BIONF/BENG 203: Functional Genomics

Size: px
Start display at page:

Download "BIONF/BENG 203: Functional Genomics"

Transcription

1 BIONF/BENG 203: Functional Genomics Sources of Functional Data Lectures 1 and 2 Lecture TI 1,2 Trey Ideker UCSD Departments of Medicine & Bioengineering 1

2 Instructors Trey Ideker Vineet Bafna Anand Patel (TA) 2

3 Grading 40% Problem Sets (best 4 of 5) 30% Midterm 30% Final Project 3

4 Topics Covered By This Course 4 1 Signal detection in bioinformatics 2 Large-scale data generation platforms 3 Understanding next-gen sequencing data 4 Understanding mass spectrometry data 5 Clustering and Classification 6 Genotype-phenotype association 7 Understanding physical & genetic networks 8 Gene network inference and evolution

5 Bioinformatics as Signal Detection Ideker, Dutkowski, Hood. Cell 2011

6 Power, FDR, and all that... Test Statistic t Ideker, Dutkowski, Hood. Cell 2011

7 Power, FDR, and all that... Test Statistic t

8 An Example: Pathway-Level Integration of Genome-wide Association Studies Segrè et al., 2010 A.V. Segrè, L. Groop, V.K. Mootha, M.J. Daly and D. Altshuler, PLoS Genet. 6 (2010), p. e

9 Classes of biological measurements 1) Molecular States DNA sequence / genotype: Next-gen sequencing, SNP & CNV arrays Gene expression: DNA microarrays, mrna sequencing Protein levels, locations, mods: Mass spectrometry, fluorescence microscopy, protein arrays 2) Molecular Networks Protein-protein interactions: Two-hybrid system, coip, protein antibody array Protein-DNA interactions: Chromatin IP (chip) sequencing Protein-compound 3) Phenotypic traits Physiological or disease state, binary or quantitative Growth rate, response to stimulus or stress Behaviors

10 Sequencing By Synthesis (Illumina GenomeAnalyzer or HiSeq)

11

12

13

14

15

16

17

18

19 Bridge Amplification

20 Pyrosequencing Note: No actual houses are burned down in pyrosequencing

21 Pyrosequencing (Life Sciences / Roche 454) A luciferase is an enzyme which emits light in the presence of ATP. Several organisms, such as the American firefly and the poisonous Jack-o-lantern mushroom, produce luciferases.

22 Detecting polymerase activity Recall: Pyrophosphate is also known as PPi, also known as two phosphate groups stuck together. During replication, each addition of a dntp releases pyrophosphate In the reaction mixture, PPi allows adenosine phosphosulfate (APS) to be converted to ATP; this ATP allows luciferase to luciferate (emit light). Measures strand extension as it happens

23 Pyrosequencing cycle Add datp. If light is emitted, your sequence starts with A. If not, the datp is degraded (or elutes past immobilized primer). Add dgtp. If light is emitted, the next base must be a G. Then add T, then C. You now know at least one (maybe more) base of the sequence. Repeat!

24 Pyrosequencing output Runs of bases produce higher peaks for instance, the sequence for (a) is GGCCCTTG. Sample (c) comes from a heterozygous individual (hence the heights in multiples of ½)

25 The X Prize Foundation In October 2006, the X Prize Foundation established an initiative to promote the development of full genome sequencing technologies, called the Archon X Prize, intending to award $10 million to "the first Team that can build a device and use it to sequence 100 human genomes within 10 days or less, with an accuracy of no more than one error in every 100,000 bases sequenced, with sequences accurately covering at least 98% of the genome, and at a recurring cost of no more than $10,000 (US) per genome.

26 Gene and Protein Expression The transcriptome is the full complement of RNA molecules produced by a genome The proteome is the full complement of proteins enabled by the transcriptome DNA RNA protein Genome transcriptome proteome 30,000 genes??? RNAs??? proteins? 26 For example, the drosophila gene Dscam can generate 40,000 distinct transcripts through alternative splicing. What is the minimum number of exons that would be required?

