BIOSYNTHESIS OF DNA AND RNA: REPLICATION AND TRANSCRIPTION

Size: px

Start display at page:

Download "BIOSYNTHESIS OF DNA AND RNA: REPLICATION AND TRANSCRIPTION"

Dominic O’Brien’
6 years ago
Views:

1 BIOSYNTHESIS OF DNA AND RNA: REPLICATION AND TRANSCRIPTION HLeeYu Jsuico Junsay Department of Chemistry School of Science and Engineering Ateneo de Manila University 1

2 Nucleic Acids are important for their roles in the storage, transfer and expression of genecc informacon. HOW DO YOU TRANSFER INFORMATION TO THE NEXT GENERATION? HOW DO YOU DECODE THE INFORMATION AND MAINTAIN THE CELL S STRUCTURE AND FUNCTION? 2

3 Transfer and interpretacon of genecc informacon is described in the central dogma of molecular biology. 3

4 REPLICATION OF DNA 4

5 DNA is passed on thru replicacon and is semi conservacve. 5

6 DNA is passed on thru replicacon and is semi conservacve. 6

7 DNA is passed on thru replicacon and is semi conservacve. 7

8 DNA is passed on thru replicacon and is semi conservacve. 8

9 DNA is passed on thru replicacon and is semiconservacve. 9

10 ReplicaCon start at discrete points on DNA and is bidirecconal 10

11 ReplicaCon start at discrete points on DNA and is bidirecconal 11

12 ReplicaCon start at discrete points on DNA and is bidirecconal 12

13 ReplicaCon start at discrete points on DNA and is bidirecconal DNA_bi_direcConal 13

14 ReplicaCon is semi disconcnuous. Leading strand is copied concnuously Lagging strand is copied in segments which must be joined 14

15 ReplicaCon is semi disconcnuous. DNA_leading_lagging 15

16 If Watson and Crick were right, then there should be an enzyme that makes DNA copies from a DNA template In 1957, Arthur Kornberg and colleagues demonstrated the existence of a DNA polymerase DNA polymerase I (Pol I) Pol I needs all four deoxynucleocdes, a template and a primer a ss DNA (with a free 3' OH) that pairs with the template to form a short double stranded region 16

17 DNA elongacon happens through the accon of DNA Polymerases. template directed enzymes 5 classes are idencfied all DNA polymerase have common structural features Klenow fragment 17

18 DNA elongacon happens through the accon of DNA Polymerases. specificity dictated by Hbonding and shape complementarity between bases binding of correct base is favorable (more stable) interaccon of residues in the enzyme to the minor groove of DNA close down around the incoming NTP 18

19 DNA Polymerase creates the phosphodiester bond from a pre exiscng 3 OH and a dntp creacng a pyrophosphate. 19

20 The first DNA polymerases were discovered in E. coli. 20

21 The exonuclease accvity of DNA Polymerases are important for proofreading. proofreading mechanisms Klenow fragment removes mismatched nucleocdes from the 3 end of DNA (exonuclease accvity) deteccon of incorrect base incorrect pairing with the template (weak Hbonding) unable to interact with the minor groove (enzyme stalls) 21

22 The exonuclease accvity of DNA Polymerases are important for proofreading. 22

23 DNA polymerase III holoenzyme replicates the E. coli chromosome. Several other proteins are also important: 23

24 Unwinding of DNA helix: dnab helicase disrupts H bonds holding the 2 strands DNA gyrase introduces negacve supercoils 24

25 Unwinding of DNA helix: SSB (single stranded DNA binding protein) binds to unwound strands to prevent annealing forms prepriming complex 25

26 Primer RNA primes the synthesis of DNA. Primase synthesizes short RNA. 26

27 ElongaCon by DNA Polymerase III 27

28 DNA Polymerase I cleaves RNA primer and inserts dntps. 28

29 DNA ligase seals breaks in the double stranded DNA DNA ligases use an energy source (ATP in eukaryotes and archaea, NAD + in bacteria) to form a phosphodiester bond between the 3 hydroxyl group at the end of one DNA chain and 5 phosphate group at the end of the other. 29

