Lab-on-a-Chip. Lecture Outline

Size: px
Start display at page:

Download "Lab-on-a-Chip. Lecture Outline"

Transcription

1 Lab-on-a-Chip Dr. Thara Srinivasan Lecture 20 Picture credit: Anderson et al. Lecture Outline Reading from reader Auroux, P.-A., Manz, A. et al., Micro Total Analysis Systems, (2002) pp Krishnan, M., et al., Microfabricated Reaction and Separation Systems, (2001) pp Quake, S., R, and A. Scherer, From Micro- to Nanofabrication Using Soft Materials, (2001) pp Today s Lecture Lab-on-a-Chip Concept and Examples Application to Proteomics Lab-on-a-Chip Subunits Sample handling Reactors Separation Methods Detection 2

2 Lab-on-a-Chip Micro total analysis system (µ-tas) Vision proposed by Manz, Widmer and Harrison in early 90 s Perform sample addition, pretreatment and transport, chemical reactions, separation, and detection on a microscope slide or credit card size chip Annual conference, MicroTAS, had 700 attendees in 02 Saves reagents and labor Increases testing throughput Creates portable systems Applications Genomics and proteomics Environmental assays Medical diagnostics Drug discovery Chemical production Cellular analysis 3 Affymetrix Lab-on-a-Chip Multiple operations performed Cell lysis Sample concentration Enzymatic reactions such as reverse transcription, PCR, DNAse digestion and terminal transferase labeling Dilution, hybridization, and washing Dye staining Anderson et al. 4

3 U of M Lab-on-a-Chip Mastrangelo and Burns groups integrated device Nanoliter liquid injector Sample mixing and positioning system Temperaturecontrolled PCR reaction chamber Electrophoretic separation Fluorescent photodetector 5 Microscope-on-a-Chip 6

4 Proteomics A proteome is the set of proteins encoded by a gene Proteomics Identifying all the proteins made by a given cell, tissue or organism Determining how the proteins network among themselves Finding out precise 3D structures of the proteins Proteins more complex than genes DNA: 4 bases, proteins: 20 amino acids Even with a protein s sequence, its function and networks still unknown 3D shape of folded protein difficult to predict All human cells have same genome, but differ in which genes are active and which proteins are made ~40,000 human genes, each gene can encode several proteins (typical cell makes 100,000 s proteins) 7 Scientific American April

5 Necessary Subunits for µ-tas Sample handling Extraction Mixers Valves Pumps Reactors Separation Detection 9 Sample Extraction Means for extracting samples from dilute solutions required At macroscale, centrifugal force is used For microfluidics, sample extraction is interface to macroscale Most of the power consumption is spent at this step Methods include Filtration Chromatography 10

6 Extraction Using Filters Microfabricated filters Mechanically robust to withstand high pressure drops for filtering µm-sized particles Very uniform pore sizes determined by Photolithography Sacrificial layer thickness C.-M. Ho group, UCLA Keller et al., UCB 11 Solid-Phase Extraction As in chromatography, Desired components bind reversibly to a coated porous solid and are later flushed out by a change in solvent Hydrophobic coatings bind nonpolar compounds in aqueous flow Bead chambers Hydrophobic beads trapped in a flow chamber Harrison group, Univ. of Alberta Stemme group, Sweden 12

7 Extraction Using Porous Polymers Porous polymers increase available surface area for binding interactions Fill channels with polymerization mixture ~ monomers, initiator, and porogenic solvent Irradiate chip with UV light through photomask Surface chemistry may be varied widely Fréchet group, UCB 13 Extraction by Diffusion Mixing in low Re flows is nearly reversible Two flows that have been stirred together may be unstirred except for any mixing by diffusion by reversing the driving force Can we use irreversibility of diffusive mixing in reversibly stirred flows to separate chemical species based on size? 14

8 Extraction by Diffusion As two parallel laminar flows contact, diffusion extracts certain components Components with higher diffusivity extracted Micronics H-filter pull elements out of sample into diluent 15 Necessary Subunits for µ-tas Sample handling Preparation Mixers Pumps Valves Reactors Separation Detection 16

9 Mixing Mixing of particles, cells and molecules often determines the system efficiency PCR, DNA hybridization, cell lyses Diffusion, the mechanism of mixing at the microscale, still requires relatively long times for thorough mixing. How to assist mixing? Repeated lamination of flows increases contact area and decreases diffusion length C.-M. Ho Group, UCLA 17 Chaotic flows can be very efficient mixers Changing surface topography of microchannel floor induces chaotic flows Stroock et al., Whitesides Group, Harvard 18

10 Necessary Subunits for µ-tas Sample handling Preparation Mixers Pumps Valves Reactors Separation Detection 19 Pumping Mechanisms Pressure gradients Electrokinetic forces Surface tension forces Electrowetting Thermocapillary Surface acoustic waves Magnetohydrodynamic Dielectrophoresis C. M.Ho 20

11 Centrifugal Forces Gyros, Sweden When CD spins, centrifugal force causes liquids on their surface to move outwards. The force can drive liquids through microchannels even breaking through hydrophobic barriers in the channels, releasing different chemicals selectively 21 Electrowetting Electrical potential can control surface tension on a dielectric solid surface Asymmetric contact angles generate internal pressure imbalance, leading to movement Fluidic operations can be done on discrete droplets Low voltages: 25 V DC for v = 30 mm/s; 100V AC for v = 200 mm/s CJ Kim group, UCLA cosθ( V ) = cosθ εε 0V 2 t γ LV 22

12 Thermocapillary Pumping Thermocapillary effect Local heating reduces surface tension, pulling liquid towards cooler surface Surface temperature manipulated by embedded heaters Results v = 600 µm/s for liquid PDMS + Low operating voltage (2-3 V) + Works with polar and non-polar liquids Thermocapillary mixer ~1000 faster than diffusion Troian group, Princeton U. 23 Thermocapillary Mixer ~1000 faster than diffusion Troian group, Princeton U. 24

13 Surface Acoustic Waves More on ultrasonic fluidic devices at White group, BSAC Sandia Labs 25 Necessary Subunits for µ-tas Sample handling Preparation Mixers Pumps Valves Reactors Separation Detection 26

14 Elastomer Valves A good valve needs flexibility and a valve seat that closes completely Microfabricated poly-si valves: microactuator forces limited, so stiffness limits minimum size For elastomers, Young s Modulus can be tuned over 2 orders of magnitude PDMS valves and pumps made by replica molding Crossed channel layout; channels 100 µm wide, 10 µm high When P is applied to upper channel, membrane deflects, closing lower channel Response time 1 ms, applied P = 100kPa Dead volume is zero for on-off valve Unger et al., Quake group 27 Valves and Pumping Peristaltic pumping with elastomer valves 3 valves on a single channel (closing pattern: 101, 100, 110, 010, 011, 001) 2.35 nl/s at 75 Hz, 1 mn force Avoids drawbacks of EO pumping Dependence on medium Electrolytic bubble formation Difficulty setting voltages when many junctions present Flow stops and gas vents Hydrophobic patches Hydrophobic membrane vents Thermally-generated bubbles Unger et al., Quake group, Caltech 28

15 Necessary Subunits for µ-tas Sample handling Preparation Mixers Pumps Valves Reactors Separation Detection Jensen group, MIT 29 Immunoassay Reactor Immunoassays Important analytical method for clinical diagnostics, environmental analyses, and biochemical studies. Antigens and antibodies are fixed onto a solid support ELISA = Enzyme-Linked ImmunoSorbent Assay Point of care testing using microfluidics Enhanced reaction efficiency Simplified procedures Reduced assay time Lower sample & energy consumption Sato et al., University of Tokyo 30

16 Clinical Diagnosis On-Chip Diagnosis of colon cancer by detection of human carcinoembryonic antigen (CEA) in serum on-chip Polystyrene beads coated with antibody in microchannel, antigenantibody complex detected optically Liquid handling significantly simplified Assay time reduced to ~1% (45 h to 35 min) Compared to conventional ELISA, detection limit dozens of times lower High throughput analysis using branching channels for simultaneous analysis Sato et al., University of Tokyo 31 Necessary Subunits for µ-tas Sample handling Preparation Mixers Pumps Valves Reactors Separation Detection 32

17 Separation by Electrophoresis Current standard method for protein sizing Sodium Dodecyl Sulfate-PolyAcrylamide Gel Electrophoresis (SDS-PAGE) SDS denatures proteins and gives them charge; PAGE separates by size Protein electrophoresis on chip Steps: sample loading (protein + SDS), dye labeling (staining), separation, SDS dilution and destaining, and detection Staining and SDS dilution steps occur in 100 s ms, 10 4 faster than macroscale Sequential analysis of 11 samples, sizing accuracy >5%, sensitivity 30 nm Video clip at 33 Separation by Isoelectric Focusing Isoelectric focusing (IEF) is electrophoresis in a ph gradient (cathode at higher ph) A protein s isoelectric point (pi) is the ph at which it has neutral charge Charged species stop moving when EP pushes them to their pi Linear ph gradient built up using ampholytes IEF concentrates and separates Issues + IEF downscales well since resolution is independent of channel length, in contrast to CE EP focusing effect counteracted by diffusion, yielding Gaussian band distribution Dilute base Higher ph, (-) pi = 3 min dph D dx L dµ V dph Dilute acid lower ph, (+) 34

18 IEF On-Chip Advantages Sample mobilization unnecessary No injection plug so separation does not depend on initial sample shape Short channel length gives rapid analysis and Full field detection by imaging with inexpensive CCD Challenge High field with shorter separation length leads to increased Joule heating 35 Separation by Entropic Traps Channels with nanoscale constrictions Require long DNA to repeatedly change conformation, costing entropic free energy Longer DNA has higher mobility Separation No sieving medium needed 5-kbp sample at 80 V/cm in 30 min Longer channels for better separations; resolution not as good as CE Sample concentration At low E, DNA is trapped into band Craighead group, Cornell 36

19 Separation by Diffusion Using 2-D obstacle course and electric field in y direction Asymmetric obstacles rectify Brownian motion (diffusion) of molecules Faster-diffusing species move more in +x direction Results Obstacles: µm² at 45 angle No sieving medium; low E (1.4 V/cm); may be applied to DNA, proteins, cells, etc. v = 1-15 µm/s, for a 10 cm sieve Bandwidth = 200 µm for 15 kbp DNA (R G = 0.31 µm) Chou, Austin groups, Princeton, Craighead group, Cornell 37 Necessary Subunits for µ-tas Sample handling Preparation Mixers Pumps Valves Reactors Separation Detection 38

20 Detection: Chemiluminescence Chemiluminescence (CL) or electrochemiluminescence (ECL) Ru(bpy) 3 +2 oxidized chemically or electrochemically to Ru(bpy) 3 +3 which Reacts with amines, amino acids, glucose, PCR products, etc and emits light at 620 nm Advantages Laser not required Instruments much simpler than for LIF Low to zero background signal; sensitivity high Scaling benefits ~ microphotodetector for on-chip detection Challenges Need for robust and/or universal probes Isolation of ECL electrodes from CE high voltage 39 Electrochemical Detection Electrochemical detection (EC) Control potential of working electrode and monitor current as samples pass by Applied potential is driving force for electrochemical reactions of sample analytes, current reflects concentration of compounds Benefits and challenges On-chip detection; truly portable Chemistries need to be developed Rossier et al. integrated screen-printed carbon ink electrodes into plastic microchannels and demonstrated detection limit of ~1 fmol for ferrocenecarboxylic acid (2001). (EPL, Lausanne) 40

