Correction: The Leukemia-Associated Mllt10/ Af10-Dot1l Are Tcf4/β-Catenin Coactivators Essential for Intestinal Homeostasis
|
|
|
- Ruby Hawkins
- 6 years ago
- Views:
Transcription
1 CORRECTION Correction: The Leukemia-Associated Mllt10/ Af10-Dot1l Are Tcf4/β-Catenin Coactivators Essential for Intestinal Homeostasis Tokameh Mahmoudi, Sylvia F. Boj, Pantelis Hatzis, Vivian S. W. Li, Nadia Taouatas, Robert G. J. Vries, Hans Teunissen, Harry Begthel, Jeroen Korving, Shabaz Mohammed, Albert J. R. Heck, Hans Clevers Notice of republication Due to the publication of copyrighted material, this article has been republished in order to remove dual published content from the published record. Please see below for full details. The authors would like to make the following corrections to four of the published figures Figs 1, 3, 5 and 6. The editors have verified all relevant original data and also confirm that the manuscript s original conclusions are not affected. The authors apologize for these errors caused by mislabelling and inadvertent duplication during initial manuscript preparation. All authors have seen and approved this republication. OPEN ACCESS Citation: Mahmoudi T, Boj SF, Hatzis P, Li VSW, Taouatas N, Vries RGJ, et al. (2017) Correction: The Leukemia-Associated Mllt10/Af10-Dot1l Are Tcf4/β-Catenin Coactivators Essential for Intestinal Homeostasis. PLoS Biol 15(2): e doi: /journal.pbio Published: February 7, 2017 Copyright: 2017 Mahmoudi et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. PLOS Biology DOI: /journal.pbio February 7, / 7
2 Fig 1. Mllt10/Af10 co-immunoprecipitates with Tcf4 in the mouse small intestinal crypt. (A) Cell lysates from purified crypt fractions were immunoprecipitated with antibodies directed against endogenous Tcf4, β- catenin, and (B) Mllt10/Af10 as indicated and analyzed by Western blotting with the indicated antibodies. (C) Western blot analysis of mechanically fractionated crypt and villus from mouse small intestine using antibodies directed against a gene expressed specifically in the crypt (c-myc), villus (Keratin 20), Tubulin as control, as well as Mllt10/Af10 and Dot1l. (D) Mllt10/Af10 antibody staining on mouse small intestinal epithelium. Arrow indicates expression in the crypt proliferative compartment. (E) Confocal image for MLLT10/AF10 (green), E-Cadherin (red), and the nuclei counter stained with DAPi (blue). MLLT10/AF10 is expressed in nuclei of normal colon epithelium in a gradient concentrated at the crypt bottom and in colorectal cancer cells. doi: /journal.pbio g001 Corrections to Fig 1 The originally published version of Fig 1C included a Tubulin (crypt-villus) panel had been previously published in Fig 1A of a publication in another journal (The EMBO Journal (2009) 28, ). Both panels are correct, but we are re-publishing Fig 1 in thisplosbiology PLOS Biology DOI: /journal.pbio February 7, / 7
3 Fig 3. β-catenin-dependent H3K79 methylation and MLLT10/AF10, DOT1L recruitment to human AXIN2 gene. Cell lysates from Ls174T CRCs were immunoprecipitated with antibodies against endogenous MLLT10/AF10 (A) and DOT1L (B) complexes and analyzed by Western blotting with the indicated antibodies. (C) MLLT10/AF10 interaction with TCF4 is mediated by β-catenin. Western blot analysis of β-catenin depletion in Ls174T cells expressing doxycycline (Dox)-inducible β-catenin shrna. Immunoprecipitated TCF4-protein complexes from untreated or Dox-treated cells were resolved by SDS-PAGE followed by Western blotting with the indicated antibodies. (D) Schematic representation of the human AXIN2 locus and amplicons scanned in Chromatin immunoprecipitation experiments by qpcr. ChIP in Ls174T CRCs uninduced or induced with Dox using antibodies specific for TCF4 (E), β-catenin (F), MLLT10/AF10 (G), DOT1L (H), H3K79 dimethyl (I), and H3K79 trimethyl (J). The immunoprecipitated DNA was analyzed by qpcr using primers specific for the AXIN2 locus as indicated. Results are presented as percent immunoprecipitated over input and are representative of three independent experiments. doi: /journal.pbio g002 PLOS Biology DOI: /journal.pbio February 7, / 7
4 Fig 5. MLLT10/AF10 and DOT1L are essential and dedicated to the Wnt-induced transcriptional program in HEK293T cells. Wnt-induced association of MLLT10/AF10-DOT1L with and regulation of Wnt target genes in HEK293T cells. (A F) ChIP assays in HEK293T cells uninduced or induced with Wnt3A conditioned media at 2 and 12 h using antibodies specific for TCF4 (A), β-catenin (B), MLLT10/AF10 (C), DOT1L (D), H3K79 di-methyl (E), and H3K79 tri-methyl (F). The immunoprecipitated DNA was analyzed by qpcr using primers specific for the c-myc and ZCCHC12 loci as indicated. PLOS Biology DOI: /journal.pbio February 7, / 7
5 Results are presented as percent immunoprecipitated over input and are representative of three independent experiments. (G) Comparison of the corresponding expression pattern after sirna suppression of MLLT10/AF10, DOT1L, BRG1, and p300 in the Wnt induced condition. Heatmap showing 1988 Wnt regulated transcripts after 9 h Wnt-induction (relative to uninduced sample (no Wnt)) in HEK293T cells with greater than 1.5-fold variation, and the comparison of the corresponding expression pattern after sirna suppression of MLLT10/AF10, DOT1L, BRG1, and p300 in Wnt-induced condition (relative to 9 h Wnt induction). Red, upregulated after Wnt; green, downregulated after Wnt induction; grey, missing data. Western blot analysis of MLLT10/AF10, DOT1L, BRG1, p300, and Tubulin upon sirna depletion of each gene as indicated. (H) Venn diagram depicting the comparison of Wnt-induced genes and genes downregulated after MLLT10/AF10, DOT1L, BRG1, or p300 suppression in HEK293T cells after Wnt induction. doi: /journal.pbio g003 article to include a replicate of the Tubulin (crypt-villus) panel in Fig 1C to avoid issues of copyrighted dual publication. The corrected Fig 1 file is provided. Corrections to Fig 3 The published Fig 3A MLLT10 bands are incorrect; an MLLT10 panel from Fig 4B was accidentally duplicated in its place. The correct MLLT10 bands are now provided in this revised figure. The published Fig 3A TCF4 bands are incorrect; a similar-looking beta-catenin panel from Fig 1B was accidentally duplicated in its place. The correct TCF4 bands are now provided in this revised figure. The published Fig 3B Tubulin panel is incorrect; a similar-looking Tubulin panel from Fig 1A was accidentally duplicated in its place. The correct Tubulin bands are now provided in this revised figure. The published Fig 3B MLLT10 panel is incorrect; a DOT1L panel from a beta-catenin IP experiment in Fig S3A was accidentally duplicated in its place. The correct MLLT10 bands are now provided in this revised figure. Correction to Fig 5 Fig 5G Tubulin panel (for si con, si DOT1L) is incorrect; a similar-looking DOT1L panel from Fig 4A was accidentally duplicated in its place. The correct Tubulin bands are now provided in this revised figure. Corrections to Fig 6 The originally published version of Fig 6A included a beta-catenin (si MLLT10) panel that we had previously published in Fig 5B (as beta-catenin, si TNIK) of a publication in another journal (The EMBO Journal (2009) 28, ). The EMBO publication s panel is correct; this PLOSBiology article s panel was incorrect. We have now corrected Fig 6 to include the correct beta-catenin (si MLLT10) panel in Fig 6A. We are also re-publishing this corrected Fig 6 to avoid issues of incorrect dual publication. The corrected Fig 6 file is provided. PLOS Biology DOI: /journal.pbio February 7, / 7
6 Fig 6. MLLT10/AF10 targets DOT1L-H3K79 methylation to Wnt target genes and is essential for transcription elongation. (A) Expression levels of MLLT10/AF10, β-catenin, DOT1L, and Tubulin analyzed by Western blotting after sirna depletion of MLLT10/AF10. ChIP experiments in Ls174T CRCs containing or depleted of MLLT10/AF10 by sirna using antibodies against (B) TCF4, (C) β-catenin, (D) MLLT10/AF10, (E) DOT1L, (F) H3K79 dimethyl, (G) H3K79 trimethyl, (H) H3K4trimethyl, (I) RNA Pol II, (J) RNA Pol II Ser2P, and PLOS Biology DOI: /journal.pbio February 7, / 7
7 (K) RNA Pol II Ser5P. Immunoprecipitated DNA was analyzed by qpcr using primers specific for AXIN2 and c-myc promoters and unbound AXIN2 upstream control region. Results are presented as percent immunoprecipitated over input and are representative of three independent experiments. doi: /journal.pbio g004 Reference 1. Mahmoudi T, Boj SF, Hatzis P, Li VSW, Taouatas N, Vries RGJ, et al. (2010) The Leukemia-Associated Mllt10/Af10-Dot1l Are Tcf4/β-Catenin Coactivators Essential for Intestinal Homeostasis. PLoS Biol 8 (11): e doi: /journal.pbio PMID: PLOS Biology DOI: /journal.pbio February 7, / 7
Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and
Supplementary Figure Legend: Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and ATRIP protein peptides identified from our mass spectrum analysis were shown. Supplementary
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Han et al., http://www.jcb.org/cgi/content/full/jcb.201311007/dc1 Figure S1. SIVA1 interacts with PCNA. (A) HEK293T cells were transiently
monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal antibody was examined in
Supplementary information Supplementary figures Supplementary Figure 1 Determination of the s pecificity of in-house anti-rhbdd1 mouse monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal
supplementary information
DOI: 10.1038/ncb2172 Figure S1 p53 regulates cellular NADPH and lipid levels via inhibition of G6PD. (a) U2OS cells stably expressing p53 shrna or a control shrna were transfected with control sirna or
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Nakajima and Tanoue, http://www.jcb.org/cgi/content/full/jcb.201104118/dc1 Figure S1. DLD-1 cells exhibit the characteristic morphology
MEFs were isolated as in (Hadjihannas et al., 2006) from conductin knockout mice described
Supplementary Information Supplementary Methods Cell culture and treatments MEFs were isolated as in (Hadjihannas et al., 2006) from conductin knockout mice described in (Lustig et al., 2002). For treatments,
Supplementary Table, Figures and Videos
Supplementary Table, Figures and Videos Table S1. Oligonucleotides used for different approaches. (A) RT-qPCR study. (B) qpcr study after ChIP assay. (C) Probes used for EMSA. Figure S1. Notch activation
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3363 Supplementary Figure 1 Several WNTs bind to the extracellular domains of PKD1. (a) HEK293T cells were co-transfected with indicated plasmids. Flag-tagged proteins were immunoprecipiated
A RRM1 H2AX DAPI. RRM1 H2AX DAPI Merge. Cont. sirna RRM1
A H2AX DAPI H2AX DAPI Merge Cont sirna Figure S1: Accumulation of RRM1 at DNA damage sites (A) HeLa cells were subjected to in situ detergent extraction without IR irradiation, and immunostained with the
Supplemental Figure 1.
Supplemental Data. Charron et al. Dynamic landscapes of four histone modifications during de-etiolation in Arabidopsis. Plant Cell (2009). 10.1105/tpc.109.066845 Supplemental Figure 1. Immunodetection
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation
Four different active promoter genes were chosen, ATXN7L2, PSRC1, CELSR2 and
SUPPLEMENTARY MATERIALS AND METHODS Chromatin Immunoprecipitation for qpcr analysis Four different active promoter genes were chosen, ATXN7L2, PSRC1, CELSR2 and IL24, all located on chromosome 1. Primer
supplementary information
DOI: 10.1038/ncb2116 Figure S1 CDK phosphorylation of EZH2 in cells. (a) Comparison of candidate CDK phosphorylation sites on EZH2 with known CDK substrates by multiple sequence alignments. (b) CDK1 and
Nature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Schematic and results of screening the combinatorial antibody library for Sox2 replacement activity. A single batch of MEFs were plated and transduced with doxycycline inducible
Primers used for PCR of conductin, SGK1 and GAPDH have been described in (Dehner et al,
Supplementary METHODS Flow Cytometry (FACS) For FACS analysis, trypsinized cells were fixed in ethanol, rehydrated in PBS and treated with 40μg/ml propidium iodide and 10μ/ml RNase for 30 min at room temperature.
Supplementary Information (Aoki, K. et al., "Chromosomal instability by β-catenin/tcf transcription in APC or β-catenin mutant cells")
Supplementary Information (Aoki, K. et al., "Chromosomal instability by β-catenin/tcf transcription in APC or β-catenin mutant cells") Supplementary materials and methods ES cells and Mice The floxed β-catenin
Supplementary Figure 1
Supplementary Figure 1 Supplementary Fig. 1 shrna mediated knockdown of ZRSR2 in K562 and 293T cells. (a) ZRSR2 transcript levels in stably transduced K562 cells were determined using qrt-pcr. GAPDH was
Nature Immunology: doi: /ni Supplementary Figure 1. Control experiments for Figure 1.
Supplementary Figure 1 Control experiments for Figure 1. (a) Localization of SETX in untreated or PR8ΔNS1 virus infected A549 cells (4hours). Nuclear (DAPI) and Tubulin staining are shown. SETX antibody
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/362/ra12/dc1 Supplementary Materials for FOXP1 potentiates Wnt/β-catenin signaling in diffuse large B cell lymphoma Matthew P. Walker, Charles M. Stopford, Maria
Supplementary Fig. 1
a FL (1-2266) NL (1-1190) CL (1191-2266) HA-ICE1: - HA-ICE1: - - - FLAG-ICE2: + + + + FLAG-ELL: + + + + + + IP: anti-ha FLAG-ICE2 HA-ICE1-FL HA-ICE1-NL HA-ICE1-CL FLAG-ICE2 b IP: anti-ha FL (1-2266) NL
Supplementary Figure 1. Isolation of GFPHigh cells.
Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding
Stabilization of the Transcription Factor Foxp3 by the Deubiquitinase USP7 Increases Treg-Cell-Suppressive Capacity
Immunity, Volume 39 Supplemental Information Stabilization of the Transcription Factor Foxp3 by the Deubiquitinase USP7 Increases Treg-Cell-Suppressive Capacity Jorg van Loosdregt, Veerle Fleskens, Juan
b alternative classical none
Supplementary Figure. 1: Related to Figure.1 a d e b alternative classical none NIK P-IkBa Total IkBa Tubulin P52 (Lighter) P52 (Darker) RelB (Lighter) RelB (Darker) HDAC1 Control-Sh RelB-Sh NF-kB2-Sh
Ascl2 Acts as an R-spondin/Wnt-Responsive Switch to Control Stemness in Intestinal Crypts
Cell Stem Cell Supplemental Information Ascl2 Acts as an R-spondin/Wnt-Responsive Switch to Control Stemness in Intestinal Crypts Jurian Schuijers, Jan Philipp Junker, Michal Mokry, Pantelis Hatzis, Bon-Kyoung
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/3/146/ra80/dc1 Supplementary Materials for DNMT1 Stability Is Regulated by Proteins Coordinating Deubiquitination and Acetylation-Driven Ubiquitination Zhanwen
Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1. Validation of CDK9-inhibitor treatment.
Supplementary Figure 1 Validation of CDK9-inhibitor treatment. (a) Schematic of GAPDH with the middle of the amplicons indicated in base pairs. The transcription start site (TSS) and the terminal polyadenylation
At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in
Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3209 Supplementary Figure 1 IR induces the association of FH with chromatin. a, U2OS cells synchronized by thymidine double block (2 mm) underwent no release (G1 phase) or release for 2
Supplementary Figure S1 Evi/Wls and Wnt3 are overexpressed in epithelial cells in colon cancers. (a) Validation of the specificity of the Wnt3
Supplementary Figure S1 Evi/Wls and Wnt3 are overexpressed in epithelial cells in colon cancers. (a) Validation of the specificity of the Wnt3 antibody. HCT116 cells were reverse transfected with sicontrol
GFP CCD2 GFP IP:GFP
D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant
Gene Forward Primer Reverse Primer GAPDH ATCATCCCTGCCTCTACTGG GTCAGGTCCACCACTGACAC SSB1 AACTTCAGTGAGCCAAACCC GTTCTCAGAGGCTGGAGAGG
Supplemental Data EXPERIMENTAL PROCEDURES Plasmids and Antibodies- Full length cdna of INT11 or INT12 were cloned into ps- Flag-SBP vector respectively. Anti-RNA pol II (RPB1) was purchased from Santa
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Endogenous gene tagging to study subcellular localization and chromatin binding. a, b, Schematic of experimental set-up to endogenously tag RNAi factors using the CRISPR Cas9 technology,
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: Supplementary Figure 1. dcas9-mq1 fusion protein induces de novo
Mock. Control. sirna1
siha CaSki Mock Control sirna1 Supplementary Data Figure 1: Photomicrographs of siha and CaSki cells taken 48 hours after mock transfection, transfection of control sirna or sirna1. (100X magnification).
Supplementary Figure S1. The tetracycline-inducible CRISPR system. A) Hela cells stably
Supplementary Information Supplementary Figure S1. The tetracycline-inducible CRISPR system. A) Hela cells stably expressing shrna sequences against TRF2 were examined by western blotting. shcon, shrna
Supplemental Figure 1 (Figure S1), related to Figure 1 Figure S1 provides evidence to demonstrate Nfatc1Cre is a mouse line that directed gene
Developmental Cell, Volume 25 Supplemental Information Brg1 Governs a Positive Feedback Circuit in the Hair Follicle for Tissue Regeneration and Repair Yiqin Xiong, Wei Li, Ching Shang, Richard M. Chen,
PDIP46 (DNA polymerase δ interacting protein 46) is an activating factor for human DNA polymerase δ
PDIP46 (DNA polymerase δ interacting protein 46) is an activating factor for human DNA polymerase δ Supplementary Material Figure S1. PDIP46 is associated with Pol isolated by immunoaffinity chromatography.
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11326 Supplementary Figure 1: Histone exchange increases over the ORF in a set2 mutant. (a) Gene average analysis. Schematic representation of the bin distribution over the coding and
Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53
Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -
Dual Roles for PARP1 during Heat Shock: Transcriptional Activator and Posttranscriptional Inhibitor of Gene Expression
Dual Roles for PARP1 during Heat Shock: Transcriptional Activator and Posttranscriptional Inhibitor of Gene Expression The MIT Faculty has made this article openly available. Please share how this access
FRAUNHOFER IME SCREENINGPORT
FRAUNHOFER IME SCREENINGPORT Detection technologies used in drug discovery Introduction Detection technologies in drug discovery is unlimited only a biased snapshot can be presented Differences can presented
Infiltrating immune cells do not differ between T2E and non-t2e samples and represent a small fraction of total cellularity.
Supplementary Figure 1 Infiltrating immune cells do not differ between T2E and non-t2e samples and represent a small fraction of total cellularity. (a) ESTIMATE immune score from mrna expression array
Enteroendocrine cells switch hormone expression along the crypt-to-villus BMP signalling gradient
SUPPLEMENTARY INFORMATION Letters https://doi.org/10.1038/s41556-018-0143-y In the format provided by the authors and unedited. Enteroendocrine cells switch hormone expression along the crypt-to-villus
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43
Supplementary Figure 1. Limit of quantitation (LOQ) and limit of detection (LOD) were
Supplementary Figure 1. Limit of quantitation (LOQ) and limit of detection (LOD) were determined for SIL peptides in buffer solution. Presented in this figure are the regression analysis to demonstrate
supplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
UTX mediates demethylation of H3K27me3 at musclespecific genes during myogenesis
Manuscript EMBO-2009-72795 UTX mediates demethylation of H3K27me3 at musclespecific genes during myogenesis Shayesta Seenundun, Shravanti Rampalli, Qi-Cai Liu, Arif Aziz, Carmen Palii, SunHwa Hong, Alexandre
Supporting Online Material for
www.sciencemag.org/cgi/content/full/1154040/dc1 Supporting Online Material for Selective Blockade of MicroRNA Processing by Lin-28 Srinivas R. Viswanathan, George Q. Daley,* Richard I. Gregory* *To whom
Transcriptional regulation of IFN-l genes in Hepatitis C virus-infected hepatocytes via IRF-3 IRF-7 NF- B complex
POSTER PRESENTATION Transcriptional regulation of IFN-l genes in Hepatitis C virus-infected hepatocytes via IRF-3 IRF-7 NF- B complex Hai-Chon Lee *, Je-In Youn, Kyungwha Lee, Hwanyul Yong, Seung-Yong
Nature Medicine doi: /nm.3554
SUPPLEMENTARY FIGURES LEGENDS Supplementary Figure 1: Generation, purification and characterization of recombinant mouse IL-35 (ril-35). High-Five insect cells expressing high levels of the bicistronic
transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected with the wwp-luc reporter, and FLAG-tagged FHL1,
Supplementary Data Supplementary Figure Legends Supplementary Figure 1 FHL-mediated TGFβ-responsive reporter transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2579 Figure S1 Incorporation of heavy isotope-labeled amino acids and enrichment of di-glycine modified peptides. The incorporation of isotopelabeled amino acids in peptides was calculated
Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas.
Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Target Gene Non-target / Control BTG2 BRCA1 NFE2L2 Target Sequence ON-TARGET plus Non-targeting sirna # 1 (Cat# D-001810-01-05) sirna1: GAACCGACAUGCUCCCGGA
SUPPLEMENTARY INFORMATION
(Supplementary Methods and Materials) GST pull-down assay GST-fusion proteins Fe65 365-533, and Fe65 538-700 were expressed in BL21 bacterial cells and purified with glutathione-agarose beads (Sigma).
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2271 Supplementary Figure a! WM266.4 mock WM266.4 #7 sirna WM266.4 #10 sirna SKMEL28 mock SKMEL28 #7 sirna SKMEL28 #10 sirna WM1361 mock WM1361 #7 sirna WM1361 #10 sirna 9 WM266. WM136
ChampionChIP Quick, High Throughput Chromatin Immunoprecipitation Assay System
ChampionChIP Quick, High Throughput Chromatin Immunoprecipitation Assay System Liyan Pang, Ph.D. Application Scientist 1 Topics to be Covered Introduction What is ChIP-qPCR? Challenges Facing Biological
Supplementary Information
Supplementary Information Table of contents: Pages: Supplementary Methods 2-3 Supplementary Figure 1 4 Supplementary Figure 2 5 Supplementary Figure 3 6 Supplementary Figure 4 7 Supplementary Figure 5
HPV E6 oncoprotein targets histone methyltransferases for modulating specific. Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu,
1 HPV E oncoprotein targets histone methyltransferases for modulating specific gene transcription 3 5 Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu, Cheng-Ming Chiang, Sheng-Chung
Histone H3 Methylation Antibody Panel Pack I - Active Genes Base Catalog # C Component Size Shipping Temperature
Histone H3 Methylation Antibody Panel Pack I - Active Genes Base Catalog # PACK CONTENTS Component Size Shipping Temperature Upon Receipt Checklist 3K4D Histone H3K4me2 (H3K4 Dimethyl) Polyclonal Antibody
(a) Immunoblotting to show the migration position of Flag-tagged MAVS
Supplementary Figure 1 Characterization of six MAVS isoforms. (a) Immunoblotting to show the migration position of Flag-tagged MAVS isoforms. HEK293T Mavs -/- cells were transfected with constructs expressing
Transcriptional Regulation (Gene Regulation)
Experimental Techniques in Biomedical Sciences 의생명과학실험기법 Transcriptional Regulation (Gene Regulation) 4/17/13 Jeong Hoon Kim (jeongkim@skku.edu) Department of Health Sciences and Technology, SKKU Graduate
Supplementary Information
Supplementary Information MLL histone methylases regulate expression of HDLR- in presence of estrogen and control plasma cholesterol in vivo Khairul I. Ansari 1, Sahba Kasiri 1, Imran Hussain 1, Samara
H3K36me3 polyclonal antibody
H3K36me3 polyclonal antibody Cat. No. C15410192 Type: Polyclonal ChIP-grade/ChIP-seq grade Source: Rabbit Lot #: A1845P Size: 50 µg/32 µl Concentration: 1.6 μg/μl Specificity: Human, mouse, Arabidopsis,
Resveratrol inhibits epithelial-mesenchymal transition of retinal. pigment epithelium and development of proliferative vitreoretinopathy
Resveratrol inhibits epithelial-mesenchymal transition of retinal pigment epithelium and development of proliferative vitreoretinopathy Keijiro Ishikawa, 1,2 Shikun He, 2, 3 Hiroto Terasaki, 1 Hossein
e15 e14 3utr i13 K36me3 / H i4 ** ** ** ** ** tss IIIb K36me2 / H IIIb BCOR (% input)
a Epithelial cells (2) Mesenchymal cells () Alternatively spliced region i13 e14 e15 / CycA 25 15 1 5 e14 e13-e14 - - K27me3 / H3 b 2.5 c v5 K36me3 / H3 d 3.5 2.8 2.1 1.4.7 e 3.5 2.8 2.1 1.4.7 v5 K9me3
Hitting the mark: specificity analysis of histone antibodies
APPLICATION NOTE Histone modification antibodies Hitting the mark: specificity analysis of histone antibodies Introduction The nucleosome, composed of the histones H2A, H2B, H3, and H4, is the fundamental
SUPPLEMENTARY INFORMATION
DOI: 1.138/ncb37 a Supplementary Figure 1 Dapi EU γh2ax Overlay b Dapi NBS1-GFP Firbillarin Overlay c Pre-laser 2 min 5 min 1 min 2 min 3 min 4 min 5 min 6 min 7 min d Dapi GFP-MRE11 γh2ax Overlay Supplementary
Supplementary Figure 1. Nature Structural & Molecular Biology: doi: /nsmb.3494
Supplementary Figure 1 Pol structure-function analysis (a) Inactivating polymerase and helicase mutations do not alter the stability of Pol. Flag epitopes were introduced using CRISPR/Cas9 gene targeting
Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.
Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3562 In the format provided by the authors and unedited. Supplementary Figure 1 Glucose deficiency induced FH-ATF2 interaction. In b-m, immunoblotting or immunoprecipitation analyses were
Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days,
Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days, respectively, and their mrnas were quantified by real time
The role of erna in chromatin looping
The role of erna in chromatin looping Introduction Enhancers are cis-acting DNA regulatory elements that activate transcription of target genes 1,2. It is estimated that 400 000 to >1 million alleged enhancers
TRIM31 is recruited to mitochondria after infection with SeV.
Supplementary Figure 1 TRIM31 is recruited to mitochondria after infection with SeV. (a) Confocal microscopy of TRIM31-GFP transfected into HEK293T cells for 24 h followed with SeV infection for 6 h. MitoTracker
Supplementary Fig S1 Nutlin-3a treatment does not affect cell cycle progression in the absence
Supplementary Figure Legends Supplementary Fig S1 Nutlin-3a treatment does not affect cell cycle progression in the absence of p53 or p21. HCT116 cells which were null for either p53 (A) or p21 (B) were
Nuclear Organization and Gene Expression Dr. David L. Spector
NUCLEAR ORGANIZATION AND GENE EXPRESSION David L. Spector, Ph.D. Cold Spring Harbor Laboratory One Bungtown Road Cold Spring Harbor, New York 11724 Visit our website at www.cshl.edu/spectorlab 1 Orphanides
SUPPLEMENTARY INFORMATION
doi:.38/nature899 Supplementary Figure Suzuki et al. a c p7 -/- / WT ratio (+)/(-) p7 -/- / WT ratio Log X 3. Fold change by treatment ( (+)/(-)) Log X.5 3-3. -. b Fold change by treatment ( (+)/(-)) 8
Zhang et al., RepID facilitates replication Initiation. Supplemental Information:
Supplemental Information: a b 1 Supplementary Figure 1 (a) DNA sequence of all the oligonucleotides used in this study. Only one strand is shown. The unshaded nucleotide sequences show changes from the
Post-translational modification
Protein expression Western blotting, is a widely used and accepted technique to detect levels of protein expression in a cell or tissue extract. This technique measures protein levels in a biological sample
supplementary information Normalized Men ε/β ncrnas level 1.0 Ratio of Men ε/men β expression 0.5 DOI: /ncb2140
DOI: 10.1038/ncb2140 2.5 10 Normalized Men ε/β ncrnas level 2.0 1.5 1.0 0.5 0 -DOX +DOX Ratio of Men ε/men β expression 5 0 -DOX +DOX Figure S1 Men ε/β reporter gene expression level by qrt-pcr. Left,
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1.
Supplementary Figure 1. Characterization and high expression of Lnc-β-Catm in liver CSCs. (a) Heatmap of differently expressed lncrnas in Liver CSCs (CD13 + CD133 + ) and non-cscs (CD13 - CD133 - ) according
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3389 Supplementary Figure 1 Hepatocyte-specific overexpression of activated Yap causes hepatomegaly and accelerates DMBA-induced liver tumor formation. (a) Schematic diagram of the construct
Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).
1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well
B Western blot of the p150caf-1 complex
Loyola et al., Supplementary Figure 1 A MS data of the HP1α complex RIF1 SPT6 SMARCA4 POGZ CAF-1 p150 KAP-1 HP1α 200 116 97.1 CAF-1 p150 tnasp Importin4 B Western blot of the p150caf-1 complex Input mock
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Bays et al., http://www.jcb.org/cgi/content/full/jcb.201309092/dc1 Figure S1. Specificity of the phospho-y822 antibody. (A) Total cell
Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 CSRP2 PFKP ADFP ADM C10orf10 GPI LOX PLEKHA2 WIPF1
Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 4.52E-18 PDK1 6.77E-18 CSRP2 4.42E-17 PFKP 1.23E-14 MSH2 3.79E-13 NARF_A 5.56E-13 ADFP 5.56E-13 FAM13A1 1.56E-12 FAM29A_A 1.22E-11 CA9 1.54E-11
Nature Genetics: doi: /ng Supplementary Figure 1. ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets.
Supplementary Figure 1 ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets. Gene structures are shown underneath each panel. Supplementary Figure 2 pref6::ref6-gfp complements
Supplementary Figure 1. Wnt10a mutation causes aberrant molar tooth development and formation of an ectopic M4 molar. (a,b) Smaller molar teeth with
Supplementary Figure 1. Wnt10a mutation causes aberrant molar tooth development and formation of an ectopic M4 molar. (a,b) Smaller molar teeth with blunted cusp formation, and presence of an ectopic molar
Coleman et al., Supplementary Figure 1
Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential
Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated
Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated reporter luciferase constructs, HEK293T cells were stimulated
Supplementary Figure 1. RAD51 and RAD51 paralogs are enriched spontaneously onto
Supplementary Figure legends Supplementary Figure 1. and paralogs are enriched spontaneously onto the S-phase chromatin during DN replication. () Chromatin fractionation was carried out as described in
Regulation of transcription by the MLL2 complex and MLL complex-associated AKAP95
Supplementary Information Regulation of transcription by the complex and MLL complex-associated Hao Jiang, Xiangdong Lu, Miho Shimada, Yali Dou, Zhanyun Tang, and Robert G. Roeder Input HeLa NE IP lot:
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11355 Supplemental Table 1. Gene targeting efficiency in mutants of nonessential genes. This table is presented as a separate Excel file. Supplemental Table 2. Genes with altered expression
Chromatin immunoprecipitation (ChIP) ES and FACS-sorted GFP+/Flk1+ cells were fixed in 1% formaldehyde and sonicated until fragments of an average
Chromatin immunoprecipitation (ChIP) ES and FACS-sorted cells were fixed in % formaldehyde and sonicated until fragments of an average size of 5 bp were obtained. Soluble, sheared chromatin was diluted
VCP adaptor interactions are exceptionally dynamic and subject to differential modulation by a VCP inhibitor
VCP adaptor interactions are exceptionally dynamic and subject to differential modulation by a VCP inhibitor Liang Xue 1, Emily E. Blythe 1, Elyse C. Freiberger 2, Jennifer Mamrosh 1, Alexander S. Hebert
Supplementary Figure 1. ERK signaling is not activated at early hypertension. a, Western blot analysis for the level of phospho-erk (perk) and total
Supplementary Figure 1. ERK signaling is not activated at early hypertension. a, Western blot analysis for the level of phospho-erk (perk) and total ERK in the aortic tissue from the saline- or AngII-infused
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3206 Supplementary Figure 1 Autophagy-related gene expression in murine and human intestinal tumors. (a) Representative LC3 immunostaining in colonic adenoma and adjacent non tumoral tissue
SUPPLEMENTARY INFORMATION
Supplementary Discussion Interestingly, a recent study demonstrated that knockdown of Tet1 alone would lead to dysregulation of differentiation genes, but only minor defects in ES maintenance and no change
Histone H3K27 Methylation Antibody Panel Pack Base Catalog # C Component Size Shipping Temperature
Histone H3K27 Methylation Antibody Panel Pack Base Catalog # PACK CONTENTS Component Size Shipping Temperature Upon Receipt Checklist 3K27M Histone H3K27me1 (H3K27 Monomethyl) Polyclonal Antibody 25 µg
Supplementary Materials
Supplementary Materials Construction of Synthetic Nucleoli in Human Cells Reveals How a Major Functional Nuclear Domain is Formed and Propagated Through Cell Divisision Authors: Alice Grob, Christine Colleran
Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate
Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated