BIONF/BENG 203: Functional Genomics
|
|
- Herbert Stevens
- 6 years ago
- Views:
Transcription
1 BIONF/BENG 203: Functional Genomics Sources of Functional Data Lectures 1 and 2 Lecture TI 1,2 Trey Ideker UCSD Departments of Medicine & Bioengineering 1
2 Instructors Trey Ideker Vineet Bafna Anand Patel (TA) 2
3 Grading 40% Problem Sets (best 4 of 5) 30% Midterm 30% Final Project 3
4 Topics Covered By This Course 4 1 Signal detection in bioinformatics 2 Large-scale data generation platforms 3 Understanding next-gen sequencing data 4 Understanding mass spectrometry data 5 Clustering and Classification 6 Genotype-phenotype association 7 Understanding physical & genetic networks 8 Gene network inference and evolution
5 Bioinformatics as Signal Detection Ideker, Dutkowski, Hood. Cell 2011
6 Power, FDR, and all that... Test Statistic t Ideker, Dutkowski, Hood. Cell 2011
7 Power, FDR, and all that... Test Statistic t
8 An Example: Pathway-Level Integration of Genome-wide Association Studies Segrè et al., 2010 A.V. Segrè, L. Groop, V.K. Mootha, M.J. Daly and D. Altshuler, PLoS Genet. 6 (2010), p. e
9 Classes of biological measurements 1) Molecular States DNA sequence / genotype: Next-gen sequencing, SNP & CNV arrays Gene expression: DNA microarrays, mrna sequencing Protein levels, locations, mods: Mass spectrometry, fluorescence microscopy, protein arrays 2) Molecular Networks Protein-protein interactions: Two-hybrid system, coip, protein antibody array Protein-DNA interactions: Chromatin IP (chip) sequencing Protein-compound 3) Phenotypic traits Physiological or disease state, binary or quantitative Growth rate, response to stimulus or stress Behaviors
10 Sequencing By Synthesis (Illumina GenomeAnalyzer or HiSeq)
11
12
13
14
15
16
17
18
19 Bridge Amplification
20 Pyrosequencing Note: No actual houses are burned down in pyrosequencing
21 Pyrosequencing (Life Sciences / Roche 454) A luciferase is an enzyme which emits light in the presence of ATP. Several organisms, such as the American firefly and the poisonous Jack-o-lantern mushroom, produce luciferases.
22 Detecting polymerase activity Recall: Pyrophosphate is also known as PPi, also known as two phosphate groups stuck together. During replication, each addition of a dntp releases pyrophosphate In the reaction mixture, PPi allows adenosine phosphosulfate (APS) to be converted to ATP; this ATP allows luciferase to luciferate (emit light). Measures strand extension as it happens
23 Pyrosequencing cycle Add datp. If light is emitted, your sequence starts with A. If not, the datp is degraded (or elutes past immobilized primer). Add dgtp. If light is emitted, the next base must be a G. Then add T, then C. You now know at least one (maybe more) base of the sequence. Repeat!
24 Pyrosequencing output Runs of bases produce higher peaks for instance, the sequence for (a) is GGCCCTTG. Sample (c) comes from a heterozygous individual (hence the heights in multiples of ½)
25 The X Prize Foundation In October 2006, the X Prize Foundation established an initiative to promote the development of full genome sequencing technologies, called the Archon X Prize, intending to award $10 million to "the first Team that can build a device and use it to sequence 100 human genomes within 10 days or less, with an accuracy of no more than one error in every 100,000 bases sequenced, with sequences accurately covering at least 98% of the genome, and at a recurring cost of no more than $10,000 (US) per genome.
26 Gene and Protein Expression The transcriptome is the full complement of RNA molecules produced by a genome The proteome is the full complement of proteins enabled by the transcriptome DNA RNA protein Genome transcriptome proteome 30,000 genes??? RNAs??? proteins? 26 For example, the drosophila gene Dscam can generate 40,000 distinct transcripts through alternative splicing. What is the minimum number of exons that would be required?
27 mrna Expression: Two dominant approaches RNA sequencing DNA Microarrays 27 Others / older approaches: EST sequencing RT-PCR Differential display SAGE Massively parallel signature sequencing (MPSS)
28 Microarrays Monitors the level of each gene: Is it turned on or off in a particular biological condition? Is this on/off state different between two biological conditions? 28 Microarray is a rectangular grid of spots printed on a glass microscope slide, where each spot contains DNA for a different gene
29 Two-color DNA microarray design Reverse Transcription 29
30 Types of microarrays Spotted (cdna) Robotic transfer of cdna clones or PCR products Spotting on nylon membranes or glass slides coated with poly-lysine Synthetic (oligo) Direct oligo synthesis on solid microarray substrate Uses photolithography (Affymetrix) or ink-jet printing (Agilent) 100,000 features per cm 2 All configurations assume the DNA on the array is in excess of the hybridized sample thus the kinetics are linear and the spot intensity reflects that amount of hybridized sample. 30 Labeling can be radioactive, fluorescent (one-color), or two-color
31 31 Microarray Spotter
32 Affymetrix High Density Arrays
33 Collects sharply defined optical sections from which 3D renderings can be created The key is spatial filtering to eliminate outof-focus light or glare in specimens whose thickness exceeds the immediate plane of focus. Two lasers for excitation Two color scan in less than 10 minutes High resolution, 10 micron pixel size Microarray confocal scanner
34 Next-Gen Sequencing of mrnas cdna = complementary or copy DNA EST = Expressed Sequence Tag The microarray could be described as a closed system because information about RNAs is limited by the targets available for hybridization. RNAs not represented on the array are not interrogated. Direct sequencing of cdnas overcomes this problem by large-scale random sampling of sequences from a wholecell RNA extract Statistical counting of distinct sequences provides a precise estimate of expression level cdna library can be normalized to capture rare messages Has been dramatically enabled by large scale sequencing
35 mrna Sequencing: Preparation of a cdna library in phage vector
36 Proteomics MS / MS 1D and 2D SDS PAGE 36
37 Mass spectrometry Mass spectrometers consist of 3 essential parts Ionization source: Converts peptides into gas-phase ions (MALDI + ESI) Mass analyzer: Separates ions by mass to charge (m/z) ratio (Ion trap, time of flight, quadrupole) Ion detector: Current over time indicates amount of signal at each m/z value 37
38 MS/MS Overview
39 MS/MS Overview
40
41
42 A raw fragmentation spectrum By calculating the molecular weight difference between ions of the same type the sequence can be determined. Algorithms like SEQUEST use the fragmentation pattern to search through a complete protein database to identify the sequence which best fits the pattern.
43 43 Tandem Mass Spec (MS/MS)
44 Isotope Coded Affinity Tags (ICAT) Mass spec based method for measuring relative protein abundances between two samples ICAT Reagents: N O S N O Heavy reagent: d8-icat (X=deuterium) Normal reagent: d0-icat (X=hydrogen) N X X O X X O X X O X X N O I Biotin tag Linker (d0 or d8) Thiol specific reactive group
45 Protein Quantification & Identification via ICAT Strategy Mixture Light Heavy ICATlabeled cysteines Mixture 2 Combine and proteolyze (trypsin) Affinity separation (avidin) m/z Quantitation NH 2 -EACDPLR-COOH ICAT Flash animation: m/z Protein identification
46 ICAT continued The heavy (blue) and light (gray) peptides are separated and quantified to produce a ratio for each peptide here, a single peptide ratio is shown Each peptide is subjected to CID fragmentation in the second MS stage in order to identify it
47 Gene replacement for yeast & other model species Using HR-based gene replacement, genes can be replaced with drug resistance cassette, tagged with GFP, epitope tagged, etc.
48 Systematic phenotyping Barcode (UPTAG): Deletion Strain: CTAACTC TCGCGCA TCATAAT yfg1 yfg2 yfg3 Rich media Growth 6hrs in minimal media (how many doublings?) Harvest and label genomic DNA
49 Systematic phenotyping with a barcode array Ron Davis and friends These oligo barcodes are also spotted on a DNA microarray Growth time in minimal media: Red: 0 hours Green: 6 hours
50 YFP tagging for protein localization YPF is green, transmitted light is red NIC96 Nuclear Pore TUB1 Tubulin cytoskeleton HHF2 Histone Nucleus BNI4 Bud neck Images courtesy T. Davis lab See also work by Weissman and O Shea labs at UCSF
51 Molecular Interactions Among proteins, mrna, small molecules, and so on 51
52 52 Protein DNA interactions Chromatin IP DNA microarray Gene levels (on/off) Protein protein interactions Protein coip Mass spectrometry Protein levels (present/absent) Biochemical reactions Not yet!!! Metabolic flux measurements Biochemical levels
53 Measurements of molecular interactions Protein-protein interactions Yeast-two-hybrid Kinase-substrate assays Co-immunoprecipitation w/ mass spec Protein-DNA interactions ChIP-on-chip and ChIP-seq 53 Genetic interactions Systematic Genetic Analysis
54 Yeast two-hybrid method 54 Fields and Song
55 Kinase-target interactions 55 Mike Snyder and colleagues
56 Protein interactions by protein immunoprecipitation followed by mass spectrometry TEV = Tobacco Etch Virus proteolytic site CBP = Calmodulin binding peptide Protein A = IgG binding from Staphylococcus 56 Gavin / Cellzome
57 ChIP measurement of protein DNA interactions From Figure 1 of Simon et al. Cell 2001
58 Genetic interactions: synthetic lethals and suppressors Genetic Interactions: Widespread method used by geneticists to discover pathways in yeast, fly, and worm Implications for drug targeting and drug development for human disease Thousands are now reported in literature and systematic studies As with other types, the number of known genetic interactions is exponentially increasing Adapted from Tong et al., Science 2001
59 Most recorded genetic interactions are synthetic lethal relationships A B A B A B A B 59 Adapted from Hartman, Garvik, and Hartwell, Science 2001
60 Interpretation of genetic interactions (Guarente T.I.G. 1990) Parallel Effects (Redundant or Additive) Sequential Effects (Additive) A GOAL: Identify downstream B physical pathways A B Single A or B mutations typically abolish their biochemical activities Single A or B mutations typically reduce their biochemical activities
Gene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationMBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1. Lecture 25: Mass Spectrometry Applications
MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1 Lecture 25: Mass Spectrometry Applications Measuring Protein Abundance o ICAT o DIGE Identifying Post-Translational Modifications Protein-protein
More informationRecent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)
Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on
More informationMethods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
More informationPlease purchase PDFcamp Printer on to remove this watermark. DNA microarray
DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of
More informationProteomics And Cancer Biomarker Discovery. Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar. Overview. Cancer.
Proteomics And Cancer Biomarker Discovery Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar Overview Proteomics Cancer Aims Tools Data Base search Challenges Summary 1 Overview
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More informationIntroduction to Bioinformatics and Gene Expression Technologies
Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a
More informationDNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
More information3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
More informationNPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA
LECTURE-03 GENOMICS AND TRANSCRIPTOMICS: WHY PROTEOMICS? TRANSCRIPT Welcome to the proteomics course. Today, we will talk about Genomics and Transcriptomics and then we will talk about why to study proteomics?
More informationIntroduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationDNA Microarray Technology
CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic
More informationProteomics. Proteomics is the study of all proteins within organism. Challenges
Proteomics Proteomics is the study of all proteins within organism. Challenges 1. The proteome is larger than the genome due to alternative splicing and protein modification. As we have said before we
More informationSIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology.
SIMS2003 Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School Introduction to Microarray Technology. Lecture 1 I. EXPERIMENTAL DETAILS II. ARRAY CONSTRUCTION III. IMAGE ANALYSIS Lecture
More informationMIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr.
MIT Department of Biology 7.01: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel iv) Would Xba I be useful for cloning? Why or why not?
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationCHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
More informationProteomics: A Challenge for Technology and Information Science. What is proteomics?
Proteomics: A Challenge for Technology and Information Science CBCB Seminar, November 21, 2005 Tim Griffin Dept. Biochemistry, Molecular Biology and Biophysics tgriffin@umn.edu What is proteomics? Proteomics
More informationGenome Biology and Biotechnology
Genome Biology and Biotechnology 10. The proteome Prof. M. Zabeau Department of Plant Systems Biology Flanders Interuniversity Institute for Biotechnology (VIB) University of Gent International course
More informationIntroductory Next Gen Workshop
Introductory Next Gen Workshop http://www.illumina.ucr.edu/ http://www.genomics.ucr.edu/ Workshop Objectives Workshop aimed at those who are new to Illumina sequencing and will provide: - a basic overview
More informationProteomics. Areas of Application for Proteomics. Most Commonly Used Proteomics Techniques: Limitations: Examples
Proteomics Areas of Application for Proteomics Most Commonly Used Proteomics Techniques: Antibody arrays Protein activity arrays 2-D gels ICAT technology SELDI Limitations: protein sources surfaces and
More informationResearch school methods seminar Genomics and Transcriptomics
Research school methods seminar Genomics and Transcriptomics Stephan Klee 19.11.2014 2 3 4 5 Genetics, Genomics what are we talking about? Genetics and Genomics Study of genes Role of genes in inheritence
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationAdvances in analytical biochemistry and systems biology: Proteomics
Advances in analytical biochemistry and systems biology: Proteomics Brett Boghigian Department of Chemical & Biological Engineering Tufts University July 29, 2005 Proteomics The basics History Current
More informationRecombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
More informationLecture 25 (11/15/17)
Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);
More informationChapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi
Chapter 17. PCR the polymerase chain reaction and its many uses Prepared by Woojoo Choi Polymerase chain reaction 1) Polymerase chain reaction (PCR): artificial amplification of a DNA sequence by repeated
More informationEECS730: Introduction to Bioinformatics
EECS730: Introduction to Bioinformatics Lecture 14: Microarray Some slides were adapted from Dr. Luke Huan (University of Kansas), Dr. Shaojie Zhang (University of Central Florida), and Dr. Dong Xu and
More informationAP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
More informationThe Two-Hybrid System
Encyclopedic Reference of Genomics and Proteomics in Molecular Medicine The Two-Hybrid System Carolina Vollert & Peter Uetz Institut für Genetik Forschungszentrum Karlsruhe PO Box 3640 D-76021 Karlsruhe
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More informationFor quantitative methylation and mutation analysis using Pyrosequencing technology in a 24-well format
ProductProfile PyroMark Q24 For quantitative methylation and mutation analysis using Pyrosequencing technology in a 24-well format The PyroMark Q24 uses proven Pyrosequencing technology for real-time,
More informationFunctional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017
Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Agenda What is Functional Genomics? RNA Transcription/Gene Expression Measuring Gene
More informationWhat is a microarray
DNA Microarrays What is a microarray A surface on which sequences from thousands of different genes are covalently attached to fixed locations (probes). Glass slides Silicon chips Utilize the selective
More information6. GENE EXPRESSION ANALYSIS MICROARRAYS
6. GENE EXPRESSION ANALYSIS MICROARRAYS BIOINFORMATICS COURSE MTAT.03.239 16.10.2013 GENE EXPRESSION ANALYSIS MICROARRAYS Slides adapted from Konstantin Tretyakov s 2011/2012 and Priit Adlers 2010/2011
More informationChapter 20: Biotechnology
Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter
More informationHuman genome sequence
NGS: the basics Human genome sequence June 26th 2000: official announcement of the completion of the draft of the human genome sequence (truly finished in 2004) Francis Collins Craig Venter HGP: 3 billion
More informationGenetics Lecture 21 Recombinant DNA
Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of
More informationChapter 10 Analytical Biotechnology and the Human Genome
Chapter 10 Analytical Biotechnology and the Human Genome Chapter Outline Enzyme tests and biosensors DNA-based tests DNA analysis technologies Human genome and genome-based analytical methods 1 Enzyme-based
More informationContents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
More informationWelcome to the NGS webinar series
Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic
More informationChapter 15 Gene Technologies and Human Applications
Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect
More informationTrasposable elements: Uses of P elements Problem set B at the end
Trasposable elements: Uses of P elements Problem set B at the end P-elements have revolutionized the way Drosophila geneticists conduct their research. Here, we will discuss just a few of the approaches
More informationQIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd
QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s
More informationRNA-Sequencing analysis
RNA-Sequencing analysis Markus Kreuz 25. 04. 2012 Institut für Medizinische Informatik, Statistik und Epidemiologie Content: Biological background Overview transcriptomics RNA-Seq RNA-Seq technology Challenges
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationLATE-PCR. Linear-After-The-Exponential
LATE-PCR Linear-After-The-Exponential A Patented Invention of the Laboratory of Human Genetics and Reproductive Biology Lab. Director: Lawrence J. Wangh, Ph.D. Department of Biology, Brandeis University,
More informationKinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets)
Quiz 1 Kinetics Review Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets) I will post the problems with solutions on Toolkit for those that can t make
More information2. Outline the levels of DNA packing in the eukaryotic nucleus below next to the diagram provided.
AP Biology Reading Packet 6- Molecular Genetics Part 2 Name Chapter 19: Eukaryotic Genomes 1. Define the following terms: a. Euchromatin b. Heterochromatin c. Nucleosome 2. Outline the levels of DNA packing
More informationINTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
More informationIntroduction to gene expression microarray data analysis
Introduction to gene expression microarray data analysis Outline Brief introduction: Technology and data. Statistical challenges in data analysis. Preprocessing data normalization and transformation. Useful
More informationMultiplex Assay Design
Multiplex Assay Design Geeta Bhat, Luminex Molecular Diagnostics; Toronto. APHL/CDC Newborn Screening Molecular Workshop, CDC, Atlanta, GA June 28-30, 2011 Luminex Multiplexed Solutions. For Life. Luminex
More informationChapter 9 Genetic Engineering
Chapter 9 Genetic Engineering Biotechnology: use of microbes to make a protein product Recombinant DNA Technology: Insertion or modification of genes to produce desired proteins Genetic engineering: manipulation
More informationExam MOL3007 Functional Genomics
Faculty of Medicine Department of Cancer Research and Molecular Medicine Exam MOL3007 Functional Genomics Tuesday May 29 th 9.00-13.00 ECTS credits: 7.5 Number of pages (included front-page): 5 Supporting
More informationGene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays
Gene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays Application Note Authors Bahram Arezi, Nilanjan Guha and Anne Bergstrom Lucas Agilent Technologies Inc. Santa
More informationIntroduction To Real-Time Quantitative PCR (qpcr)
Introduction To Real-Time Quantitative PCR (qpcr) Samuel Rulli, Ph.D. Samuel.Rulli@QIAGEN.com Technical Support: BRCsupport@qiagen.com The products described in this webinar are intended for molecular
More informationM Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour
Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries
More informationREAL TIME PCR USING SYBR GREEN
REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM
More informationIntroduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute
Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationLecture 8: Sequencing and SNP. Sept 15, 2006
Lecture 8: Sequencing and SNP Sept 15, 2006 Announcements Random questioning during literature discussion sessions starts next week for real! Schedule changes Moved QTL lecture up Removed landscape genetics
More informationPyrosequencing. Alix Groom
Pyrosequencing Alix Groom Pyrosequencing high-throughput CpG methylation analysis platform real-time, sequence-based detection and quantification % methylation at multiple adjacent CpG sites 80-100 bases
More informationFunctional Genomics in Plants
Functional Genomics in Plants Jeffrey L Bennetzen, Purdue University, West Lafayette, Indiana, USA Functional genomics refers to a suite of genetic technologies that will contribute to a comprehensive
More informationMicroarray Technique. Some background. M. Nath
Microarray Technique Some background M. Nath Outline Introduction Spotting Array Technique GeneChip Technique Data analysis Applications Conclusion Now Blind Guess? Functional Pathway Microarray Technique
More informationReverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami
Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami hanialhadrami@kau.edu.sa www.hanialhadrami.kau.edu.sa Overview Several techniques are available to detect and analyse RNA. Examples of these techniques
More informationGenome Sequencing Technologies. Jutta Marzillier, Ph.D. Lehigh University Department of Biological Sciences Iacocca Hall
Genome Sequencing Technologies Jutta Marzillier, Ph.D. Lehigh University Department of Biological Sciences Iacocca Hall Sciences start with Observation Sciences start with Observation and flourish with
More informationBioinformatics Advice on Experimental Design
Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics
More informationincluding, but not limited to:
*This Section is part of the original Request for Proposal # P08 080. The Contractor should provide the following eligible Scientific Biomedical Research Equipment, Reagents & Supplies including, but not
More information3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome
Lectures 30 and 31 Genome analysis I. Genome analysis A. two general areas 1. structural 2. functional B. genome projects a status report 1. 1 st sequenced: several viral genomes 2. mitochondria and chloroplasts
More informationNext Gen Sequencing. Expansion of sequencing technology. Contents
Next Gen Sequencing Contents 1 Expansion of sequencing technology 2 The Next Generation of Sequencing: High-Throughput Technologies 3 High Throughput Sequencing Applied to Genome Sequencing (TEDed CC BY-NC-ND
More informationOutline. Array platform considerations: Comparison between the technologies available in microarrays
Microarray overview Outline Array platform considerations: Comparison between the technologies available in microarrays Differences in array fabrication Differences in array organization Applications of
More informationGoals of pharmacogenomics
Goals of pharmacogenomics Use drugs better and use better drugs! People inherit/exhibit differences in drug: Absorption Metabolism and degradation of the drug Transport of drug to the target molecule Excretion
More informationNext Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms
Next Generation Sequencing Lecture Saarbrücken, 19. March 2012 Sequencing Platforms Contents Introduction Sequencing Workflow Platforms Roche 454 ABI SOLiD Illumina Genome Anlayzer / HiSeq Problems Quality
More informationSession 3 Cloning Overview & Polymerase Chain Reaction
Session 3 Cloning Overview & Polymerase Chain Reaction Learning Objective: In this lab exercise, you will become familiar with the steps of a polymerase chain reaction, the required reagents for a successful
More informationQuantitative Real Time PCR USING SYBR GREEN
Quantitative Real Time PCR USING SYBR GREEN SYBR Green SYBR Green is a cyanine dye that binds to double stranded DNA. When it is bound to D.S. DNA it has a much greater fluorescence than when bound to
More informationChapter 10: Classification of Microorganisms
Chapter 10: Classification of Microorganisms 1. The Taxonomic Hierarchy 2. Methods of Identification 1. The Taxonomic Hierarchy Phylogenetic Tree of the 3 Domains Taxonomic Hierarchy 8 successive taxa
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationIntroduction to Bioinformatics. Fabian Hoti 6.10.
Introduction to Bioinformatics Fabian Hoti 6.10. Analysis of Microarray Data Introduction Different types of microarrays Experiment Design Data Normalization Feature selection/extraction Clustering Introduction
More informationCHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning
Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can
More informationMOLECULAR BIOLOGY OF EUKARYOTES 2016 SYLLABUS
03-442 Lectures: MWF 9:30-10:20 a.m. Doherty Hall 2105 03-742 Advanced Discussion Section: Time and place to be announced Probably Mon 4-6 p.m. or 6-8p.m.? Once we establish who is taking the advanced
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationSMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA
SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA The most sensitive cdna synthesis technology, combined with next-generation
More informationIntroduction to Molecular Biology
Introduction to Molecular Biology Bioinformatics: Issues and Algorithms CSE 308-408 Fall 2007 Lecture 2-1- Important points to remember We will study: Problems from bioinformatics. Algorithms used to solve
More informationDNA Microarray Data Oligonucleotide Arrays
DNA Microarray Data Oligonucleotide Arrays Sandrine Dudoit, Robert Gentleman, Rafael Irizarry, and Yee Hwa Yang Bioconductor Short Course 2003 Copyright 2002, all rights reserved Biological question Experimental
More informationIntroducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.
Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid
More informationEnabling Systems Biology Driven Proteome Wide Quantitation of Mycobacterium Tuberculosis
Enabling Systems Biology Driven Proteome Wide Quantitation of Mycobacterium Tuberculosis SWATH Acquisition on the TripleTOF 5600+ System Samuel L. Bader, Robert L. Moritz Institute of Systems Biology,
More informationBiotechnology and Genomics in Public Health. Sharon S. Krag, PhD Johns Hopkins University
This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationChromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce
Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one
More informationChapter 11: Regulation of Gene Expression
Chapter Review 1. It has long been known that there is probably a genetic link for alcoholism. Researchers studying rats have begun to elucidate this link. Briefly describe the genetic mechanism found
More informationThe Polymerase Chain Reaction. Chapter 6: Background
The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for
More informationHigh Throughput Sequencing Technologies. UCD Genome Center Bioinformatics Core Monday 15 June 2015
High Throughput Sequencing Technologies UCD Genome Center Bioinformatics Core Monday 15 June 2015 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion 2011 PacBio
More informationCAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools. Giri Narasimhan
CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools Giri Narasimhan ECS 254; Phone: x3748 giri@cis.fiu.edu www.cis.fiu.edu/~giri/teach/bioinfs15.html Gene Expression q Process of transcription
More informationCHAPTER 21 LECTURE SLIDES
CHAPTER 21 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.
More informationMetabolomics in Systems Biology
Metabolomics in Systems Biology Basil J. Nikolau W.M. Keck Metabolomics Research Laboratory Iowa State University February 7, 2008 Outline What is metabolomics? Why is metabolomics important? What are
More informationYear III Pharm.D Dr. V. Chitra
Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves
More informationUsing Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application
Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Gene Expression Author Michelle M. Chen Agilent Technologies, Inc. 3500 Deer Creek Road, MS 25U-7 Palo Alto,
More informationClass Information. Introduction to Genome Biology and Microarray Technology. Biostatistics Rafael A. Irizarry. Lecture 1
This work is licensed under a Creative Commons ttribution-noncommercial-sharelike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this
More informationDNA REPLICATION. Anna Onofri Liceo «I.Versari»
DNA REPLICATION Anna Onofri Liceo «I.Versari» Learning objectives 1. Understand the basic rules governing DNA replication 2. Understand the function of key proteins involved in a generalised replication
More information