21 Mass Spectrometry Mass spectrometry (MS) measures mass-to-charge ratios (m/z) of species fragments Electrospray ionization spectrometry (ESI) is recent, powerful technique Dilute solution of analyte ( M) is sprayed from capillary tip at high potential (3-4 kv) Liquid forms Taylor cone, fine jet of tiny charged droplets which blow apart due to charge repulsion Nanospray uses smaller glass capillaries for lower flows (20-50 nl/min) 2-30 µm New Objective 41 Proteomics-on-a-Chip Integrated chromatography + CE + ESI Photolithography and wet-etching of Corning 0211 glass Nanospray emitter placed into a flat-bottomed hole drilled into the exit of separation channel Bead channel for sample concentration 800 µm wide, 150 µm deep, 22 mm long, etched into the cover plate (2.4 µl volume) Filled with bead suspension slurry Low flow resistance of bead channel allows sample loading without perturbing CE channel. Results Flowrate ~ 2 µl/min Throughput ~ 5 min/sample Sensitivity ~ 25 fmol (5 nm) Harrison Group, U. of Alberta 42

22 ESI On-Chip 2 Fabrication Polymer chip embossed from silicon master Electrospray tip is flat parylene C triangle (5 µm thick) sandwiched between channel chip and sealing cover Tip is wet by analyte, helping to form and fix position of Taylor cone Results Low dead volume connection Stable ion current na measured using kv potentials Analyte liquid is completely confined on triangular tip Cone volume estimated as 0.06 nl Craighead group, Cornell U 43 More Topics Cell culturing Cell handling Dielectrophoresis Optical tweezers Protein crystallization Interfacing between micro-macroworlds Materials and surfaces Microfluidic/nanofluidic components, modeling Applications Many more 44

Proteomics. Proteomics is the study of all proteins within organism. Challenges

Proteomics. Proteomics is the study of all proteins within organism. Challenges Proteomics Proteomics is the study of all proteins within organism. Challenges 1. The proteome is larger than the genome due to alternative splicing and protein modification. As we have said before we

More information

Protein Microarrays?

Protein Microarrays? Protein Microarrays? Protein Chemistry/Proteomics Unit and the Neuroscience Program,Biomedicum Helsinki E-Mail: marc.baumann@helsinki.fi (http://research.med.helsinki.fi/corefacilities/proteinchem) What

More information

Electrophoresis and the Agilent Bioanalyzer. Advanced Biotechnology Lab I Florida Atlantic University January 23, 2008

Electrophoresis and the Agilent Bioanalyzer. Advanced Biotechnology Lab I Florida Atlantic University January 23, 2008 Electrophoresis and the Agilent Bioanalyzer Advanced Biotechnology Lab I Florida Atlantic University January 23, 2008 Introduction Electrophoresis is one of the most commonlyused methods of separating

More information

Protein Techniques 1 APPENDIX TO CHAPTER 5

Protein Techniques 1 APPENDIX TO CHAPTER 5 Protein Techniques 1 APPENDIX T CHAPTER 5 Dialysis and Ultrafiltration If a solution of protein is separated from a bathing solution by a semipermeable membrane, small molecules and ions can pass through

More information

LabChip 90 System with DataViewer Software

LabChip 90 System with DataViewer Software Revolutionizing DNA and Protein Gel Electrophoresis LabChip 90 System with DataViewer Software The Proven Alternative to Slab Gels. The massive flow of information emerging from today s genomic and proteomic

More information

Disposable microfluidic devices: fabrication, function, and application

Disposable microfluidic devices: fabrication, function, and application Disposable microfluidic devices: fabrication, function, and application Gina S. Fiorini and Daniel T. Chiu BioTechniques 38:429-446 (March 2005) This review article describes recent developments in microfluidics,

More information

Proteomics And Cancer Biomarker Discovery. Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar. Overview. Cancer.

Proteomics And Cancer Biomarker Discovery. Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar. Overview. Cancer. Proteomics And Cancer Biomarker Discovery Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar Overview Proteomics Cancer Aims Tools Data Base search Challenges Summary 1 Overview

More information

Purification: Step 1. Lecture 11 Protein and Peptide Chemistry. Cells: Break them open! Crude Extract

Purification: Step 1. Lecture 11 Protein and Peptide Chemistry. Cells: Break them open! Crude Extract Purification: Step 1 Lecture 11 Protein and Peptide Chemistry Cells: Break them open! Crude Extract Total contents of cell Margaret A. Daugherty Fall 2003 Big Problem: Crude extract is not the natural

More information

Purification: Step 1. Protein and Peptide Chemistry. Lecture 11. Big Problem: Crude extract is not the natural environment. Cells: Break them open!

Purification: Step 1. Protein and Peptide Chemistry. Lecture 11. Big Problem: Crude extract is not the natural environment. Cells: Break them open! Lecture 11 Protein and Peptide Chemistry Margaret A. Daugherty Fall 2003 Purification: Step 1 Cells: Break them open! Crude Extract Total contents of cell Big Problem: Crude extract is not the natural

More information

NPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA

NPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA LECTURE-06 PROTEIN PURIFICATION AND PEPTIDE ISOLATION USING CHROMATOGRAPHY TRANSCRIPT Welcome to the proteomics course. Today, we will talk about protein purification and peptide isolation using chromatography

More information

Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer. Application Note. Odilo Mueller. Abstract

Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer. Application Note. Odilo Mueller. Abstract Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer Application Note Odilo Mueller Abstract This application note describes how the Agilent Technologies 2100 bioanalyzer can be used

More information

Novel Microfluidic Valving and Packaging Designs for Protein Containing Biochips

Novel Microfluidic Valving and Packaging Designs for Protein Containing Biochips Novel Microfluidic Valving and Packaging Designs for Protein Containing Biochips Chunmeng Lu and L. James Lee Department of Chemical and Biomolecular Engineering The Ohio State University Lab-on on-a-chip

More information

Molecular characterization, detection & quantitation of biological products Purin Charoensuksai, PhD

Molecular characterization, detection & quantitation of biological products Purin Charoensuksai, PhD Molecular characterization, detection & quantitation of biological products Purin Charoensuksai, PhD Department of Biopharmacy, Faculty of Pharmacy, Silpakorn University Example of critical checkpoints

More information

PA 800 plus Catalog. Systems/Software

PA 800 plus Catalog. Systems/Software PA 800 plus Catalog Built on 20 years of innovation and leadership in the field of capillary electrophoresis, Beckman Coulter s PA 800 plus provides solutions for protein purity analysis, charge heterogeneity

More information

Types of chromatography

Types of chromatography Chromatography Physical separation method based on the differential migration of analytes in a mobile phase as they move along a stationary phase. Mechanisms of Separation: Partitioning Adsorption Exclusion

More information

3.1.4 DNA Microarray Technology

3.1.4 DNA Microarray Technology 3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns

More information

Kinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets)

Kinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets) Quiz 1 Kinetics Review Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets) I will post the problems with solutions on Toolkit for those that can t make

More information

Leveraging the Precision of Electroforming over Alternative Processes When Developing Nano-scale Structures

Leveraging the Precision of Electroforming over Alternative Processes When Developing Nano-scale Structures VOLUME 4 - ELECTROFORMING Leveraging the Precision of over Alternative Processes When Developing Nano-scale Structures Electrical and mechanical component and subsystem designers generally have five techniques

More information

Comparing the Agilent 2100 Bioanalyzer Performance to Traditional DNA Analysis Techniques

Comparing the Agilent 2100 Bioanalyzer Performance to Traditional DNA Analysis Techniques Comparing the Agilent 2100 Bioanalyzer Performance to Traditional DNA Analysis Techniques Application Note Author Deborah Vitale Agilent Technologies, Inc. Palo Alto, CA, USA Abstract This Application

More information

Microarray Industry Products

Microarray Industry Products Via Nicaragua, 12-14 00040 Pomezia (Roma) Phone: +39 06 91601628 Fax: +39 06 91612477 info@lifelinelab.com www.lifelinelab.com Microarray Industry Products Page 10 NBT / BCPIP Chromogenic phosphatase

More information

SEPARATING PLASMA AND BLOOD CELLS BY DIELECTROPHORESIS IN MICROFLUIDIC CHIPS

SEPARATING PLASMA AND BLOOD CELLS BY DIELECTROPHORESIS IN MICROFLUIDIC CHIPS Fourth International Symposium on Physics of Fluids (ISPF4) International Journal of Modern Physics: Conference Series Vol. 19 (2012) 185 189 World Scientific Publishing Company DOI: 10.1142/S2010194512008732

More information

Microfluidics A new technology. A review Marie C Béné Nantes France

Microfluidics A new technology. A review Marie C Béné Nantes France Microfluidics A new technology A review Marie C Béné Nantes France Nothing to disclose CELL COUNTING CELL TYPING TOWARDS MICROFLUIDICS Lab on a chip or Lab-on-chip : LOC LOC represents the next generation

More information

GeNei TM Gel Extraction Teaching Kit Manual

GeNei TM Gel Extraction Teaching Kit Manual Teaching Kit Manual Cat No. New Cat No. KT43 106279 KT43A 106300 KT43B 106301 Revision No.: 00280507 CONTENTS Page No. Objective 3 Principle 3 Kit Description 5 Materials Provided 7 Procedure 8 Observation

More information

WesternBright Quantum

WesternBright Quantum User Manual WesternBright Quantum Chemiluminescent HRP Substrate For Catalog Numbers K-12042-C20 20 ml, sufficient for 200 cm 2 K-12042-D10 100 ml, sufficient for 1000 cm 2 K-12042-D20 200 ml, sufficient

More information

A handheld system for DNA test based on Lab on chip technologies. Marco Bianchessi

A handheld system for DNA test based on Lab on chip technologies. Marco Bianchessi A handheld system for DNA test based on Lab on chip technologies Marco Bianchessi History 2 Mid 90s: Lab on chip introduction From niche to high-volumes products What is needed: 3 Miniaturization 75 000

More information

Nanoimprinting in Polymers and Applications in Cell Studies. Albert F. YEE Chemical Engineering & Materials Science UC Irvine

Nanoimprinting in Polymers and Applications in Cell Studies. Albert F. YEE Chemical Engineering & Materials Science UC Irvine Nanoimprinting in Polymers and Applications in Cell Studies Albert F. YEE Chemical Engineering & Materials Science UC Irvine Presentation outline Motivation Reversal imprinting Soft inkpad imprinting on

More information

A Lab-on-Chip System for direct SNP sensing from human blood

A Lab-on-Chip System for direct SNP sensing from human blood A LabonChip System for direct SP sensing from human blood Ichiro Yamashita 1,3, Paolo Fiorini 2 1 Advanced Technology Research Laboratory, Panasonic corp. 34 Hikaridai, Seikacho, Sorakugun, Kyoto 6190237,

More information

LAB 6: Agarose Gel Electrophoresis of Restriction Digested Plasmid DNA

LAB 6: Agarose Gel Electrophoresis of Restriction Digested Plasmid DNA LAB 6: Agarose Gel Electrophoresis of Restriction Digested Plasmid DNA I. Objectives The purpose of today s lab is to learn how to set up and run an agarose gel, separate DNA fragments on the gel, and

More information

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques) Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on

More information

Using ULS24 CMOS Bio-imager as a Readout Sensor for Chemiluminescence Immunoassay and DNA Hybridization Assay

Using ULS24 CMOS Bio-imager as a Readout Sensor for Chemiluminescence Immunoassay and DNA Hybridization Assay Using ULS24 CMOS Bio-imager as a Readout Sensor for Chemiluminescence Immunoassay and DNA Hybridization Assay Updated: Nov 11, 2016 Introduction Immunoassay is a widely used method for detecting the presence

More information

special offers from your protein biology resource

special offers from your protein biology resource special offers from your protein biology resource Pop open your cells, extract your proteins, purify, quantify and express them. Seeking knowledge about proteins with Thermo Scientific Protein Research

More information

Exam MOL3007 Functional Genomics

Exam MOL3007 Functional Genomics Faculty of Medicine Department of Cancer Research and Molecular Medicine Exam MOL3007 Functional Genomics Tuesday May 29 th 9.00-13.00 ECTS credits: 7.5 Number of pages (included front-page): 5 Supporting

More information

Determination of Isoelectric Point (pi) By Whole-Column Detection cief

Determination of Isoelectric Point (pi) By Whole-Column Detection cief Determination of Isoelectric Point (pi) By Whole-Column Detection cief Tiemin Huang and Jiaqi Wu CONVERGENT BIOSCIENCE Determination of Isoelectric Point (pi) by Whole Column Detection cief Definition

More information

Soft Lithography. Jin-Goo Park. Materials and Chemical Engineering Hanyang University, Ansan. Electronic Materials and Processing Lab.

Soft Lithography. Jin-Goo Park. Materials and Chemical Engineering Hanyang University, Ansan. Electronic Materials and Processing Lab. Hanyang University Soft Lithography Jin-Goo Park Materials and Chemical Engineering Hanyang University, Ansan Electronic Materials and Processing Lab. Introduction to Soft Lithography Research Micro- Electro-

More information

Chapter 10 Analytical Biotechnology and the Human Genome

Chapter 10 Analytical Biotechnology and the Human Genome Chapter 10 Analytical Biotechnology and the Human Genome Chapter Outline Enzyme tests and biosensors DNA-based tests DNA analysis technologies Human genome and genome-based analytical methods 1 Enzyme-based

More information

Lecture 6. Through-Wafer Interconnect. Agenda: Through-wafer Interconnect Polymer MEMS. Through-Wafer Interconnect -1. Through-Wafer Interconnect -2

Lecture 6. Through-Wafer Interconnect. Agenda: Through-wafer Interconnect Polymer MEMS. Through-Wafer Interconnect -1. Through-Wafer Interconnect -2 Agenda: EEL6935 Advanced MEMS (Spring 2005) Instructor: Dr. Huikai Xie Lecture 6 Through-wafer Interconnect EEL6935 Advanced MEMS 2005 H. Xie 1/21/2005 1 Motivations: Wafer-level packaging CMOS 3D Integration

More information

HiPer Immunoprecipitation Teaching Kit

HiPer Immunoprecipitation Teaching Kit HiPer Immunoprecipitation Teaching Kit Product Code: HTI016 Number of experiments that can be performed: 5 Duration of Experiment Storage Instructions The kit is stable for 6 months from the date of receipt

More information

EE40 Lec 22. IC Fabrication Technology. Prof. Nathan Cheung 11/19/2009

EE40 Lec 22. IC Fabrication Technology. Prof. Nathan Cheung 11/19/2009 Suggested Reading EE40 Lec 22 IC Fabrication Technology Prof. Nathan Cheung 11/19/2009 300mm Fab Tour http://www-03.ibm.com/technology/manufacturing/technology_tour_300mm_foundry.html Overview of IC Technology

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

R R Innovation Way P/N SECKIT-7830 Newark, DE 19711, USA Tel: Fax: Website: Published in November 2013

R R Innovation Way P/N SECKIT-7830 Newark, DE 19711, USA Tel: Fax: Website:  Published in November 2013 5-100 Innovation Way Newark, DE 19711, USA Tel:302-3661101 Fax:302-3661151 Website: www.sepax-tech.com Published in November 2013 P/N SECKIT-7830 These Phases are developed based on innovative surface

More information

Please purchase PDFcamp Printer on to remove this watermark. DNA microarray

Please purchase PDFcamp Printer on  to remove this watermark. DNA microarray DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of

More information

Voltage clamp and patch-clamp techniques

Voltage clamp and patch-clamp techniques Voltage clamp and patch-clamp techniques Dr. Nilofar Khan Objectives Historical background Voltage Clamp Theory Variations of voltage clamp Patch-clamp Principal Patch-clamp configurations Applications

More information

OLED/OPD transducer for point-of-use diagnostics

OLED/OPD transducer for point-of-use diagnostics OLED/OPD transducer for point-of-use diagnostics Overview 1. CDT overview + Biosensor platform overview CDT overview Absorbance based lateral flow device (LFD) basics and advantages Abingdon Health collaboration

More information

Blot: a spot or stain, especially of ink on paper.

Blot: a spot or stain, especially of ink on paper. Blotting technique Blot: a spot or stain, especially of ink on paper. 2/27 In molecular biology and genetics, a blot is a method of transferring proteins, DNA or RNA, onto a carrier (for example, a nitrocellulose,pvdf

More information

ELECTROPHORESIS a es

ELECTROPHORESIS a es ELECTROPHORESIS Images DEFINITION Electrophoresis is a procedure for separating a mixture of charged molecules through a stationary material (gel) in an electrical field. It is a powerful tool for separating

More information

Protein-Pak Hi Res HIC Column and HIC Protein Standard

Protein-Pak Hi Res HIC Column and HIC Protein Standard Protein-Pak Hi Res HIC Column and HIC Protein Standard CONTENTS I. INTRODUCTION II. a. Mobile Phase b. Flow Direction CONNECTING COLUMN TO LC SYSTEM I. INTRODUCTION This offering contains non-porous, polymethacrylate-based

More information

Technical Instructions for Spotting Microarrays

Technical Instructions for Spotting Microarrays Technical Instructions for Spotting Microarrays PRODUCT is a special low fluorescence glass slide in the standard size of 75.6 mm x 25.0 mm x 1.0 mm. The aldehyde surface coating allows efficient covalent

More information

MagSi Beads. Magnetic Silica Beads for Life Science and Biotechnology study

MagSi Beads. Magnetic Silica Beads for Life Science and Biotechnology study MagSi Beads Magnetic Silica Beads for Life Science and Biotechnology study MagnaMedics Diagnostics B.V. / Rev. 9.2 / 2012 Wide range of products for numerous applications MagnaMedics separation solutions

More information

RAINBOW GELS: AN INTRODUCTION TO ELECTROPHORESIS. STANDARDS 3.1.7, , Westminster College 3.3.7, , 3.3.

RAINBOW GELS: AN INTRODUCTION TO ELECTROPHORESIS. STANDARDS 3.1.7, , Westminster College 3.3.7, , 3.3. RAINBOW GELS: AN INTRODUCTION TO ELECTROPHORESIS STANDARDS 3.1.7, 3.1.10, 3.1.12 Westminster College 3.3.7, 3.3.10, 3.3.12 INTRODUCTION This laboratory will demonstrate the basics of electrophoresis and

More information

Microarray. Slide Selection Chart... J2. Epoxide-coated Slides... J3. GAPS II-coated Slides... J5. Corning Cover Glass... J6

Microarray. Slide Selection Chart... J2. Epoxide-coated Slides... J3. GAPS II-coated Slides... J5. Corning Cover Glass... J6 Slide Selection Chart... J2 Epoxide-coated Slides... J3 UltraGAPS -coated Slides... J4 GAPS II-coated Slides... J5 Corning Cover Glass... J6 384-well Printing Plates... J6 Slide Mailers/Storage Boxes...

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

3. Close the bottom end of the column and apply the packing device on top. Pump water through the upper adaptor to remove air.

3. Close the bottom end of the column and apply the packing device on top. Pump water through the upper adaptor to remove air. INSTRUCTIONS FOR USE WorkBeads Protein A Product name Pack size Article number WorkBeads Protein A Bulk Media 1.5 ml 40605001 Bulk Media 5 ml 40605002 Bulk Media 10 ml 40605003 Bulk Media 100 ml 40605004

More information

NanoSystemsEngineering: NanoNose Final Status, March 2011

NanoSystemsEngineering: NanoNose Final Status, March 2011 1 NanoSystemsEngineering: NanoNose Final Status, March 2011 The Nanonose project is based on four research projects (VCSELs, 3D nanolithography, coatings and system integration). Below, the major achievements

More information

WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits

WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits Code N221-KIT N220-KIT Description WesternMAX Chemiluminescent AP Kit, Anti-Mouse Includes: Alkaline Phosphatase (AP) Conjugated Anti-Mouse

More information

Agilent AdvanceBio SEC Columns for Aggregate Analysis: Instrument Compatibility

Agilent AdvanceBio SEC Columns for Aggregate Analysis: Instrument Compatibility Agilent AdvanceBio SEC Columns for Aggregate Analysis: Instrument Compatibility Technical Overview Introduction Agilent AdvanceBio SEC columns are a new family of size exclusion chromatography (SEC) columns

More information

MSD Immuno-Dot-Blot Assays. A division of Meso Scale Diagnostics, LLC.

MSD Immuno-Dot-Blot Assays. A division of Meso Scale Diagnostics, LLC. MSD Immuno-Dot-Blot Assays Example: High Throughput Western Blots Replacements Traditional Western Blots High content Molecular weight and immunoreactivity Labor and protein intensive Inherently low throughput

More information

Electrophoresis 101 Student Worksheet

Electrophoresis 101 Student Worksheet 1 Electrophoresis 101 Student Worksheet Experiment Objective To develop an understanding of electrophoresis principles. To analyze results and to calculate the sizes of unknown charged molecules from given

More information

CBI Toolbox Tour 2015

CBI Toolbox Tour 2015 CBI Toolbox Tour 2015 Thermophoresis (NanoTemper) NT.115 & NT.LabelFree Images: NanoTemper Circular Dichroism Jasco J-1500 Spectrometer Six Position Turreted Peltier Temperature Control System Automated

More information

LabChip GXII: Antibody Analysis

LabChip GXII: Antibody Analysis WHITE PAPER LabChip GXII: Antibody Analysis Antibody Analysis using microfluidic technology in high throughput Quality by Design Experiments Abstract Current initiatives in Process Analytical Technology

More information

EASY-Spray Columns. Guidance for column set up and installation Tips to maximize column lifetime

EASY-Spray Columns. Guidance for column set up and installation Tips to maximize column lifetime EASY-Spray Columns Guidance for column set up and installation Tips to maximize column lifetime EASY-Spray Column Tips and Tricks This document provides guidance for Thermo Scientific EASY-Spray column

More information

Lesson 3 Gel Electrophoresis of Amplified PCR Samples and Staining of Agarose Gels

Lesson 3 Gel Electrophoresis of Amplified PCR Samples and Staining of Agarose Gels Lesson 3 Gel Electrophoresis of Amplified PCR Samples and Staining of Agarose Gels What Are You Looking At? Before you analyze your PCR products, let s take a look at the target sequence being explored.

More information

Module 16: Gel filtration: Principle, Methodology & applications. Dr. Savita Yadav Professor Department of Biophysics AIIMS, New Delhi

Module 16: Gel filtration: Principle, Methodology & applications. Dr. Savita Yadav Professor Department of Biophysics AIIMS, New Delhi PAPER 9: TECHNIQUES USED IN MOLECULAR BIOPHYSICS I Module 16: Gel filtration: Principle, Methodology & applications Dr. Savita Yadav Professor Department of Biophysics AIIMS, New Delhi Module 16 Gel filtration:

More information

Development of Novel NOx Sensors and System Integration with Alumina Heater Elements

Development of Novel NOx Sensors and System Integration with Alumina Heater Elements Development of Novel NOx Sensors and System Integration with Alumina Heater Elements UC Riverside PEMS 2016 International Conference & Workshop March 17, 2016 F. Bell, M. Boettcher, J. Chee, J. Fitzpatrick,

More information

CaptiveSpray nanobooster

CaptiveSpray nanobooster CaptiveSpray nanobooster The Revolution in Proteomics Ionization Innovation with Integrity LC-MS Source The Key to Performance and Reliability for nano flow MS Bruker CaptiveSpray principle: Stable and

More information

ProSignal Dura Juniper Creek Lane, San Diego, CA Phone: Fax:

ProSignal Dura Juniper Creek Lane, San Diego, CA Phone: Fax: ProSignal Dura 8430 Juniper Creek Lane, San Diego, CA 92126 Phone: 800.789.5550 Fax: 888.789.0444 Email: support@geneseesci.com www.geneseesci.com User Manual ProSignal Dura Chemiluminescent HRP Substrate

More information

Proteomics. Areas of Application for Proteomics. Most Commonly Used Proteomics Techniques: Limitations: Examples

Proteomics. Areas of Application for Proteomics. Most Commonly Used Proteomics Techniques: Limitations: Examples Proteomics Areas of Application for Proteomics Most Commonly Used Proteomics Techniques: Antibody arrays Protein activity arrays 2-D gels ICAT technology SELDI Limitations: protein sources surfaces and

More information

Fast mass transfer Fast separations High throughput and improved productivity Long column lifetime Outstanding reproducibility Low carryover

Fast mass transfer Fast separations High throughput and improved productivity Long column lifetime Outstanding reproducibility Low carryover columns ProSwift Reversed-Phase Monolith Columns for Protein Analysis ProSwift reversed-phase columns use a unique monolith technology for fast, high-resolution HPLC and LC/MS separations of proteins.

More information

HIGH SCHOOL STUDENT SCIENCE WEEK. St. Paul s Hospital Vancouver, BC

HIGH SCHOOL STUDENT SCIENCE WEEK. St. Paul s Hospital Vancouver, BC HIGH SCHOOL STUDENT SCIENCE WEEK St. Paul s Hospital Vancouver, BC Sponsors 2 AGENDA Location: UBC James Hogg Research Centre (JHRC), St. Paul s Hospital, Room 166 Burrard Building, 1081 Burrard Street,

More information

Chem 321 Lecture 23 - Liquid Chromatography 11/19/13

Chem 321 Lecture 23 - Liquid Chromatography 11/19/13 Chem 321 Lecture 23 - Liquid Chromatography 11/19/13 Student Learning Objectives High Performance Liquid Chromatography With the advent of relatively inexpensive and reliable pumps, the development of

More information

Review. Microfluidic devices fabricated in poly(dimethylsiloxane) for biological studies. Miniaturization. Contents.

Review. Microfluidic devices fabricated in poly(dimethylsiloxane) for biological studies. Miniaturization. Contents. Electrophoresis 2003, 24, 3563 3576 3563 Review Samuel K. Sia George M. Whitesides Department of Chemistry and Chemical Biology, Harvard University, Cambridge, MA, USA Microfluidic devices fabricated in

More information

GENECHECKER Ultra-Fast PCR System

GENECHECKER Ultra-Fast PCR System "Gives You a PCR Result in 11 Minutes." GENECHECKER Ultra-Fast PCR System PCR Innovation Starts Here! Do it Anywhere. Make it Faster. See the Result. Patented Chip Based Design Provides Extremely Rapid

More information

Metallization deposition and etching. Material mainly taken from Campbell, UCCS

Metallization deposition and etching. Material mainly taken from Campbell, UCCS Metallization deposition and etching Material mainly taken from Campbell, UCCS Application Metallization is back-end processing Metals used are aluminum and copper Mainly involves deposition and etching,

More information

ab MDR Assay Kit (Fluorometric)

ab MDR Assay Kit (Fluorometric) ab112142 MDR Assay Kit (Fluorometric) Instructions for Use For detecting MDR pump activities in cells using our proprietary fluorescence probe. This product is for research use only and is not intended

More information

Protein Expression, Electrophoresis, His tag Purification

Protein Expression, Electrophoresis, His tag Purification Protein Expression, Electrophoresis, His tag Purification 2013 edition H.E. Schellhorn Day 2 Lecture 2- Protein Expression Protein over-expression and purification are key techniques in Molecular Biology

More information

Thin Films: Sputtering Systems (Jaeger Ch 6 & Ruska Ch 7,) Can deposit any material on any substrate (in principal) Start with pumping down to high

Thin Films: Sputtering Systems (Jaeger Ch 6 & Ruska Ch 7,) Can deposit any material on any substrate (in principal) Start with pumping down to high Thin Films: Sputtering Systems (Jaeger Ch 6 & Ruska Ch 7,) Can deposit any material on any substrate (in principal) Start with pumping down to high vacuum ~10-7 torr Removes residual gases eg oxygen from

More information

Human BDNF ELISA. For the precise measurement of BDNF in human serum, plasma, body fluids, tissue homogenate or cell culture supernates.

Human BDNF ELISA. For the precise measurement of BDNF in human serum, plasma, body fluids, tissue homogenate or cell culture supernates. Product information User s Manual Human BDNF ELISA For the precise measurement of BDNF in human serum, plasma, body fluids, tissue homogenate or cell culture supernates. BE69099 Storage: 96 2-8 C RUO For

More information

2. Relay characteristics of proteins and protein electrophoresis / fractionation.

2. Relay characteristics of proteins and protein electrophoresis / fractionation. UNIT: Proteins 15prot_elec.wpd Task Electrophoresis Objectives Upon completion of this exercise, the student will be able to: 1. Review electrophoresis information as presented in class. 2. Relay characteristics

More information

Introduction to Protein Purification

Introduction to Protein Purification Introduction to Protein Purification 1 Day 1) Introduction to Protein Purification. Input for Purification Protocol Development - Guidelines for Protein Purification Day 2) Sample Preparation before Chromatography

More information

DNA Arrays Affymetrix GeneChip System

DNA Arrays Affymetrix GeneChip System DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC

More information

KPL LumiGLO Reserve Chemiluminescent Substrate

KPL LumiGLO Reserve Chemiluminescent Substrate DESCRIPTION KPL LumiGLO Reserve contains a luminol-based chemiluminescent substrate designed for use with peroxidase-labeled (HRP) reporter molecules. KPL LumiGLO Reserve offers improvements in the way

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

Notes to accompany the slidecast on theory of SDS PAGE and Western blotting

Notes to accompany the slidecast on theory of SDS PAGE and Western blotting S317 Biological science: from genes to species Notes to accompany the slidecast on theory of SDS PAGE and Western blotting SDS PAGE SDS PAGE is a standard technique for determining the molecular size of