30 DNA ligase seals breaks in the double stranded DNA DNA ligases use an energy source (ATP in eukaryotes and archaea, NAD + in bacteria) to form a phosphodiester bond between the 3 hydroxyl group at the end of one DNA chain and 5 phosphate group at the end of the other. 30

31 31

32 32

33 33

34 DNA replicacon sites 34

35 DNA replicacon sites 35

36 Linear DNA gets shorter ager each replicacon cycle. To protect DNA, Telomeres are added to the ends of DNA. DNA_telomeres 36

37 Telomeres are synthesized by Ribonuclearprotein complexes called Telomerases. 37

38 Telomerases use RNA template to synthesize DNA. (REVERSE TRANSCRIPTASE!) Primer required, but a strange one a trna molecule that the virus captures from the host RT transcribes the RNA template into a complementary DNA (cdna) to form a DNA:RNA hybrid 38

39 Reverse Transcriptase is very common in viruses Three enzyme activities RNA-directed DNA polymerase RNase H activity - degrades RNA in the DNA:RNA hybrids DNA-directed DNA polymerase - which makes a DNA duplex after RNase H activity destroys the viral genome HIV therapy: AZT (or 3'-azido-2',3'- dideoxythymidine) specifically inhibits RT 39

40 RECAP: 1. DNA replicacon is semi conservacve, bidirecconal and semi disconcnuous 2. Helicases, DNA gyrase and SSB are needed to prepare a DNA for replicacon. 3. RNA primase creates primers to start DNA replicacon. 4. DNA is synthesized from a pre exiscng 3 OH in the 5 3 direccon by DNA polymerases (with proofreading mechanism) 5. DNA ligase connects fragments 6. DNA is shortened ager replicacon, to prevent adverse effects, telomeres are present. 7. DNAs can be synthesized from RNA template via reverse transcriptase.

41 DNA DAMAGE AND REPAIR 41

Changes in the base sequence of DNA are called mutagons. They may have adverse effect on the normal biological funccons or silent. MutaCons may be spontaneous or induced.

42 Changes in the base sequence of DNA are called mutagons. They may have adverse effect on the normal biological funccons or silent. MutaCons may be spontaneous or induced. The gene defect is a known mutacon of a single nucleocde (T to A) of the β globin gene, which results in glutamate being subsctuted by valine at posicon 6. hkp:// 42

43 Spontaneous mutacons are those that occur during normal genecc and metabolic funccons. 1. SubsCtuCon of base pair a. TransiCon b. Transversion 2. DeleCon of base pair/s 3. InserCon of base pair/s 43

44 Nitrogeneous bases may be modified by naturally occuring species (water) and reaccve oxygen species (ROS). Repaired by DNA glycosidases cleave the nitrogeneous bases 44

45 Environmental factors also cause mutacons. These are called mutagens. One type of this mutagen are ionizing radiacons. 45

46 Chemical Agents can modify DNA: (1) Heterocyclic base analogs, (2) ReacCve chemicals, (3) IntercalaCng agents 5 BU is an example of heterocyclic base analogs. 46

47 Chemical Agents can modify DNA: (1) Heterocyclic base analogs, (2) ReacCve chemicals, (3) IntercalaCng agents Nitrous acid (HNO 2 ) Converts adenine to hypoxanthine, cytosine to uracil, and guanine to xanthine Causes A T to G C transicons 47

48 Chemical Agents can modify DNA: (1) Heterocyclic base analogs, (2) ReacCve chemicals, (3) IntercalaCng agents 48

49 Chemical Agents can modify DNA: (1) Heterocyclic base analogs, (2) ReacCve chemicals, (3) IntercalaCng agents IntercalaCng agents are flat aromacc compound. Causes insercon or delecon 49

50 DNAs repair damage via nucelocde excision or base excision 50

51 DNAs repair damage via nucelocde excision 51

52 DNAs repair damage via nucelocde excision 52

53 DNAs repair damage via nucelocde excision 53

54 RECAP: 1. Integrity of DNA can be jeopardized during replicacon. 2. Damage may also come in the form of natural reaccons from the environment: via chemical or radiacon 3. DNA repairs itself via base excision or nucleocde excision processes

55 TRANSCRIPTION OF DNA TO RNA 55

56 Mechanism of RNA synthesis is similar to DNA synthesis. RNA Polymerases Template (DNA) AcCvated precursors (NTP) Divalent metal ion (Mg 2+ or Mn 2+ ) 56