27 mrna Expression: Two dominant approaches RNA sequencing DNA Microarrays 27 Others / older approaches: EST sequencing RT-PCR Differential display SAGE Massively parallel signature sequencing (MPSS)

28 Microarrays Monitors the level of each gene: Is it turned on or off in a particular biological condition? Is this on/off state different between two biological conditions? 28 Microarray is a rectangular grid of spots printed on a glass microscope slide, where each spot contains DNA for a different gene

29 Two-color DNA microarray design Reverse Transcription 29

30 Types of microarrays Spotted (cdna) Robotic transfer of cdna clones or PCR products Spotting on nylon membranes or glass slides coated with poly-lysine Synthetic (oligo) Direct oligo synthesis on solid microarray substrate Uses photolithography (Affymetrix) or ink-jet printing (Agilent) 100,000 features per cm 2 All configurations assume the DNA on the array is in excess of the hybridized sample thus the kinetics are linear and the spot intensity reflects that amount of hybridized sample. 30 Labeling can be radioactive, fluorescent (one-color), or two-color

31 31 Microarray Spotter

32 Affymetrix High Density Arrays

33 Collects sharply defined optical sections from which 3D renderings can be created The key is spatial filtering to eliminate outof-focus light or glare in specimens whose thickness exceeds the immediate plane of focus. Two lasers for excitation Two color scan in less than 10 minutes High resolution, 10 micron pixel size Microarray confocal scanner

34 Next-Gen Sequencing of mrnas cdna = complementary or copy DNA EST = Expressed Sequence Tag The microarray could be described as a closed system because information about RNAs is limited by the targets available for hybridization. RNAs not represented on the array are not interrogated. Direct sequencing of cdnas overcomes this problem by large-scale random sampling of sequences from a wholecell RNA extract Statistical counting of distinct sequences provides a precise estimate of expression level cdna library can be normalized to capture rare messages Has been dramatically enabled by large scale sequencing

35 mrna Sequencing: Preparation of a cdna library in phage vector

36 Proteomics MS / MS 1D and 2D SDS PAGE 36

37 Mass spectrometry Mass spectrometers consist of 3 essential parts Ionization source: Converts peptides into gas-phase ions (MALDI + ESI) Mass analyzer: Separates ions by mass to charge (m/z) ratio (Ion trap, time of flight, quadrupole) Ion detector: Current over time indicates amount of signal at each m/z value 37

38 MS/MS Overview

39 MS/MS Overview

40

41

42 A raw fragmentation spectrum By calculating the molecular weight difference between ions of the same type the sequence can be determined. Algorithms like SEQUEST use the fragmentation pattern to search through a complete protein database to identify the sequence which best fits the pattern.

43 43 Tandem Mass Spec (MS/MS)

44 Isotope Coded Affinity Tags (ICAT) Mass spec based method for measuring relative protein abundances between two samples ICAT Reagents: N O S N O Heavy reagent: d8-icat (X=deuterium) Normal reagent: d0-icat (X=hydrogen) N X X O X X O X X O X X N O I Biotin tag Linker (d0 or d8) Thiol specific reactive group

45 Protein Quantification & Identification via ICAT Strategy Mixture Light Heavy ICATlabeled cysteines Mixture 2 Combine and proteolyze (trypsin) Affinity separation (avidin) m/z Quantitation NH 2 -EACDPLR-COOH ICAT Flash animation: m/z Protein identification

46 ICAT continued The heavy (blue) and light (gray) peptides are separated and quantified to produce a ratio for each peptide here, a single peptide ratio is shown Each peptide is subjected to CID fragmentation in the second MS stage in order to identify it

47 Gene replacement for yeast & other model species Using HR-based gene replacement, genes can be replaced with drug resistance cassette, tagged with GFP, epitope tagged, etc.

48 Systematic phenotyping Barcode (UPTAG): Deletion Strain: CTAACTC TCGCGCA TCATAAT yfg1 yfg2 yfg3 Rich media Growth 6hrs in minimal media (how many doublings?) Harvest and label genomic DNA

49 Systematic phenotyping with a barcode array Ron Davis and friends These oligo barcodes are also spotted on a DNA microarray Growth time in minimal media: Red: 0 hours Green: 6 hours

50 YFP tagging for protein localization YPF is green, transmitted light is red NIC96 Nuclear Pore TUB1 Tubulin cytoskeleton HHF2 Histone Nucleus BNI4 Bud neck Images courtesy T. Davis lab See also work by Weissman and O Shea labs at UCSF

51 Molecular Interactions Among proteins, mrna, small molecules, and so on 51

52 52 Protein DNA interactions Chromatin IP DNA microarray Gene levels (on/off) Protein protein interactions Protein coip Mass spectrometry Protein levels (present/absent) Biochemical reactions Not yet!!! Metabolic flux measurements Biochemical levels

53 Measurements of molecular interactions Protein-protein interactions Yeast-two-hybrid Kinase-substrate assays Co-immunoprecipitation w/ mass spec Protein-DNA interactions ChIP-on-chip and ChIP-seq 53 Genetic interactions Systematic Genetic Analysis

54 Yeast two-hybrid method 54 Fields and Song

55 Kinase-target interactions 55 Mike Snyder and colleagues

56 Protein interactions by protein immunoprecipitation followed by mass spectrometry TEV = Tobacco Etch Virus proteolytic site CBP = Calmodulin binding peptide Protein A = IgG binding from Staphylococcus 56 Gavin / Cellzome

57 ChIP measurement of protein DNA interactions From Figure 1 of Simon et al. Cell 2001

58 Genetic interactions: synthetic lethals and suppressors Genetic Interactions: Widespread method used by geneticists to discover pathways in yeast, fly, and worm Implications for drug targeting and drug development for human disease Thousands are now reported in literature and systematic studies As with other types, the number of known genetic interactions is exponentially increasing Adapted from Tong et al., Science 2001

59 Most recorded genetic interactions are synthetic lethal relationships A B A B A B A B 59 Adapted from Hartman, Garvik, and Hartwell, Science 2001

60 Interpretation of genetic interactions (Guarente T.I.G. 1990) Parallel Effects (Redundant or Additive) Sequential Effects (Additive) A GOAL: Identify downstream B physical pathways A B Single A or B mutations typically abolish their biochemical activities Single A or B mutations typically reduce their biochemical activities

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1. Lecture 25: Mass Spectrometry Applications

MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1. Lecture 25: Mass Spectrometry Applications MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1 Lecture 25: Mass Spectrometry Applications Measuring Protein Abundance o ICAT o DIGE Identifying Post-Translational Modifications Protein-protein

More information

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques) Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

Please purchase PDFcamp Printer on to remove this watermark. DNA microarray

Please purchase PDFcamp Printer on  to remove this watermark. DNA microarray DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of

More information

Proteomics And Cancer Biomarker Discovery. Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar. Overview. Cancer.

Proteomics And Cancer Biomarker Discovery. Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar. Overview. Cancer. Proteomics And Cancer Biomarker Discovery Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar Overview Proteomics Cancer Aims Tools Data Base search Challenges Summary 1 Overview

More information

Lecture #1. Introduction to microarray technology

Lecture #1. Introduction to microarray technology Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a

More information

DNA Arrays Affymetrix GeneChip System

DNA Arrays Affymetrix GeneChip System DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC

More information

3.1.4 DNA Microarray Technology

3.1.4 DNA Microarray Technology 3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns

More information

NPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA

NPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA LECTURE-03 GENOMICS AND TRANSCRIPTOMICS: WHY PROTEOMICS? TRANSCRIPT Welcome to the proteomics course. Today, we will talk about Genomics and Transcriptomics and then we will talk about why to study proteomics?

More information

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information

DNA Microarray Technology

DNA Microarray Technology CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic

More information

Proteomics. Proteomics is the study of all proteins within organism. Challenges

Proteomics. Proteomics is the study of all proteins within organism. Challenges Proteomics Proteomics is the study of all proteins within organism. Challenges 1. The proteome is larger than the genome due to alternative splicing and protein modification. As we have said before we

More information

SIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology.

SIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology. SIMS2003 Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School Introduction to Microarray Technology. Lecture 1 I. EXPERIMENTAL DETAILS II. ARRAY CONSTRUCTION III. IMAGE ANALYSIS Lecture

More information

MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr.

MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. MIT Department of Biology 7.01: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel iv) Would Xba I be useful for cloning? Why or why not?

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

CHAPTER 9 DNA Technologies

CHAPTER 9 DNA Technologies CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes

More information

Proteomics: A Challenge for Technology and Information Science. What is proteomics?

Proteomics: A Challenge for Technology and Information Science. What is proteomics? Proteomics: A Challenge for Technology and Information Science CBCB Seminar, November 21, 2005 Tim Griffin Dept. Biochemistry, Molecular Biology and Biophysics tgriffin@umn.edu What is proteomics? Proteomics

More information

Genome Biology and Biotechnology

Genome Biology and Biotechnology Genome Biology and Biotechnology 10. The proteome Prof. M. Zabeau Department of Plant Systems Biology Flanders Interuniversity Institute for Biotechnology (VIB) University of Gent International course

More information

Introductory Next Gen Workshop

Introductory Next Gen Workshop Introductory Next Gen Workshop http://www.illumina.ucr.edu/ http://www.genomics.ucr.edu/ Workshop Objectives Workshop aimed at those who are new to Illumina sequencing and will provide: - a basic overview

More information

Proteomics. Areas of Application for Proteomics. Most Commonly Used Proteomics Techniques: Limitations: Examples

Proteomics. Areas of Application for Proteomics. Most Commonly Used Proteomics Techniques: Limitations: Examples Proteomics Areas of Application for Proteomics Most Commonly Used Proteomics Techniques: Antibody arrays Protein activity arrays 2-D gels ICAT technology SELDI Limitations: protein sources surfaces and

More information

Research school methods seminar Genomics and Transcriptomics

Research school methods seminar Genomics and Transcriptomics Research school methods seminar Genomics and Transcriptomics Stephan Klee 19.11.2014 2 3 4 5 Genetics, Genomics what are we talking about? Genetics and Genomics Study of genes Role of genes in inheritence

More information

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

Advances in analytical biochemistry and systems biology: Proteomics

Advances in analytical biochemistry and systems biology: Proteomics Advances in analytical biochemistry and systems biology: Proteomics Brett Boghigian Department of Chemical & Biological Engineering Tufts University July 29, 2005 Proteomics The basics History Current

More information

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology. PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?

More information

Lecture 25 (11/15/17)

Lecture 25 (11/15/17) Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);

More information

Chapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi

Chapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi Chapter 17. PCR the polymerase chain reaction and its many uses Prepared by Woojoo Choi Polymerase chain reaction 1) Polymerase chain reaction (PCR): artificial amplification of a DNA sequence by repeated

More information

EECS730: Introduction to Bioinformatics

EECS730: Introduction to Bioinformatics EECS730: Introduction to Bioinformatics Lecture 14: Microarray Some slides were adapted from Dr. Luke Huan (University of Kansas), Dr. Shaojie Zhang (University of Central Florida), and Dr. Dong Xu and

More information

AP Biology Gene Expression/Biotechnology REVIEW

AP Biology Gene Expression/Biotechnology REVIEW AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.

More information

The Two-Hybrid System

The Two-Hybrid System Encyclopedic Reference of Genomics and Proteomics in Molecular Medicine The Two-Hybrid System Carolina Vollert & Peter Uetz Institut für Genetik Forschungszentrum Karlsruhe PO Box 3640 D-76021 Karlsruhe

More information

2054, Chap. 14, page 1

2054, Chap. 14, page 1 2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification

More information

For quantitative methylation and mutation analysis using Pyrosequencing technology in a 24-well format

For quantitative methylation and mutation analysis using Pyrosequencing technology in a 24-well format ProductProfile PyroMark Q24 For quantitative methylation and mutation analysis using Pyrosequencing technology in a 24-well format The PyroMark Q24 uses proven Pyrosequencing technology for real-time,

More information

Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017

Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Agenda What is Functional Genomics? RNA Transcription/Gene Expression Measuring Gene

More information

What is a microarray

What is a microarray DNA Microarrays What is a microarray A surface on which sequences from thousands of different genes are covalently attached to fixed locations (probes). Glass slides Silicon chips Utilize the selective

More information

6. GENE EXPRESSION ANALYSIS MICROARRAYS

6. GENE EXPRESSION ANALYSIS MICROARRAYS 6. GENE EXPRESSION ANALYSIS MICROARRAYS BIOINFORMATICS COURSE MTAT.03.239 16.10.2013 GENE EXPRESSION ANALYSIS MICROARRAYS Slides adapted from Konstantin Tretyakov s 2011/2012 and Priit Adlers 2010/2011

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter

More information

Human genome sequence

Human genome sequence NGS: the basics Human genome sequence June 26th 2000: official announcement of the completion of the draft of the human genome sequence (truly finished in 2004) Francis Collins Craig Venter HGP: 3 billion

More information

Genetics Lecture 21 Recombinant DNA

Genetics Lecture 21 Recombinant DNA Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of

More information

Chapter 10 Analytical Biotechnology and the Human Genome

Chapter 10 Analytical Biotechnology and the Human Genome Chapter 10 Analytical Biotechnology and the Human Genome Chapter Outline Enzyme tests and biosensors DNA-based tests DNA analysis technologies Human genome and genome-based analytical methods 1 Enzyme-based

More information

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution... vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface

More information

Welcome to the NGS webinar series

Welcome to the NGS webinar series Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic

More information

Chapter 15 Gene Technologies and Human Applications

Chapter 15 Gene Technologies and Human Applications Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect

More information

Trasposable elements: Uses of P elements Problem set B at the end

Trasposable elements: Uses of P elements Problem set B at the end Trasposable elements: Uses of P elements Problem set B at the end P-elements have revolutionized the way Drosophila geneticists conduct their research. Here, we will discuss just a few of the approaches

More information

QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd

QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s

More information

RNA-Sequencing analysis

RNA-Sequencing analysis RNA-Sequencing analysis Markus Kreuz 25. 04. 2012 Institut für Medizinische Informatik, Statistik und Epidemiologie Content: Biological background Overview transcriptomics RNA-Seq RNA-Seq technology Challenges

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

LATE-PCR. Linear-After-The-Exponential

LATE-PCR. Linear-After-The-Exponential LATE-PCR Linear-After-The-Exponential A Patented Invention of the Laboratory of Human Genetics and Reproductive Biology Lab. Director: Lawrence J. Wangh, Ph.D. Department of Biology, Brandeis University,

More information

Kinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets)

Kinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets) Quiz 1 Kinetics Review Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets) I will post the problems with solutions on Toolkit for those that can t make

More information

2. Outline the levels of DNA packing in the eukaryotic nucleus below next to the diagram provided.

2. Outline the levels of DNA packing in the eukaryotic nucleus below next to the diagram provided. AP Biology Reading Packet 6- Molecular Genetics Part 2 Name Chapter 19: Eukaryotic Genomes 1. Define the following terms: a. Euchromatin b. Heterochromatin c. Nucleosome 2. Outline the levels of DNA packing

More information

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing

More information

Introduction to gene expression microarray data analysis

Introduction to gene expression microarray data analysis Introduction to gene expression microarray data analysis Outline Brief introduction: Technology and data. Statistical challenges in data analysis. Preprocessing data normalization and transformation. Useful

More information

Multiplex Assay Design

Multiplex Assay Design Multiplex Assay Design Geeta Bhat, Luminex Molecular Diagnostics; Toronto. APHL/CDC Newborn Screening Molecular Workshop, CDC, Atlanta, GA June 28-30, 2011 Luminex Multiplexed Solutions. For Life. Luminex

More information

Chapter 9 Genetic Engineering

Chapter 9 Genetic Engineering Chapter 9 Genetic Engineering Biotechnology: use of microbes to make a protein product Recombinant DNA Technology: Insertion or modification of genes to produce desired proteins Genetic engineering: manipulation

More information

Exam MOL3007 Functional Genomics

Exam MOL3007 Functional Genomics Faculty of Medicine Department of Cancer Research and Molecular Medicine Exam MOL3007 Functional Genomics Tuesday May 29 th 9.00-13.00 ECTS credits: 7.5 Number of pages (included front-page): 5 Supporting

More information

Gene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays

Gene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays Gene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays Application Note Authors Bahram Arezi, Nilanjan Guha and Anne Bergstrom Lucas Agilent Technologies Inc. Santa

More information

Introduction To Real-Time Quantitative PCR (qpcr)

Introduction To Real-Time Quantitative PCR (qpcr) Introduction To Real-Time Quantitative PCR (qpcr) Samuel Rulli, Ph.D. Samuel.Rulli@QIAGEN.com Technical Support: BRCsupport@qiagen.com The products described in this webinar are intended for molecular

More information

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries

More information

REAL TIME PCR USING SYBR GREEN

REAL TIME PCR USING SYBR GREEN REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM

More information

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

Lecture 8: Sequencing and SNP. Sept 15, 2006

Lecture 8: Sequencing and SNP. Sept 15, 2006 Lecture 8: Sequencing and SNP Sept 15, 2006 Announcements Random questioning during literature discussion sessions starts next week for real! Schedule changes Moved QTL lecture up Removed landscape genetics

More information

Pyrosequencing. Alix Groom

Pyrosequencing. Alix Groom Pyrosequencing Alix Groom Pyrosequencing high-throughput CpG methylation analysis platform real-time, sequence-based detection and quantification % methylation at multiple adjacent CpG sites 80-100 bases

More information

Functional Genomics in Plants

Functional Genomics in Plants Functional Genomics in Plants Jeffrey L Bennetzen, Purdue University, West Lafayette, Indiana, USA Functional genomics refers to a suite of genetic technologies that will contribute to a comprehensive

More information

Microarray Technique. Some background. M. Nath

Microarray Technique. Some background. M. Nath Microarray Technique Some background M. Nath Outline Introduction Spotting Array Technique GeneChip Technique Data analysis Applications Conclusion Now Blind Guess? Functional Pathway Microarray Technique

More information

Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami

Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami hanialhadrami@kau.edu.sa www.hanialhadrami.kau.edu.sa Overview Several techniques are available to detect and analyse RNA. Examples of these techniques

More information

Genome Sequencing Technologies. Jutta Marzillier, Ph.D. Lehigh University Department of Biological Sciences Iacocca Hall

Genome Sequencing Technologies. Jutta Marzillier, Ph.D. Lehigh University Department of Biological Sciences Iacocca Hall Genome Sequencing Technologies Jutta Marzillier, Ph.D. Lehigh University Department of Biological Sciences Iacocca Hall Sciences start with Observation Sciences start with Observation and flourish with

More information

Bioinformatics Advice on Experimental Design

Bioinformatics Advice on Experimental Design Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics

More information

including, but not limited to:

including, but not limited to: *This Section is part of the original Request for Proposal # P08 080. The Contractor should provide the following eligible Scientific Biomedical Research Equipment, Reagents & Supplies including, but not

More information

3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome

3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome Lectures 30 and 31 Genome analysis I. Genome analysis A. two general areas 1. structural 2. functional B. genome projects a status report 1. 1 st sequenced: several viral genomes 2. mitochondria and chloroplasts

More information

Next Gen Sequencing. Expansion of sequencing technology. Contents

Next Gen Sequencing. Expansion of sequencing technology. Contents Next Gen Sequencing Contents 1 Expansion of sequencing technology 2 The Next Generation of Sequencing: High-Throughput Technologies 3 High Throughput Sequencing Applied to Genome Sequencing (TEDed CC BY-NC-ND

More information

Outline. Array platform considerations: Comparison between the technologies available in microarrays

Outline. Array platform considerations: Comparison between the technologies available in microarrays Microarray overview Outline Array platform considerations: Comparison between the technologies available in microarrays Differences in array fabrication Differences in array organization Applications of

More information

Goals of pharmacogenomics

Goals of pharmacogenomics Goals of pharmacogenomics Use drugs better and use better drugs! People inherit/exhibit differences in drug: Absorption Metabolism and degradation of the drug Transport of drug to the target molecule Excretion

More information

Next Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms

Next Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms Next Generation Sequencing Lecture Saarbrücken, 19. March 2012 Sequencing Platforms Contents Introduction Sequencing Workflow Platforms Roche 454 ABI SOLiD Illumina Genome Anlayzer / HiSeq Problems Quality

More information

Session 3 Cloning Overview & Polymerase Chain Reaction

Session 3 Cloning Overview & Polymerase Chain Reaction Session 3 Cloning Overview & Polymerase Chain Reaction Learning Objective: In this lab exercise, you will become familiar with the steps of a polymerase chain reaction, the required reagents for a successful

More information

Quantitative Real Time PCR USING SYBR GREEN

Quantitative Real Time PCR USING SYBR GREEN Quantitative Real Time PCR USING SYBR GREEN SYBR Green SYBR Green is a cyanine dye that binds to double stranded DNA. When it is bound to D.S. DNA it has a much greater fluorescence than when bound to

More information

Chapter 10: Classification of Microorganisms

Chapter 10: Classification of Microorganisms Chapter 10: Classification of Microorganisms 1. The Taxonomic Hierarchy 2. Methods of Identification 1. The Taxonomic Hierarchy Phylogenetic Tree of the 3 Domains Taxonomic Hierarchy 8 successive taxa

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

Introduction to Bioinformatics. Fabian Hoti 6.10.