More information

HUMAN CONNECTIVE TISSUE GROWTH FACTOR (CTGF) ELISA KIT

HUMAN CONNECTIVE TISSUE GROWTH FACTOR (CTGF) ELISA KIT HUMAN CTGF ELISA KIT PAGE 1 HUMAN CONNECTIVE TISSUE GROWTH FACTOR (CTGF) ELISA KIT PURCHASE INFORMATION: ELISA NAME HUMAN CTGF ELISA FOR THE QUANTITATIVE DETERMINATION OF HUMAN CTGF CONCENTRATIONS IN SERUM

More information

Quantum Dot applications in Fluorescence Imaging for Calibration and Molecular Imaging

Quantum Dot applications in Fluorescence Imaging for Calibration and Molecular Imaging Quantum Dot applications in Fluorescence Imaging for Calibration and Molecular Imaging Introduction In this application note, we will discuss the application of quantum dots in fluorescence imaging, both

More information

5 AMP Sepharose 4B. instructions

5 AMP Sepharose 4B. instructions instructions 5 AMP Sepharose 4B 5' AMP Sepharose 4B interacts strongly with NAD + -dependent dehydrogenases and ATP-dependent enzymes. Selective elution with gradients of NAD + or NADP + has allowed the

More information

FemINDICAtor qpcr Plant Gender Detection Kit on the Agilent AriaMX Real-Time PCR Detection System Page 1 of 10

FemINDICAtor qpcr Plant Gender Detection Kit on the Agilent AriaMX Real-Time PCR Detection System Page 1 of 10 Page 1 of 10 Please refer to http://www.medicinalgenomics.com/product-literature/ for updated protocols and Material Safety Data Sheets (MSDS). Consult MSDS before using any new product. FEMINDICATOR is

More information

Capillary Electrophoresis of Proteins

Capillary Electrophoresis of Proteins Capillary Electrophoresis of Proteins SDS Capillary Gel Electrophoresis SDS-CGE Outline CE-SDS Gel Analysis Description of Technique Method Development Tips PA800 plus kits SDS-MW IgG Purity & Heterogeneity

More information

UTILIZATION OF ATMOSPHERIC PLASMA SURFACE PREPARATION TO IMPROVE COPPER PLATING PROCESSES.

UTILIZATION OF ATMOSPHERIC PLASMA SURFACE PREPARATION TO IMPROVE COPPER PLATING PROCESSES. SESSION 14 MATERIALS AND PROCESSES FOR ADVANCED PACKAGING UTILIZATION OF ATMOSPHERIC PLASMA SURFACE PREPARATION TO IMPROVE COPPER PLATING PROCESSES. Eric Schulte 1, Gilbert Lecarpentier 2 SETNA Corporation

More information

What is a microarray

What is a microarray DNA Microarrays What is a microarray A surface on which sequences from thousands of different genes are covalently attached to fixed locations (probes). Glass slides Silicon chips Utilize the selective

More information

Agarose Gel Electrophoresis

Agarose Gel Electrophoresis Agarose Gel Electrophoresis Gel electrophoresis is a widely used technique for the analysis of nucleic acids and proteins. Agarose gel electrophoresis is routinely used for the preparation and analysis

More information

Introduction of Biosensors

Introduction of Biosensors Introduction of Biosensors Lecture April 17 Jeff T.H.Wang website: http://pegasus.me.jhu.edu/~thwang/ New course : BioMEMS and BioSensing (Spring 04 ) What s is a biosensor? Target 4.22 Signal Signal Analtye

More information

Laboratory Reagents. for life science research.

Laboratory Reagents. for life science research. Laboratory Reagents Research, quality control, or routine analysis whatever the field of activity, where there is a need for laboratory reagents, Thermo Fisher Scientific has a suitable product. We offer

More information

Exploring Extra Sensitivity Using ionkey/ms with the Xevo G2-XS Q-Tof HRMS for Small Molecule Pharmaceutical Analysis in Human Plasma

Exploring Extra Sensitivity Using ionkey/ms with the Xevo G2-XS Q-Tof HRMS for Small Molecule Pharmaceutical Analysis in Human Plasma Exploring Extra Sensitivity Using ionkey/ms with the Xevo G2-XS Q-Tof HRMS for Small Molecule Pharmaceutical Analysis in Human Plasma Yun Wang Alelyunas, Mark D. Wrona, Jim Murphy, Angela Doneanu, Gregory

More information

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template Catalog # Description 172-5085 SingleShot SYBR Green Kit, 100 x 50 µl reactions For research purposes only. Introduction The SingleShot SYBR Green Kit prepares genomic DNA (gdna) free RNA directly from

More information

nanodsf 2bind: Your service provider for biophysical characterization of proteins Precisely revealing protein folding and stability

nanodsf 2bind: Your service provider for biophysical characterization of proteins Precisely revealing protein folding and stability nanodsf Precisely revealing protein folding and stability 2bind: Your service provider for biophysical characterization of proteins This booklet was written and designed by 2bind 08 2015 Any reproduction

More information

including, but not limited to:

including, but not limited to: *This Section is part of the original Request for Proposal # P08 080. The Contractor should provide the following eligible Scientific Biomedical Research Equipment, Reagents & Supplies including, but not

More information

Positively Charged Membrane

Positively Charged Membrane BIOBOND NYLON MEMBRANES ProductInformation Technical Bulletin No. MB-570 June 1999 Size Quantity Positively Charged Membrane Neutral Membrane 30 cm x 3.5 m 1 roll N4781 N1031 30 cm x 12 m 1 roll N4906

More information

Thermo Scientific EASY-nLC 1200 System. Leading in simplicity. and performance

Thermo Scientific EASY-nLC 1200 System. Leading in simplicity. and performance Thermo Scientific EASY-nLC 1200 System Leading in simplicity and performance Peak performance made EASY Effortless ultra high performance for everybody A straightforward LC-MS solution Optimized and integrated

More information