosciences Clontech Discovery Labware Immunocytometry Systems Pharmingen
Product Datasheet. TGN38 Antibody NBP Unit Size: 0.5 mg
Product Datasheet TGN38 Antibody NBP1-03495 Unit Size: 0.5 mg Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles. Publications: 5 Protocols, Publications, Related Products,
Supporting Information Lin et al.
Supporting Information Lin et al. SI Materials and Methods. Isolation and culture of human MSCs and ECFCs Human watmscs were isolated from normal discarded subcutaneous white adipose tissue obtained during
Supplementary Information
Electronic Supplementary Material (ESI) for Analyst. This journal is The Royal Society of Chemistry 2017 Seidel et al. 2016 Page 1 of 13 In vitro field potential monitoring on multi-micro electrode array
Supporting Information
Supporting Information Groschwitz et al. 10.1073/pnas.0906372106 SI Methods In vitro permeability. Caco2-bbe human intestinal adenocarcinoma cells (ATCC) were maintained in DMEM supplemented with 10% FCS,
Your Antibody Source. prosci-inc.com. Extensive Antibody Services Broad Antibody Catalog
Your Source prosci-inc.com Extensive Services Broad Catalog Company Overview Established in 1998, ProSci Incorporated is a leading provider of high performance antibodies and custom antibody services.
Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section B and ONE question from Section C.
UNIVERSITY OF EAST ANGLIA School of Biological Sciences Main Series UG Examination 2013-2014 CELL BIOLOGY BIO-2B06 Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in
GenScript. Neuroscience Products & Services. Your Innovation Partner in Drug Discovery! Tools for Neurological Disease Research:
Neuroscience Products & Services Reliable, well-selected antibodies are one of the most effective tools in the neuroscience researcher's arsenal with regard to identifying and locating specific proteins.
Immunohistochemistry. How does it look like? When do we need IHC? When do we need IHC? In clinic: In research:
Introduction How does it look like? Immunohistochemistry Smooth muscle actin Parvalbumin Distrophyn Sandrine Bichet Head of Molecular Histology Platform Signal versus background 06.03.2012 IHC basics Introduction
In-Cell ELISA. Validated antibodies, dyes and kits for the analysis of fixed adherent and suspension cells. Discover more at abcam.
In-Cell ELISA Validated antibodies, dyes and kits for the analysis of fixed adherent and suspension cells. In-Cell ELISA Advantages of In-Cell ELISA Flexible Measure specific protein level or post-translation
1. Cross-linking and cell harvesting
ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine
Epithelial cell-cell adhesion molecule (Ep-CAM)
Assessment Run 45 205 Epithelial cell-cell adhesion molecule (Ep-CAM) Material The slide to be stained for Ep-CAM comprised:. Appendix, 2. Kidney, 3. Basal cell carcinoma, 4. Colon adenocarcinoma, 5-6.
BD Biosciences Stem Cell Research Reagents Product List
BD Biosciences Stem Cell Research Reagents Product List For Research Use Only. Not for use in diagnostic or therapeutic procedures. Table of Contents Stem Cell Research Reagents Human Stem Cell Markers
Description: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tables Title of file for HTML: Supplementary Movie 1 Description: Nuclear morphology and dynamics
Comparing the Quality of Fixation for Gel-based Formalin (Formagel) versus Traditional Liquid-Based Formalin for Immunohistochemistry
Comparing the Quality of Fixation for Gel-based Formalin (Formagel) versus Traditional Liquid-Based Formalin for Immunohistochemistry Brian H. Le, M.D., Reading Hospital Reviewed by Michael R. LaFrinere,
PSC 4-Marker Immunocytochemistry Kit PSC (OCT4, SSEA4) Immunocytochemistry Kit PSC (SOX2, TRA-1-60) Immunocytochemistry Kit
PSC 4-Marker Immunocytochemistry Kit PSC (OCT4, SSEA4) Immunocytochemistry Kit PSC (SOX2, TRA-1-60) Immunocytochemistry Kit Catalog no. A24881, A25526, A25525 Table 1 Contents and storage Kit component
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Description of the observed lymphatic metastases in two different SIX1-induced MCF7 metastasis models (Nude and NOD/SCID). Supplementary Figure 2. MCF7-SIX1
Supplemental Information. Neutrophil-Derived IL-1b Impairs the Efficacy. of NF-kB Inhibitors against Lung Cancer
Cell Reports, Volume 16 Supplemental Information Neutrophil-Derived IL-1b Impairs the Efficacy of NF-kB Inhibitors against Lung Cancer Allyson G. McLoed, Taylor P. Sherrill, Dong-Sheng Cheng, Wei Han,
phab Amine and Thiol Reactive Dyes for Antibody Internalization Studies Nidhi Nath, Ph.D. Group Leader, Protein Analysis Promega Corporation
phab Amine and Thiol Reactive Dyes for Antibody Internalization Studies Nidhi Nath, Ph.D. Group Leader, Protein Analysis 1 Outline 1. phab Dyes 2. Protocols for conjugating phab Dyes to antibodies 3. Applications:
Modulation of the anti-tumor immune response by complement. Maciej M. Markiewski, Robert A. DeAngelis, Fabian Benencia, Salome K.
Modulation of the anti-tumor immune response by complement Maciej M. Markiewski, Robert A. DeAngelis, Fabian Benencia, Salome K. Ricklin- Lichtsteiner, Anna Koutoulaki, Craig Gerard, George Coukos & John
Nature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting.
Supplementary Figure 1 Zranb1 gene targeting. (a) Schematic picture of Zranb1 gene targeting using an FRT-LoxP vector, showing the first 6 exons of Zranb1 gene (exons 7-9 are not shown). Targeted mice
Supplemental Figure 1
Supplemental Figure 1 A B 50 * 40 30 20 10 0 NeurofilamentM/βactin Relative expression control D neurogenic cond. PPARγ/ Relative expression C PPARγ Hprt OilRedO adipogenic cond. control 125 * 100 75 50
Peter Dy, Weihuan Wang, Pallavi Bhattaram, Qiuqing Wang, Lai Wang, R. Tracy Ballock, and Véronique Lefebvre
Developmental Cell, Volume 22 Supplemental Information Sox9 Directs Hypertrophic Maturation and Blocks Osteoblast Differentiation of Growth Plate Chondrocytes Peter Dy, Weihuan Wang, Pallavi Bhattaram,
Supporting Figure 1: Meis2 and Pax6 transcripts in the adult murine brain detected by in situ
DEVELOP2013097295_supplementary figures Supporting Figure 1: Meis2 and Pax6 transcripts in the adult murine brain detected by in situ hybridization on vibratome sections. (A) Meis2-specific transcripts
Núñez-Toldrà et al. BMC Cell Biology (2017) 18:21 DOI /s
Núñez-Toldrà et al. BMC Cell Biology (2017) 18:21 DOI 10.1186/s12860-017-0137-9 RESEARCH ARTICLE Dental pulp pluripotent-like stem cells (DPPSC), a new stem cell population with chromosomal stability and
Supplementary Figure 1. Lnc-β-Catm characterization. (A, B) LncBRM silenced
Supplementary Figure 1. Lnc-β-Catm characterization. (A, B) LncBRM silenced Hep3B (A) and Huh7 (B) cells were established using psicor lentivirus, followed by sphere formation assays. (C, D) LncBRM deleted
Supplementary Figure S1. Non-SMCs in rat carotid artery.
Supplementary Figure S1. Non-SMCs in rat carotid artery. L M A Cross sections of carotid artery were stained for SM-MHC (red) and SMA (Green). Nuclei were stained with DAPI. L: lumen, M: media, A: adventitia.
Nature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact
Supplementary Information
Supplementary Information Supplementary Figure 1. ZBTB20 expression in the developing DRG. ZBTB20 expression in the developing DRG was detected by immunohistochemistry using anti-zbtb20 antibody 9A10 on
Interest in any of the products, request or order them at Bio-Connect.
NFκB Pathway Interest in any of the products, request or order them at Bio-Connect. Bio-Connect B.V. T NL +31 (0)26 326 44 50 T B +32 (0)2 503 03 48 Begonialaan 3a F NL +31 (0)26 326 44 51 F B +32 (0)2
Experience the Mabtech ELISA
Experience the Mabtech ELISA Mabtech provides well-designed ELISA kits for specific, sensitive, and robust quantification of analytes in solution. A comprehensive selection of ELISA kits is available for
RabMAb advantages A guide to our rabbit monoclonal antibodies
RabMAb advantages A guide to our rabbit monoclonal antibodies Discover more at abcam.com/rabmab Table of Contents About RabMAb technology... 3 RabMAb technology vs traditional mouse monoclonal technology...
Kristin Seré, Jea-Hyun Baek, Julia Ober-Blöbaum, Gerhard Müller-Newen, Frank Tacke, Yoshifumi Yokota, Martin Zenke, and Thomas Hieronymus
Immunity, Volume 37 Supplemental Information Two Distinct Types of Langerhans Cells Populate the Skin during Steady State and Inflammation Kristin Seré, Jea-Hyun Baek, Julia Ober-Blöbaum, Gerhard Müller-Newen,
Immunological Techniques in Research and Clinical Medicine. Philip L. Cohen, M.D. Chief of Rheumatology, LKSOM 10 March 2016
Immunological Techniques in Research and Clinical Medicine Philip L. Cohen, M.D. Chief of Rheumatology, LKSOM 10 March 2016 Antibodies Remarkable Tools for Research and Diagnosis You can make an antibody
IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity
IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p5 activity H6 5 5 H58 A59 H6 H58 A59 anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα
Cell Stem Cell, volume 11 Supplemental Information
Cell Stem Cell, volume 11 Supplemental Information Reprogramming of Pericyte-Derived Cells of the Adult Human Brain into Induced Neuronal Cells Marisa Karow, Rodrigo Sánchez, Christian Schichor, Giacomo
Product Datasheet. Panendothelial Cell Antigen Antibody (MECA-32) NB Unit Size: 0.5 mg
Product Datasheet Panendothelial Cell Antigen Antibody (MECA-32) NB100-77668 Unit Size: 0.5 mg Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles. Publications: 14 Protocols,
Product Datasheet. YAP1 Antibody (2F12) H M01. Unit Size: 0.1 mg. Aliquot and store at -20C or -80C. Avoid freeze-thaw cycles.
Product Datasheet YAP1 Antibody (2F12) H00010413-M01 Unit Size: 0.1 mg Aliquot and store at -20C or -80C. Avoid freeze-thaw cycles. Publications: 30 Protocols, Publications, Related Products, Reviews,
Hepatic stellate cells contribute to progenitor cells and liver regeneration
Hepatic stellate cells contribute to progenitor cells and liver regeneration Claus Kordes, 1 Iris Sawitza, 1 Silke Götze, 1 Diran Herebian, 2 and Dieter Häussinger 1 1 Clinic of Gastroenterology, Hepatology
Lower spectral overlap. Optimized stain index. Innovative antibodies. Superior multicolor flow cytometry. Violet Laser Reagents: The efluor Solution
Lower spectral overlap Optimized stain index Innovative antibodies Superior multicolor flow cytometry Violet Laser Reagents: The efluor Solution www.ebioscience.com ebioscience provides innovative high
TheraLin. Universal Tissue Fixative Enabling Molecular Pathology
TheraLin Universal Tissue Fixative Enabling Molecular Pathology TheraLin Universal Tissue Fixative Enabling Molecular Pathology Contents Page # TheraLin Universal Tissue Fixative 3 Introduction 5 Easy
Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde
Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with
Figure S1. Purity of primary cultures of renal proximal tubular epithelial culture ascertained by cytokeratin staining.
Supplementary information Supplementary figures Figure S1. Purity of primary cultures of renal proximal tubular epithelial culture ascertained by cytokeratin staining. Figure S2. Induction of Nur77 in
Research Materials Licensing Catalog. Animal Models - Antibodies & Hybridomas - Cell Lines - Proteins
Research Materials Licensing Catalog Animal Models - Antibodies & Hybridomas - Cell Lines - Proteins Updated as of: July 26, 2016 TABLE OF CONTENTS Hamster IgG Monoclonal Antibodies against Mouse IL-1
SANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same