CAGGGTTAACCTACGGGATCGAGCGATCTTATCTCTATATCTCTATTTGG 5 5 DNA coding strand 3 5

57 Mechanism of RNA synthesis is similar to DNA synthesis. 5 GTCCCAATTGGATGCCCTAGCTCGCTAGAATAGAGATATAGAGATAAACC DNA coding strand DNA template (SENSE) strand CAGGGTTAACCTACGGGATCGAGCGATCTTATCTCTATATCTCTATTTGG 5 5 DNA coding strand 3 5 GTCCCAATTGGATGCCCTAGCTCGCTAGAATAGAGATATAGAGATAAACC 3 5 GUCCCAAUUGGAUGCCCUAGCUCGCUAGAAUAGAGAUAUAGAGAUAAACC 3 5 RNA mrna 3 3 Pol DNA template strand 5 3 CAGGGTTAACCTACGGGATCGAGCGATCTTATCTCTATATCTCTATTTGG 5 57

58 Mechanism of RNA synthesis is similar to DNA synthesis. 58

59 Different types of RNA polymerase encode for different types of RNA. Most common of which is RNA Polymerase II 59

60 Intrinsic markers in the DNA molecule directs transcripcon enzymes where to start. These are called promoter sites. 60

61 RNA polymerase akach to DNA and start creacng RNA Primary transcripts. NOTE, no primer is needed! 61

62 In eukaryotes the alpha subunit is not a simple compound, but rather LOTS of transcripgon factors which have varied roles in promocng and controlling transcripcon 62

63 RNA polymerase akach to DNA and start creacng RNA. NOTE, no primer is needed! 63

64 RNA polymerase akach to DNA and start creacng RNA. NOTE, no primer is needed! 64

65 A terminator factor recognizes specific DNA sequences and signals RNA Pol to stop encoding RNA from the DNA and start creacng a terminal sequence In E.coli it creates a hairpin tail with many Uracils 65

66 In eukaryotes, a poly A tail is synthesized by poly A polymerase and poly A binding proteinsager terminacon of RNA sequence 66

67 RNA can also be synthesized from fellow RNA (via RNA replicase). 67

68 Different kinds of RNAs require different post transcripcon modificacons RNA Methylated GTP cap PolyadenylaCon Splicing Base modificacon AcetylaCon mrna trna 68

69 Primary transcripts for trna produccon are cut up in several places by nucleases. Nitrogenous bases are modified (mostly methylated) Amino acyl group is added on the 3 OH end 69

70 RNAs have a triphosphate at the 5 end, which is capped by GMP and then methylated Capping ensures the fate of an mrna as a code carrying molecule. (It allows the body to discnguish mrna from other types of RNA) 70

71 Primary transcripts for mrna containing noncoding regions called introns. Introns Intervening sequences Exons Expressed sequences 71

72 Pre mrnas containing non coding regions called introns. 72

73 Splicing defects can cause serious medical implicacons Figure Splicing Defects. MutaCon of a single base (G to A) in an intron of the b globin gene leads to thalassemia. This mutacon generates a new splice site (blue) akin to the normal one (yellow) but farther upstream. 73

Some pre mrna molecules can be spliced in alternacve ways to yield different mrna A pre mrna with mulcple exons is somecmes spliced in different ways.

74 Some pre mrna molecules can be spliced in alternacve ways to yield different mrna A pre mrna with mulcple exons is somecmes spliced in different ways. Here, with two alternacve exons (exons 2A and 2B) present, the mrna can be produced with neither, either, or both exons included. More complex alternacve splicing pakerns also are possible. 74

75 Some pre mrna molecules can be spliced in alternacve ways to yield different mrna AlternaCve splicing provides a powerful mechanism for expanding the versaclity of genomic sequences. AlternaCve splicing provides an opportunity for combinatorial control. 75

76 RECAP: 1. RNA synthesis is similar to DNA except a. RNA polymerase is directed by transcripcon factors b. RNAs do not need a primer to start transcripcon c. There is no proof reading mechanism d. Post transcripcon modificacons are necessary: capping, poly A tail, splicing

DNA Replication and Repair

DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands