Supplementary Materials for
|
|
|
- Penelope Walton
- 6 years ago
- Views:
Transcription
1 advances.sciencemag.org/cgi/content/full/2/9/e /dc1 Supplementary Materials for Somatic cell reprogramming-free generation of genetically modified pigs Fuminori Tanihara, Tatsuya Takemoto, Eri Kitagawa, Shengbin Rao, Lanh Thi Kim Do, Akira Onishi, Yukiko Yamashita, Chisato Kosugi, Hitomi Suzuki, Shoichiro Sembon, Shunichi Suzuki, Michiko Nakai, Masakazu Hashimoto, Akihiro Yasue, Munehide Matsuhisa, Sumihare Noji, Tatsuya Fujimura, Dai-ichiro Fuchimoto, Takeshige Otoi This PDF file includes: Published 14 September 2016, Sci. Adv. 2, e (2016) DOI: /sciadv Supplementary Text fig. S1. Optimization of the time period between IVF initiation and electroporation. fig. S2. Genome editing of the MSTN gene. table S1. Sequence of the MSTN target region in piglets. table S2. Off-target analysis of the piglets by deep sequencing. table S3. Sequence analysis of the MSTN gene in piglets #4 and #8 by deep sequencing. table S4. Oligonucleotide sequences used to generate sgrna. table S5. Oligonucleotide sequences used for off-target analysis.
2 Supplementary Text All animal care and experiments were carried out in accordance with the Guidelines for Animal Experiments of Tokushima University and the National Institute of Agrobiological Sciences. This study was approved by the Ethics Committee of Tokushima University for Animal Research (Approval number: T28-21) and the Safety Management Section of National Institute of Agrobiological Sciences (Approval number: H18-038).
3 fig. S1. Optimization of the time period between IVF initiation and electroporation. Presumptive zygotes were electroporated with Cas9 mrna and FGF10 guide RNA at 11, 13, 19, 21, and 23 h after IVF initiation. After incubation of the electroporated zygotes for 7 d, the blastocyst formation rates were determined. *P < 0.05 using one-way ANOVA. Error bars, mean ± s.e.m.
4 fig. S2. Genome editing of the MSTN gene. (A) Genomic MSTN sequences in the blastocysts formed from electroporated zygotes. (B) Frequency of mutations detected in the PCR amplicons. (C) Blastocyst formation rates of the electroporated zygotes. Error bars, mean ± s.e.m.
5 table S1. Sequence of the MSTN target region in piglets. The nucleotides in blue represent target sequences, while those in red represent PAM sequences.
6 table S2. Off-target analysis of the piglets by deep-sequencing. piglet Genome sequence mismatch locus (strand) frequency #4 #8 Off-target candidates Off-target candidates OT4 OT5 OT6 OT1 OT2 OT3 gctgttctcattcagatcca CGG aatgttctcatgcagatccaggg tgctttctcattcagatccatgg gtttttctcattcagatcc TAGG aggaaaatgtggaaaaagag GGG aagaaaatatggaaaaagagagg atgaaaatgtgaaaaaagagagg atgaaaacttggaaaaagagagg 1bp 2bp 2bp 1bp 1bp 2bp chr16: 3,206,113-3,206,133 (-) 2195/2209 (99%) chr11: 75,202,772-75,202,792 (-) 2168/2181 (99%) chr1:200,634, ,634,472 (-) 2734/2754 (99%) chr3:96,400,245-96,400,265 (+) chr7:115,969, ,969,817 (-) chr7:46,099,859-46,099,879 (-) 2896/2924 (99%) 2843/2861 (99%) 3025/3047 (99%) table S3. Sequence analysis of the MSTN gene in piglets #4 and #8 by deep sequencing. piglet Genome sequence indels frequency #4 #8 cgctgttctcattcagatcca CGGgac cgctgttctcattcagat TCCACGGgac cgctgttctcattcaga GAACACGGgac cgctgttctcattca GGgac aaggaaaatgtggaaaaagag GGGctg aaggaaaatgtggaaaaa AGAGGGGctg aaggaaaatgtggaaaaagaggggctg +1bp 1486/2560 (58%) +1bp, m2bp -7bp +1bp none 954/2560 (38%) 50/2560 (2%) 1391/2849 (49%) 1438/2849 (50%)
7 table S4. Oligonucleotide sequences used to generate sgrna. table S5. Oligonucleotide sequences used for off-target analysis. forward primer reverse primer OT1 OT2 OT3 OT4 OT5 OT6 OT1 OT2 OT3 OT4 OT5 OT6 common sequence ACACTCTTTCCCTACACGACGCTCTTCCGATCT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT specific sequence ACCTGTTTATGCTGATTGTTGCT GTGATCTTCACCTGCGCAG GTGCTCAGCCCTGACTCAG TCGGAGAGACGTTCCCCTG TGGTCCCGTGGATCTGAATG AGGAATGGCCCTAGAAAAGGC CCAGACTTCCTATTTTCCTCAACA CAGGCGAATTTAATCAGGCCA GTGTTTTGTCTCCACATACATGCA CTGACGGCACTGGAACCTT GGCCTAAAATCCTGAGGCCT GATGGACGCCCCTCTGAATG GTGTTTTGTCTCCACATACATGCA TGTGGATCTGAGCATGAAAGG TGTGGAAGATGAATTGTTTTAAAGCT TGCATTATGTTACAGAATTTGGACT
Supplementary Materials. China
Supplementary Materials An Efficient Genotyping Method for Genome-modified Animals and Human Cells Generated with CRISPR/Cas9 System Xiaoxiao Zhu 1,2 *, Yajie Xu 1 *, Shanshan Yu 1 *, Lu Lu 1,2, Mingqin
Supplementary Figure 1 Activities of ABEs using extended sgrnas in HEK293T cells.
Supplementary Figure 1 Activities of ABEs using extended sgrnas in HEK293T cells. Base editing efficiencies of ABEs with extended sgrnas at Site 18 (a), Site 19 (b), the HBB-E2 site (c), and the HBB-E3
CRISPR RNA-guided activation of endogenous human genes
CRISPR RNA-guided activation of endogenous human genes Morgan L Maeder, Samantha J Linder, Vincent M Cascio, Yanfang Fu, Quan H Ho, J Keith Joung Supplementary Figure 1 Comparison of VEGF activation induced
Generation of App knock-in mice reveals deletion mutations protective against Alzheimer s. disease-like pathology. Nagata et al.
Generation of App knock-in mice reveals deletion mutations protective against Alzheimer s disease-like pathology Nagata et al. Supplementary Fig 1. Previous App knock-in model did not show Aβ accumulation
Allele-specific locus binding and genome editing by CRISPR at the
Supplementary Information Allele-specific locus binding and genome editing by CRISPR at the p6ink4a locus Toshitsugu Fujita, Miyuki Yuno, and Hodaka Fujii Supplementary Figure Legends Supplementary Figure
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/3/4/e1602814/dc1 Supplementary Materials for CRISPR-Cpf1 correction of muscular dystrophy mutations in human cardiomyocytes and mice Yu Zhang, Chengzu Long, Hui
Supplementary Information Targeting fidelity of adenine and cytosine base editors in mouse embryos
Supplementary Information ing fidelity of adenine and cytosine base s in mouse embryos Lee et al. a P = 1.012e-14 b Frequency (%) 100% 80% 60% 40% 20% 0% CB AB On-target Bystander Proximal Indels Frequency
Supplemental Information. CRISPR/Cas9-loxP-Mediated Gene Editing. as a Novel Site-Specific Genetic Manipulation Tool
OMTN, Volume 7 Supplemental Information CRISPR/Cas9-loxP-Mediated Gene Editing as a Novel Site-Specific Genetic Manipulation Tool Fayu Yang, Changbao Liu, Ding Chen, Mengjun Tu, Haihua Xie, Huihui Sun,
Supplementary Material
10.1071/RD18086_AC CSIRO 2018 Supplementary Material: Reproduction, Fertility and Development, 2018, 30(12), 1616 1621. Supplementary Material Generation of gene-edited sheep with a defined Booroola fecundity
Surrogate reporter-based enrichment of cells containing RNA-guided Cas9 nucleaseinduced
Supplementary Data Surrogate reporter-based enrichment of cells containing RNA-guided Cas9 nucleaseinduced mutations Suresh Ramakrishna 1, Seung Woo Cho 2, Sojung Kim 2, Myungjae Song 1, Ramu Gopalappa
Supplementary Information. Optimization of the production of knock-in alleles by CRISPR/Cas9 microinjection into the mouse zygote
Supplementary Information Supplementary Figures S1 to S5 and Tables S1 to S3. Optimization of the production of knock-in alleles by CRISPR/Cas9 microinjection into the mouse zygote Aurélien Raveux, Sandrine
Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) (b)
Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) A schematic overview of the production and amplification of a single pirna from a transposon transcript. The
Soyeong Jun 1, 3, Hyeonseob Lim 1, 3, Hoon Jang 1, Wookjae Lee 1, Jinwoo Ahn 1, Ji Hyun Lee 2,*, Duhee Bang 1,* Korea
Straightforward Delivery of Linearized Double-stranded DNA Encoding sgrna and Donor DNA for the Generation of Single Nucleotide Variants Based on the CRISPR/Cas9 System Soyeong Jun 1, 3, Hyeonseob Lim
Supplementary Figure 1
Supplementary Figure 1 Product purity of cytosine base editing for the wheat genomic loci tested. Product distributions and indels frequencies at four representative wheat genomic DNA sites in wheat protoplasts
Nature Biotechnology: doi: /nbt Supplementary Figure 1. In vitro validation of OTC sgrnas and donor template.
Supplementary Figure 1 In vitro validation of OTC sgrnas and donor template. (a) In vitro validation of sgrnas targeted to OTC in the MC57G mouse cell line by transient transfection followed by 4-day puromycin
Bart Williams, PhD Van Andel Research Center
A History of Genome Editing in the Laboratory Implications for Translational Applications Bart Williams, PhD Van Andel Research Center Introduction by Matthew Denenberg, MD DeVos Childrens Hospital Disclosures:
Supplementary Materials
Supplementary Materials Supplementary Methods Supplementary Discussion Supplementary Figure 1 Calculated frequencies of embryo cells bearing bi-allelic alterations. Targeted indel mutations induced by
Improving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm
Improving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm Anja Smith Director R&D Dharmacon, part of GE Healthcare Imagination at work crrna:tracrrna program Cas9 nuclease Active crrna is
Targeted mutagenesis in cotton (Gossypium hirsutum L.) using the. State Key Laboratory of Cotton Biology/Institute of Cotton Research of
Supplementary Information Targeted mutagenesis in cotton (Gossypium hirsutum L.) using the CRISPR/Cas9 system Xiugui Chen 1, 2, Xuke Lu 1, Na Shu 1, Shuai Wang 1, Junjuan Wang 1, Delong Wang 1, Lixue Guo
Easi CRISPR for conditional and insertional alleles
Easi CRISPR for conditional and insertional alleles C.B Gurumurthy, University Of Nebraska Medical Center Omaha, NE cgurumurthy@unmc.edu Types of Genome edits Gene disruption/inactivation Types of Genome
CRISPR/Cas9 Mouse Production
CRISPR/Cas9 Mouse Production Emory Transgenic and Gene Targeting Core http://cores.emory.edu/tmc Tamara Caspary, Ph.D. Scientific Director Teresa Quackenbush --- Lab Operations and Communications Coordinator
Supplementary Figure 1
Supplementary Figure 1 Concept of barcoding to suppress error in sequencing. Each template DNA molecule is barcoded with a random and unique sequence (marked as red, turquoise and green). All PCR generated
Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX
Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA
SUPPLEMENTARY INFORMATION
VOLUME: 1 ARTICLE NUMBER: 0066 In the format provided by the authors and unedited. Engineering CRISPR-Cpf1 crrnas and mrnas to maximize genome editing efficiency Bin Li 1, Weiyu Zhao 1, Xiao Luo 1, Xinfu
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: Supplementary Figure 1. dcas9-mq1 fusion protein induces de novo
You use the UCSC Genome Browser (www.genome.ucsc.edu) to assess the exonintron structure of each gene. You use four tracks to show each gene:
CRISPR-Cas9 genome editing Part 1: You would like to rapidly generate two different knockout mice using CRISPR-Cas9. The genes to be knocked out are Pcsk9 and Apoc3, both involved in lipid metabolism.
SUPPLEMENTARY INFORMATION
Gene replacements and insertions in rice by intron targeting using CRISPR Cas9 Table of Contents Supplementary Figure 1. sgrna-induced targeted mutations in the OsEPSPS gene in rice protoplasts. Supplementary
Nature Methods: doi: /nmeth Supplementary Figure 1. DMS-MaPseq data are highly reproducible at elevated DMS concentrations.
Supplementary Figure 1 DMS-MaPseq data are highly reproducible at elevated DMS concentrations. a, Correlation of Gini index for 202 yeast mrna regions with 15x coverage at 2.5% or 5% v/v DMS concentrations
CRISPR-dCas9 mediated TET1 targeting for selective DNA demethylation at BRCA1 promoter
CRISPR-dCas9 mediated TET1 targeting for selective DNA demethylation at BRCA1 promoter SUPPLEMENTARY DATA See Supplementary Sequence File: 1 Supplementary Figure S1: The total protein was extracted from
Supplementary Information
Supplementary Information Generation of inheritable and transgene clean targeted genome-modified rice in later generations using the CRISPR/Cas9 system. Rong-Fang Xu, Hao Li, Rui-Ying Qin, Juan Li, Chun-Hong
Supplementary Information
Supplementary Information Super-resolution imaging of fluorescently labeled, endogenous RNA Polymerase II in living cells with CRISPR/Cas9-mediated gene editing Won-Ki Cho 1, Namrata Jayanth 1, Susan Mullen
CRISPR/Cas9 Genome Editing: Transfection Methods
CRISPR/ Genome Editing: Transfection Methods For over 20 years Mirus Bio has developed and manufactured high performance transfection products and technologies. That expertise is now being applied to the
One-step generation of triple gene-targeted pigs using
1 Supplemental Information 2 3 4 One-step generation of triple gene-targeted pigs using CRISPR/Cas9 system 5 6 7 Xianlong Wang 1,5, Chunwei Cao 1,5, Jiaojiao Huang 1,5, Jing Yao 1,Tang Hai 1, Qiantao Zheng
Supplementary Materials for
www.advances.sciencemag.org/cgi/content/full/1/7/e1500454/dc1 Supplementary Materials for CRISPR-Cas9 delivery to hard-to-transfect cells via membrane deformation Xin Han, Zongbin Liu, Myeong chan Jo,
Chang Xu Mohammad R Nezami Ranjbar Zhong Wu John DiCarlo Yexun Wang
Supplementary Materials for: Detecting very low allele fraction variants using targeted DNA sequencing and a novel molecular barcode-aware variant caller Chang Xu Mohammad R Nezami Ranjbar Zhong Wu John
Some types of Mutagenesis
Mutagenesis What Is a Mutation? Genetic information is encoded by the sequence of the nucleotide bases in DNA of the gene. The four nucleotides are: adenine (A), thymine (T), guanine (G), and cytosine
Supplementary Figure 1. Quantitative RT-PCR experimental validation of CRISPR/Cas9 and sgrnas expression in HEK293A transfected cells.
Supplementary Figure 1. Quantitative RT-PCR experimental validation of CRISPR/Cas9 and sgrnas expression in HEK293A transfected cells. HEK293A cells were transfected with the indicated combinations of
Supplementary Figure 1. Diagram for CATCHA construct. Nature Biotechnology doi: /nbt.3444
Supplementary Figure 1 Diagram for CATCHA construct. Supplementary Figure 2 Representative view of ebony (left) and non-ebony (right) F2 flies from experiments described in Fig. 1c. F0 #1 F0 #2 F0 #3 F0
Factors affecting PCR
Lec. 11 Dr. Ahmed K. Ali Factors affecting PCR The sequences of the primers are critical to the success of the experiment, as are the precise temperatures used in the heating and cooling stages of the
Genome editing. Knock-ins
Genome editing Knock-ins Experiment design? Should we even do it? In mouse or rat, the HR-mediated knock-in of homologous fragments derived from a donor vector functions well. However, HR-dependent knock-in
HHS Public Access Author manuscript Biotechniques. Author manuscript; available in PMC 2018 November 17.
Single step production of Cas9 mrna for zygote injection Bethany K Redel 1, Benjamin P Beaton 1,2, Lee D Spate 1, Joshua A Benne 1, Stephanie L Murphy 1, Chad W O Gorman 1, Anna M Spate 1, Randall S Prather
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Experimental schema for the identification of circular RNAs in six normal tissues and seven cancerous tissues. Supplementary Fiure 2 Comparison of human circrnas
Supplementary Figure 1. Phenotype and genotype of cultured and transplanted S1 KCST (A) Brightfield and mcherry fluorescence images of the spheres
Supplementary Figure 1. Phenotype and genotype of cultured and transplanted S1 KCST (A) Brightfield and mcherry fluorescence images of the spheres generated from the CD133-positive cells infected with
Supplementary Information
Supplementary Information Supplementary Figure 1: Synthetic annealed poly(ra):poly(dt) hybrid induces type I interferon response. a) Bone marrow derived macrophages (BMDM) were transfected with or without
i-stop codon positions in the mcherry gene
Supplementary Figure 1 i-stop codon positions in the mcherry gene The grnas (green) that can potentially generate stop codons from Trp (63 th and 98 th aa, upper panel) and Gln (47 th and 114 th aa, bottom
Guide-it sgrna In Vitro Transcription and Screening Systems User Manual
Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Cat. Nos. 632638, 632639, 632635, 632636, 632637 (040618) 1290 Terra Bella Avenue, Mountain View, CA 94043, USA U.S. Technical Support:
Percent survival. Supplementary fig. S3 A.
Supplementary fig. S3 A. B. 100 Percent survival 80 60 40 20 Ml 0 0 100 C. Fig. S3 Comparison of leukaemia incidence rate in the triple targeted chimaeric mice and germline-transmission translocator mice
Donor DNA Utilization during Gene Targeting with Zinc- finger Nucleases
Donor DNA Utilization during Gene Targeting with Zinc- finger Nucleases Kelly J. Beumer, Jonathan K. Trautman, Kusumika Mukherjee and Dana Carroll Department of Biochemistry University of Utah School of
Optimizing Cas9 and sgrna concentrations for increasing mutation efficiency. Nature Methods: doi: /nmeth.3360
Supplementary Figure 1 Optimizing Cas9 and sgrna concentrations for increasing mutation efficiency. (a) Wild-type, 2-dpf slc24a5 b1 embryos and a series of slc24a5 CRISPR-injected embryos; anterior is
Simple protocol for gene editing using GenCrisprTM Cas9 nuclease
Simple protocol for gene editing using GenCrisprTM Cas9 nuclease Contents Protocol Step 1: Choose the target DNA sequence Step 2: Design sgrna Step 3: Preparation for sgrna 3.1 In vitro transcription of
Nature Biotechnology: doi: /nbt.4166
Supplementary Figure 1 Validation of correct targeting at targeted locus. (a) by immunofluorescence staining of 2C-HR-CRISPR microinjected embryos cultured to the blastocyst stage. Embryos were stained
Supplementary Figure 1: sgrna library generation and the length of sgrnas for the functional screen. (a) A diagram of the retroviral vector for sgrna
Supplementary Figure 1: sgrna library generation and the length of sgrnas for the functional screen. (a) A diagram of the retroviral vector for sgrna expression. It contains a U6-promoter-driven sgrna
Genome-wide genetic screening with chemically-mutagenized haploid embryonic stem cells
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Supplementary Information Genome-wide genetic screening with chemically-mutagenized haploid embryonic stem cells Josep V. Forment 1,2, Mareike Herzog
Nature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 Workflow for multimodal analysis using sc-gem on a programmable microfluidic device (Fluidigm). 1) Cells are captured and lysed, 2) RNA from lysed single cell is reverse-transcribed
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: Supplementary figure 1 Flow diagram summarizing the overall experimental
Supplementary Figure 1. Comparison of RNA yield between kits.