Introduction to Bioinformatics. Fabian Hoti 6.10. Introduction to Bioinformatics Fabian Hoti 6.10. Analysis of Microarray Data Introduction Different types of microarrays Experiment Design Data Normalization Feature selection/extraction Clustering Introduction

More information

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can

More information

MOLECULAR BIOLOGY OF EUKARYOTES 2016 SYLLABUS

MOLECULAR BIOLOGY OF EUKARYOTES 2016 SYLLABUS 03-442 Lectures: MWF 9:30-10:20 a.m. Doherty Hall 2105 03-742 Advanced Discussion Section: Time and place to be announced Probably Mon 4-6 p.m. or 6-8p.m.? Once we establish who is taking the advanced

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA

More information

SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA

SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA The most sensitive cdna synthesis technology, combined with next-generation

More information

Introduction to Molecular Biology

Introduction to Molecular Biology Introduction to Molecular Biology Bioinformatics: Issues and Algorithms CSE 308-408 Fall 2007 Lecture 2-1- Important points to remember We will study: Problems from bioinformatics. Algorithms used to solve

More information

DNA Microarray Data Oligonucleotide Arrays

DNA Microarray Data Oligonucleotide Arrays DNA Microarray Data Oligonucleotide Arrays Sandrine Dudoit, Robert Gentleman, Rafael Irizarry, and Yee Hwa Yang Bioconductor Short Course 2003 Copyright 2002, all rights reserved Biological question Experimental

More information

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome. Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid

More information

Enabling Systems Biology Driven Proteome Wide Quantitation of Mycobacterium Tuberculosis

Enabling Systems Biology Driven Proteome Wide Quantitation of Mycobacterium Tuberculosis Enabling Systems Biology Driven Proteome Wide Quantitation of Mycobacterium Tuberculosis SWATH Acquisition on the TripleTOF 5600+ System Samuel L. Bader, Robert L. Moritz Institute of Systems Biology,

More information

Biotechnology and Genomics in Public Health. Sharon S. Krag, PhD Johns Hopkins University

Biotechnology and Genomics in Public Health. Sharon S. Krag, PhD Johns Hopkins University This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this

More information

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen

More information

Chromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce

Chromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one

More information

Chapter 11: Regulation of Gene Expression

Chapter 11: Regulation of Gene Expression Chapter Review 1. It has long been known that there is probably a genetic link for alcoholism. Researchers studying rats have begun to elucidate this link. Briefly describe the genetic mechanism found

More information

The Polymerase Chain Reaction. Chapter 6: Background

The Polymerase Chain Reaction. Chapter 6: Background The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for

More information

High Throughput Sequencing Technologies. UCD Genome Center Bioinformatics Core Monday 15 June 2015

High Throughput Sequencing Technologies. UCD Genome Center Bioinformatics Core Monday 15 June 2015 High Throughput Sequencing Technologies UCD Genome Center Bioinformatics Core Monday 15 June 2015 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion 2011 PacBio

More information

CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools. Giri Narasimhan

CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools. Giri Narasimhan CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools Giri Narasimhan ECS 254; Phone: x3748 giri@cis.fiu.edu www.cis.fiu.edu/~giri/teach/bioinfs15.html Gene Expression q Process of transcription

More information

CHAPTER 21 LECTURE SLIDES

CHAPTER 21 LECTURE SLIDES CHAPTER 21 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.

More information

Metabolomics in Systems Biology

Metabolomics in Systems Biology Metabolomics in Systems Biology Basil J. Nikolau W.M. Keck Metabolomics Research Laboratory Iowa State University February 7, 2008 Outline What is metabolomics? Why is metabolomics important? What are

More information

Year III Pharm.D Dr. V. Chitra

Year III Pharm.D Dr. V. Chitra Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves

More information

Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application

Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Gene Expression Author Michelle M. Chen Agilent Technologies, Inc. 3500 Deer Creek Road, MS 25U-7 Palo Alto,

More information

Class Information. Introduction to Genome Biology and Microarray Technology. Biostatistics Rafael A. Irizarry. Lecture 1

Class Information. Introduction to Genome Biology and Microarray Technology. Biostatistics Rafael A. Irizarry. Lecture 1 This work is licensed under a Creative Commons ttribution-noncommercial-sharelike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this

More information

DNA REPLICATION. Anna Onofri Liceo «I.Versari»

DNA REPLICATION. Anna Onofri Liceo «I.Versari» DNA REPLICATION Anna Onofri Liceo «I.Versari» Learning objectives 1. Understand the basic rules governing DNA replication 2. Understand the function of key proteins involved in a generalised replication

More information