Supplementary Figure 1 Comparison of RNA yield between kits. 1µg DNA was used for RNA synthesis according to each manufacturer s protocol. The RNA samples in lanes 1 and 2 were synthesized using kits from
Dual sgrna-directed gene knockout using CRISPR/Cas9 technology in Caenorhabditis. elegans
Dual sgrna-directed gene knockout using CRISPR/Cas9 technology in Caenorhabditis elegans Xiangyang Chen 1, Fei Xu 1, Chengming Zhu 1, Jiaojiao Ji 1, Xufei Zhou 1, Xuezhu Feng 1*, and Shouhong Guang 1*
Variant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4
WHITE PAPER Oncomine Comprehensive Assay Variant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4 Contents Scope and purpose of document...2 Content...2 How Torrent
Genomic DNA fragments identified by ChIP-chip assay for MR [28] corresponding to two
![Genomic DNA fragments identified by ChIP-chip assay for MR [28] corresponding to two](/thumbs/89/98549522.jpg "Genomic DNA fragments identified by ChIP-chip assay for MR [28] corresponding to two")
Supplemental Materials and Methods Genomic DNA fragments identified by ChIP-chip assay for MR [28] corresponding to two upstream regions of the human Klf9 gene (-5139 to -5771 bp and -3875 to -4211 bp)
BS 50 Genetics and Genomics Week of Oct 24
BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.
Single Nucleotide Variant Analysis. H3ABioNet May 14, 2014
Single Nucleotide Variant Analysis H3ABioNet May 14, 2014 Outline What are SNPs and SNVs? How do we identify them? How do we call them? SAMTools GATK VCF File Format Let s call variants! Single Nucleotide
Nature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 Ihh interacts preferentially with its upstream neighboring gene Nhej1. Genes are indicated by gray lines, and Ihh and Nhej1 are highlighted in blue. 4C seq performed in E14.5 limbs
12/31/16. I. Manipulating DNA (9.1) A. Scientists use several techniques to manipulate DNA. 1. DNA is a very large molecule
I. Manipulating DNA (9.1) A. Scientists use several techniques to manipulate DNA 1. DNA is a very large molecule 3. Led to many biotechnology applications- genetic engineering, DNA fingerprinting, cloning,
Innovative Trait Development Tools in Plant Breeding will be Crucial for Doubling Global Agricultural Productivity by 2050
Innovative Trait Development Tools in Plant Breeding will be Crucial for Doubling Global Agricultural Productivity by 2050 Greg Gocal, Ph.D., Senior Vice President, Research and Development CRISPR Precision
Authors: Vivek Sharma and Ram Kunwar
Molecular markers types and applications A genetic marker is a gene or known DNA sequence on a chromosome that can be used to identify individuals or species. Why we need Molecular Markers There will be
CRISPR/Cas9 From Yoghurt to Designer Babies. Source: nextbigfuture.com
CRISPR/Cas9 From Yoghurt to Designer Babies Source: nextbigfuture.com OBJECTIVES 1. Relate the functioning of bacterial CRISPR/Cas systems to acquired immunity 2. Describe how CRISPR/Cas9 cuts DNA 3. Explain
Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering
Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death
Supplemental Information
Supplemental Information Induction of site-specific chromosome translocations in embryonic stem cells by CRISPR/Cas9 Authors Junfeng Jiang*, 1, 2, Li Zhang*, 2, 3, Xingliang Zhou*, 2, Xi Chen 2, Guanyi
Student Learning Outcomes (SLOS)
Student Learning Outcomes (SLOS) KNOWLEDGE AND LEARNING SKILLS USE OF KNOWLEDGE AND LEARNING SKILLS - how to use Annhyb to save and manage sequences - how to use BLAST to compare sequences - how to get
Supplementary Online Material. the flowchart of Supplemental Figure 1, with the fraction of known human loci retained
SOM, page 1 Supplementary Online Material Materials and Methods Identification of vertebrate mirna gene candidates The computational procedure used to identify vertebrate mirna genes is summarized in the
Designing TaqMan MGB Probe and Primer Sets for Gene Expression Using Primer Express Software Version 2.0
Designing TaqMan MGB Probe and Primer Sets for Gene Expression Using Primer Express Software Version 2.0 Overview This tutorial details how a TaqMan MGB Probe can be designed over a specific region of
Nature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Schematic and results of screening the combinatorial antibody library for Sox2 replacement activity. A single batch of MEFs were plated and transduced with doxycycline inducible
Genome edi3ng with the CRISPR-Cas9 system
CRISPR-Cas9 Genome Edi3ng Bootcamp AHA Council on Func3onal Genomics and Transla3onal Biology Narrated video link: hfps://youtu.be/h18hmftybnq Genome edi3ng with the CRISPR-Cas9 system Kiran Musunuru,
Nature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 ATP1A1 variants with in-frame deletions are enriched in ouabain-resistant cell populations. (a) Total editing efficacy along with spectrum and frequency of individual indels as determined
Protocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection
Protocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection Written by Dan Dickinson (daniel.dickinson@austin.utexas.edu) and last updated January 2018. A version
CRISPR/Cas9-mediated viral interference in plants
CRISPR/Cas9mediated viral interference in plants Item Type Article Authors Ali, Zahir; Abulfaraj, Aala A.; Idris, Ali; Ali, Shawkat; Tashkandi, Manal; Mahfouz, Magdy M. Citation CRISPR/Cas9mediated viral
Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).
1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well
- 1 - Supplemental Data
- 1-1 Supplemental Data 2 3 4 5 6 7 8 9 Supplemental Figure S1. Differential expression of AtPIP Genes in DC3000-inoculated plants. Gene expression in leaves was analyzed by real-time RT-PCR and expression
Gene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
Using CRISPR for genetic alteration
Using CRISPR for genetic alteration Joffrey Mianné. j.mianne@har.mrc.ac.uk Mary Lyon Centre, MRC Harwell. CRISPR/Cas origins Origin of the CRISPR/Cas system: Clustered-Regularly Interspaced Short Palindromic
Functional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update
Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks
CRISPR Ribonucleoprotein (RNP) User Manual
CRISPR Ribonucleoprotein (RNP) User Manual Description This user manual describes how to use GenScript s CRISPR Ribonucleoprotein (RNP) products for targeted genome editing. The RNP system is comprised
Systematic quantification of HDR and NHEJ reveals effects of locus, nuclease, and cell type on genome editing
upplementary Information ystematic quantification of and reveals effects of locus, nuclease, and cell type on genome editing Yuichiro Miyaoka 1,, Jennifer R. Berman 2,, amantha B. Cooper 2, teven J. Mayerl
Human Molecular Genetics Assignment 3 (Week 3)
Human Molecular Genetics Assignment 3 (Week 3) Q1. Which one of the following is an effect of a genetic mutation? a. Prevent the synthesis of a normal protein. b. Alters the function of the resulting protein
Alt-Ring the genome with CRISPR- Cas9
Alt-Ring the genome with CRISPR- Cas9 Genome editing done easily and fast CHIA Jin Ngee Regional Application Specialist 1 Integrated DNA Technologies The Custom Biology Company 2 IDT was founded by a scientist
PhysicsAndMathsTutor.com. Question Number. Answer Additional guidance Mark. 1(a) 1. reference to stem cells being {totipotent / pluripotent} ;
1(a) 1. reference to stem cells being {totipotent / pluripotent} ; 2. can specialise or differentiate / can give rise to {differentiated / specialised} cells ; 3. idea that these can replace damaged cells
CRISPR Design Considera1ons
CRISPR Design Considera1ons Shifra Ben-Dor Bioinforma1cs Unit Life Sciences Core Facili1es Weizmann Ins1tute of Science June 2018 Jinek et al, elife 2013;2:e00471 Cradick et al Outline Define your
Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53
Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -
Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms
Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms No. 1 of 10 1. The mouse gene knockout is based on. (A) Homologous recombination (B) Site-specific recombination
Combining Techniques to Answer Molecular Questions
Combining Techniques to Answer Molecular Questions UNIT FM02 How to cite this article: Curr. Protoc. Essential Lab. Tech. 9:FM02.1-FM02.5. doi: 10.1002/9780470089941.etfm02s9 INTRODUCTION This manual is
Inhibition of HSV-1 Replication by Gene Editing Strategy. Running Title: Targeting HSV-1 Infection by CRISPR/Cas9
SUPPLEMENTARY MATERIALS 2/4/16 Inhibition of HSV-1 Replication by Gene Editing Strategy Running Title: Targeting HSV-1 Infection by CRISPR/Cas9 Pamela C. Roehm 1,2,3*, Masoud Shekarabi 1, Hassen Wollebo
XactEdit Cas9 Nuclease with NLS User Manual
XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of
A novel tool for monitoring endogenous alpha-synuclein transcription by NanoLuciferase
A novel tool for monitoring endogenous alpha-synuclein transcription by NanoLuciferase tag insertion at the 3 end using CRISPR-Cas9 genome editing technique Sambuddha Basu 1, 3, Levi Adams 1, 3, Subhrangshu
Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1. Validation of CDK9-inhibitor treatment.
Supplementary Figure 1 Validation of CDK9-inhibitor treatment. (a) Schematic of GAPDH with the middle of the amplicons indicated in base pairs. The transcription start site (TSS) and the terminal polyadenylation
Direct Visual Detection of Salmonella Genomic DNA using Gold Nanoparticles
Electronic Direct Visual Detection of Genomic DNA using Gold Nanoparticles SUPPORTING INFORMATION Supporting Information Contents Page S2-S3: General procedures and probe design Page S4-S11: Supporting
Nature Biotechnology: doi: /nbt.4199
Supplementary Figure 1 Base editing activities of engineered A3A-BE3 variants with mutations designed to disrupt non-specific interactions with substrate ssdna. Graphs illustrating the frequencies of C
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/4/2/eaao0665/dc1 Supplementary Materials for Variant ribosomal RNA alleles are conserved and exhibit tissue-specific expression Matthew M. Parks, Chad M. Kurylo,
Nature Biotechnology: doi: /nbt Supplementary Figure 1. Design and sequence of system 1 for targeted demethylation.
Supplementary Figure 1 Design and sequence of system 1 for targeted demethylation. (a) Design of system 1 for targeted demethylation. TET1CD was fused to a catalytic inactive Cas9 nuclease (dcas9) and
Getting started with CRISPR: A review of gene knockout and homology-directed repair
Getting started with CRISPR: A review of gene knockout and homology-directed repair Justin Barr Product Manager, Functional Genomics Integrated DNA Technologies 1 Agenda: Getting started with CRISPR Background