INCIDENCE OF VIRUS INFECTIONS ON DIFFERENT PEACH CULTIVARS IN MONTENEGRO

Size: px
Start display at page:

Download "INCIDENCE OF VIRUS INFECTIONS ON DIFFERENT PEACH CULTIVARS IN MONTENEGRO"

Transcription

1 INCIDENCE OF VIRUS INFECTIONS ON DIFFERENT PEACH CULTIVARS IN MONTENEGRO Zindović J., 1 Božović V., 1 Miladinović Z., 2 Rubies Autonell C. 3, Ratti C

2 Peach production in Montenegro Stone fruit production Total surface (ha) Enterprises and collective farms Private farms Plum ca ha ca. 5 ha ca ha Peach ca. 185 ha ca. 85 ha ca. 100 ha Cherries ca. 125 ha ca. 3 ha ca. 122 ha Peach ranking second in planted surface in stone fruit production in MNE Podgorica s region is the main peach-growing area 45% of peach production posses enterprises (AD Plantaze 13. jul) AD Plantaze 13. jul (locality Ćemovsko field): 85 ha with 19 different cultivars

3 Investigation on peach viruses Previous surveys This survey Presence of PPV on plum (PPV-D and PPV-Rec) and peach (PPV-M) was confirmed in 2007 Zindovic et al., 2008 Viršček-Marn et al., 2008 PPV was confirmed in 17 out of 18 tested samples Presence of PLMVd was confirmed in 2011 Mavrič-Pleško et al Survey is conducted in Podgorica region (ca. 80 ha) Locality: Ćemovsko field 9 peach cultivars were examined for the presence of 9 peach viruses

4 Aim of investigation Presence of different economically important peach viruses in Montenegro Incidence of 9 peach viruses in different peach cultivars Molecular characterization of the most prevalent peach virus Molecular variability of selected PPV isolates Reconstruction of phylogenetic trees based on sequences of investigated virus isolates

5 Examined cultivars and viruses Cultivars (out of 19): Adriana Caldesi Gloria Maria Marta May Crest Morsiani Rita Star Spring Belle Spring Crest Viruses (9): Plum pox virus (PPV) Prunus necrotic ringspot virus (PNRSV) Prune dwarf virus (PDV) Apple chlorotic leaf spot virus (ACLSV) Peach mosaic virus (PMV) Cherry mottle leaf virus (CMLV) Strawberry latent ringspot virus (SLRSV) Tobacco ringspot virus (TRSV) Tomato ringspot virus (ToRSV)

6 Field survey In September and October 2011, 58 symptomatic leaves samples were collected Symtoms: chlorotic ringspots, veinal chlorosis, netting, leaf distortion, stunting, rosette formation blotches and deformations

7 Field survey cv. Ritastar cv. Ritastar Symptoms on Prunus persica indicative of PNRSV infection: hlorotic rings and spots, mosaic

8 cv. Ritastar 370/11 cv. Ritastar 372/11 Symptoms on Prunus persica indicative of PPV infections: vein chlorosis and netting

9

10 Molecular methods used for the detection of stone fruit viruses Virus Primers Primers sequences (5-3 ) ACLSV CMLV PMV PNRSV PDV PPV TRSV ToRSV SLRSV ACLSRV F ACLSV R PM16AFF PM16AFR PM16AFF CML-26R Ilar 2F Ilar 1R PDV 2F PDV 1R PPV F PPV R P241 P316D P316M PPV-DM probe TRSVf1 TRSVr1 ToRSVf1 ToRSVr1 3DR F1 2R2 5DF GGCAACCCTGGAACAGA CAGACCCTTATTGAAGTCGAA CAAACATGGCTTTCACCTTCTGCA TCTTGCCCCACCCTTCAACAAATG CAAACATGGCTTTCACCTTCTGCA AGATCCTCTTTCCCTTCTAAAATG CCACCGAGAGGTTGGCA TTCTAGCAGGTCTTCATCGA ATGGATGGGATGGATAAAATAGT TAGTGCAGGTTAACCAAAAGGAT CGATATCTTGAAGCTTTTTACG CTCTTGCACAAGAACTATAACC CGTTTATTTGGCTTGGATGGAA GATTAACATCACCAGCGGTGTG GATTCACGTCACCAGCGGTGTG FAM-CGTCGGAACACAAGAAGAGGACACAGA- TAMRA GGAAGCTGTATAAACTCAGC GTGTTGGACAAACACGACAC GGAAGCTGTATAAACTCAGC GTCCTCATGGAACCTTTCTC AGGCTCAAGAAAACACAC GGCTGATCCTCGTGAGAC GCGTGTGGCGTCGCTAAT CCCTTGGTTACTTTTACCTCCT Size of amplicon 358 bp Reference Nemichov et al., 1995 Method RT-PCR 419 bp Delano and RT-PCR 705 bp Upton, 1999 RT-PCR 206 bp 173 bp Candresse et al., 1997 Parakh et al., 1995 RT-PCR RT-PCR 1274 bp This work RT-PCR 243 bp Olmos et al., 2005 Real Time PCR 338 bp Martin et al., RT-PCR 512 bp 2009 RT-PCR 739 bp RT-PCR 203 bp Ratti et al., 2008 Nested PCR

11 Incidence of different stone fruit s viruses in Montenegrin peach 70.7% of samples were infected by at least one of ascertained viruses Single and double infections were confirmed, respectively, in 56.9% and 13.8% of the assayed plants Incidence of single and double infections not infected 29.3% duble infections 13.8% single infections 56.9% Molecular analysis revealed: Presence of PPV, PNRSV and PDV Double infection were found between PPV+PNRSV and PPV+PDV Absence of ACLSV, PMV, CMLV, SLRSV, TRSV and ToRSV from all tested samples

12 Incidence of PPV, PNRSV and PDV in examined peach cultivars Cultivar PPV PNRSV PDV PPV was detected in 60,3% of assayed samples PNRSV was detected in 18,9% of assayed samples PDV was detected in 1,7% of assayed samples Maria Marta Spring Belle Spring Crest Adriana May Crest Gloria Morsiani Rita Star Caldesi 83.3% 0% 0% 83.3% 0% 0% 75.0% 25.0% 0% 66.7% 0% 16.7% 66.7% 66.7% 0% 62.5% 0% 0% 62.5% 0% 0% 55.5% 55.5% 0% 0% 0% 0%

13 Detection of PPV by Real-Time RT-PCR 39 out of 58 samples showed positive results in Real-Time PCR 8 highly infected PPV isolates (from each infected cultivar) were chosen for further analysis Molecular variability is determined using RT-PCR and primers targeting CP region (1276 bp) 1276 bp negative control

14 Purification of PCR products Cloning in pgem-t Easy vector 8 PPV isolates were purified, cloned and sequenced Screening of colonies was performed by PCR using M13-for/M13-rev primers Purification of plasmid-dna ~1500 bp Sequencing Screening of colonies

15 Molecular characterization Nucleotide sequences of complete CP gene derived from Montenegrin isolates were compared with previously described PPV sequences deposited in GenBank (92,2 99,1%) BLAST analysis showed: MNE isolates from Gloria, May Crest, Adriana and Rita Star were the most closely related (97,1 99,1%) with isolate SK68 (M ) MNE isolates from Morsiani, Maria Marta and Spring Crest shared most identity (97,6 98,4%) with previously reported Montenegrin isolate Godinje 1 (HQ452396) from region of Bar MNE isolate from cv. Spring Belle was most similar with sequence of Greek isolate N1 (FJ361234) from peach.

16 Phylogenetic analysis Phylogenetic tree was constructed using Neighborn-Joining method with bootstrap analyses of 1000 replicates within MEGA 4.1 software (Tamura et al., 2007) Phylogenetic tree was generated from complete nucleotide sequence of CP gene of 44 PPV isolates: 8 from this study 36 from NCBI database

17 To date 7 PPV strains were defined (PPV-D, PPV-M, PPV-Rec, PPV-EA, PPV-W, PPV-T and PPV-C) All isolates clustered within 5 strain groups (PPV-D, PPV-M, PPV-Rec, PPV-T and PPV-C) Phylogenetic analysis using sequences of complete CP gene showed that all Montenegrin isolates from peach belong to PPV-M strain

18 Molecular analysis for PNRSV Detection of PNRSV by RT- PCR using Ilar2F/Ilar1R primers 206 bp 11 out of 58 assayed peach samples were positive on PNRSV PNRSV was confirmed in 3 cultivars: Rita Star, May Crest and Spring Crest Highest infection rate (66,7%) was confirmed in cv. May Crest RT-PCR using Ilar2F/Ilar 1R primers

19 Molecular characterization 4 PNRSV isolates derived from cv.s Rita Star (2), May Crest (1) and Spring Crest (1) were chosen for further analysis Complete CP gene was amplified by RT-PCR using MG1/MG2 primers (Glasa et al., 2008) Isolates were cloned and sequenced Screening of PNRSV isolates by PCR using M13-for/M13-rev

20 Sequence analyses of CP gene from PNRSV isolates proved to be % identical with corresponding sequences of isolates previously described 2 PNRSV isolates from cv. Rita Star were most closely related to Chilean NctCl.augl isolate from nectarine (EF565253) PNRSV isolates from cv.s May Crest and Spring Crest were most closely related to Italian isolate PchIt.may1 from peach cv. May Crest

21 Sequences of 4 PNRSV isolates were deposited in GenBank (JX JX569828) Isolates clustered within three groups: PE-5, PV-32 and PV MNE isolates from cv. Rita Star clustered in PE-5 group Isolates from cv. May Crest and Spring Crest clustered in PV-96 Phylogenetic tree was constructed using minimum-evolution method with Tamura-Nei corrected nt distance and bootstrap analyses of replicates within MEGA 4.1 software

22 Molecular analysis for PDV RT-PCR method using PDV-2F/PDV-1R primers (173 bp) Presence of PDV was confirmed in only 1 out of 58 samples BLAST analysis revealed high similarity, ranging from 94.2 to 96%, with isolates reported from other parts of the world Highest value MNE isolates showed with Ch 137 isolate (L28145) 173 bp RT-PCR for PDV (CP)

23 Conclusions RT-PCR were used to identify infection by PPV, PDV, PNRSV, ACLSV, PMV, CMLV, TRSV, ToRSV and SLRSV in stone fruits. Nested-PCR (n-pcr) method was also used to detect SLRSV and Real-time RT-PCR to detect PPV The study reported presence of one quarantine virus (PPV) and two quality viruses (PDV and PNRSV) The study reported very high incidence of PPV (60.3%). PNRSV was detected in 18.9% and PDV in 1.7% assayed samples All other assayed peach viruses were not detected in the collected samples

24 Real Time RT-PCR identified more PPV infected samples than RT-PCR indicating higher sensitivity Amplification of different amplicons from the detected viruses by RT-PCR, followed by cloning of complete and partial sequences of CP gene allowed phylogenetic analysis of isolates of different detected viruses: PPV (8), PNRSV (4) and PDV (1) Sequence analyses revealed that all Montenegrin PPV isolates shared from 92.2 to 99.1% nucleotide identity with corresponding PPV-M strain sequences deposited in GenBank

25 Results indicate the most probable introduction of PPV in Montenegro through peach propagation material which is mainly imported from Greece where this strain is the most prevailing one Phylogenetic analysis suggesting two possible introductions of PNRSV in Montenegro Molecular grouping of PNRSV isolates wasn t in correlation with geographical region and host Urgent sanitation measures should be taken: eradication of infected trees severe control related to importation of plant material

26 Thank you for your attention!!!

Molecular detection and characterization of viruses infecting sweet cherry trees in Greece

Molecular detection and characterization of viruses infecting sweet cherry trees in Greece Molecular detection and characterization of viruses infecting sweet cherry trees in Greece V.I. Maliogka, A.T. Katsiani, V. Drougkas, K. Efthimiou, N.I. Katis Lab of Plant Pathology, School of Agriculture,

More information

Identification of a Cucumber mosaic virus Subgroup II Strain Associated with Virus-like Symptoms on Hosta in Ohio

Identification of a Cucumber mosaic virus Subgroup II Strain Associated with Virus-like Symptoms on Hosta in Ohio 2013 Plant Management Network. Accepted for publication 18 December 2012. Published. Identification of a Cucumber mosaic virus Subgroup II Strain Associated with Virus-like Symptoms on Hosta in Ohio John

More information

GenOMe ORGanIZaTIOn and SeQUenCe DIVeRSITY Of a novel blackberry ampelovirus

GenOMe ORGanIZaTIOn and SeQUenCe DIVeRSITY Of a novel blackberry ampelovirus GenOMe ORGanIZaTIOn and SeQUenCe DIVeRSITY Of a novel blackberry ampelovirus T. Thekke-Veetil 1, S. Sabanadzovic 2, K.e. Keller 3, R.R. Martin 3, I.e. Tzanetakis 1* 1 Department of Plant Pathology, Division

More information

TECHNICAL SHEET No. 21. Virus Detection: Potato virus Y (PVY)

TECHNICAL SHEET No. 21. Virus Detection: Potato virus Y (PVY) TECHNICAL SHEET No. 21 Virus Detection: Potato virus Y (PVY) Method: Immunocapture RT-PCR, RFLP Immunocapture RT-PCR General Virus detected: PVY from potato General method: IC-RT-PCR, RFLP-IC-RT-PCR Developed

More information

A TaqMan-based Quantitative RT-PCR Method for Detection of Apple Chlorotic Leaf Spot Virus in Hawthorns Wenyan Zheng 1, Wei Guo 2, Hongyan Dai 3*

A TaqMan-based Quantitative RT-PCR Method for Detection of Apple Chlorotic Leaf Spot Virus in Hawthorns Wenyan Zheng 1, Wei Guo 2, Hongyan Dai 3* A TaqMan-based Quantitative RT-PCR Method for Detection of Apple Chlorotic Leaf Spot Virus in Hawthorns Wenyan Zheng 1, Wei Guo 2, Hongyan Dai 3* College of Horticulture, Shenyang Agricultural University,

More information

Myrta A. (ed.), Di Terlizzi B. (ed.), Savino V. (ed.). Production and exchange of virus-free plant propagating material in the Mediterranean region

Myrta A. (ed.), Di Terlizzi B. (ed.), Savino V. (ed.). Production and exchange of virus-free plant propagating material in the Mediterranean region Lebanon Choueiri E. in Myrta A. (ed.), Di Terlizzi B. (ed.), Savino V. (ed.). Production and exchange of virus-free plant propagating material in the Mediterranean region Bari : CIHEAM Options Méditerranéennes

More information

Diagnosis and Quantification of Strawberry Vein Banding Virus Using Molecular Approaches

Diagnosis and Quantification of Strawberry Vein Banding Virus Using Molecular Approaches Diagnosis and Quantification of Strawberry Vein Banding Virus Using Molecular Approaches Ali Mahmoudpour Department of Plant Pathology, University of California, Davis, CA, 95616, USA Current Address:

More information

Evaluation of the Prunus Interspecific Progenies for Resistance to Plum Pox Virus

Evaluation of the Prunus Interspecific Progenies for Resistance to Plum Pox Virus Evaluation of the Prunus Interspecific Progenies for Resistance to Plum Pox Virus Jaroslav SALAVA 1, Jaroslav POLÁK 1 and Ivan OUKROPEC 2 1 Department of Virology, Crop Research Institute, Prague-Ruzyně,

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

Identification of Interspecific Peach and Prunus sp. Hybrids Resistant to Plum Pox Virus Infection

Identification of Interspecific Peach and Prunus sp. Hybrids Resistant to Plum Pox Virus Infection Plant Protect. Sci. Vol. 46, 2010, No. 4: 139 144 Identification of Interspecific Peach and Prunus sp. Hybrids Resistant to Plum Pox Virus Infection Jaroslav Polák 1 and Ivan Oukropec 2 1 Department of

More information

Executive Summary. clinical supply services

Executive Summary. clinical supply services clinical supply services case study Development and NDA-level validation of quantitative polymerase chain reaction (qpcr) procedure for detection and quantification of residual E.coli genomic DNA Executive

More information

SUPPLEMENTARY MATERIAL AND METHODS

SUPPLEMENTARY MATERIAL AND METHODS SUPPLEMENTARY MATERIAL AND METHODS Amplification of HEV ORF1, ORF2 and ORF3 genome regions Total RNA was extracted from 200 µl EDTA plasma using Cobas AmpliPrep total nucleic acid isolation kit (Roche,

More information

First record of Tomato chlorotic spot virus in the USA

First record of Tomato chlorotic spot virus in the USA Tropical Plant Pathology, vol. 37(5):333-338, 2012 Copyright by the Brazilian Phytopathological Society. Printed in Brazil. www.sbfito.com.br SHORT COMMUNICATION / COMUNICAÇÃO First record of Tomato chlorotic

More information

Plants Fight it out Intrinsic defence mechanism The magic world of Gene silencing

Plants Fight it out Intrinsic defence mechanism The magic world of Gene silencing I LOVE YOU Plants Fight it out Intrinsic defence mechanism The magic world of Gene silencing Over expression of Chalcone synthase gene to get Purple Petunias Napoli, Lemieux & Jorgensen,1990 Desired Effect

More information

CHAPTER 3 DEVELOPMENT OF DENV GROUP SPECIFIC REAL TIME RT-PCR

CHAPTER 3 DEVELOPMENT OF DENV GROUP SPECIFIC REAL TIME RT-PCR CHAPTER 3 DEVELOPMENT OF DENV GROUP SPECIFIC REAL TIME RT-PCR 28 Dengue is diagnosed by either detecting virus or antibody to the virus in blood. Isolation of virus in cell culture or in infant mouse brain

More information

Managing Nematodes and Tomato Ring Spot Virus in Vineyards

Managing Nematodes and Tomato Ring Spot Virus in Vineyards Managing Nematodes and Tomato Ring Spot Virus in Vineyards John M. Halbrendt Penn State University, Fruit Research & Extension Center, Billerville, PA Tomato Ringspot Virus on Chardonnay Hen and chick

More information

Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, ; ; 330 PCR, ; 329.

Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, ; ; 330 PCR, ; 329. Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, 240-245; 286-87; 330 PCR, 270-274; 329. Take Home Lesson(s) from Lecture 2: 1. DNA is a double helix of complementary

More information

Suggest a technique that could be used to provide molecular evidence that all English Elm trees form a clone. ... [1]

Suggest a technique that could be used to provide molecular evidence that all English Elm trees form a clone. ... [1] 1 Molecular evidence E Ulmus procera, form a genetically isolated clone. English Elms developed from a variety of elm brought to Britain from Rome in the first century A.D. Although English Elm trees make

More information

HOMOLOGY MODELLING AND PHYLOGENETIC ANALYSIS OF ALKALINE PHOSPHATASE, ACID PHOSPHATASE AND PHYTASE GENES FROM ASPERGILLUS FUMIGATUS

HOMOLOGY MODELLING AND PHYLOGENETIC ANALYSIS OF ALKALINE PHOSPHATASE, ACID PHOSPHATASE AND PHYTASE GENES FROM ASPERGILLUS FUMIGATUS ISSN: 0974-1496 e-issn: 0976-0083 CODEN: RJCABP http://www.rasayanjournal.com http://www.rasayanjournal.co.in OF ALKALINE PHOSPHATASE, ACID PHOSPHATASE AND PHYTASE GENES FROM ASPERGILLUS FUMIGATUS Neelakantan

More information

Cloning and Sequence Analysis of the 22-kDa Antigen Genes of Orientia tsutsugamushi Strains Kato, TA763, AFSC 7, , TH1814, and MAK 119

Cloning and Sequence Analysis of the 22-kDa Antigen Genes of Orientia tsutsugamushi Strains Kato, TA763, AFSC 7, , TH1814, and MAK 119 Cloning and Sequence Analysis of the 22-kDa Antigen Genes of Orientia tsutsugamushi Strains Kato, TA763, AFSC 7, 18-032460, TH1814, and MAK 119 HONG GE, a MIN TONG, a ANDREW LI, b RAJAN MEHTA, b AND WEI-MEI

More information

Cultivated Grapevines Represent a Symptomless Reservoir for the Transmission of Hop Stunt Viroid to Hop Crops: 15 Years of Evolutionary Analysis

Cultivated Grapevines Represent a Symptomless Reservoir for the Transmission of Hop Stunt Viroid to Hop Crops: 15 Years of Evolutionary Analysis Cultivated Grapevines Represent a Symptomless Reservoir for the Transmission of Hop Stunt Viroid to Hop Crops: 15 Years of Evolutionary Analysis Yoko Kawaguchi-Ito 1, Shi-Fang Li 2 *, Masaya Tagawa 3,

More information

Contents. 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA Introduction Principle...

Contents. 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA Introduction Principle... Contents 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA... 1 Introduction... 1 Principle... 1 Reagents Required and Their Role... 2 Procedure... 3 Observation... 4 Result

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

3 Designing Primers for Site-Directed Mutagenesis

3 Designing Primers for Site-Directed Mutagenesis 3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed

More information

SEROLOGICAL, BIOLOGICAL AND MOLECULAR DETECTION OF Prunus necrotic ringspot virus ON Rosa damascena Mill. IN TURKEY

SEROLOGICAL, BIOLOGICAL AND MOLECULAR DETECTION OF Prunus necrotic ringspot virus ON Rosa damascena Mill. IN TURKEY www.acta.media.pl O R I G I N A L P A P E R Acta Sci. Pol. Hortorum Cultus, 16(1) 2017, 145 150 ISSN 1644-0692 Accepted: 28.09.2016 SEROLOGICAL, BIOLOGICAL AND MOLECULAR DETECTION OF Prunus necrotic ringspot

More information

Plant Quarantine Measures and Procedures Required for Exporting Agricultural Products

Plant Quarantine Measures and Procedures Required for Exporting Agricultural Products Plant Quarantine Measures and Procedures Required for Exporting Agricultural Products March 2015 Ministry of Agriculture, Forestry and Fisheries Standard Export Procedures and Plant Quarantine Inspection

More information

Detection of Potato virus Y in pepper by ELISA-RT-nested PCR

Detection of Potato virus Y in pepper by ELISA-RT-nested PCR Phytopathol. Mediterr. (2005) 44, 75 79 Detection of Potato virus Y in pepper by ELISA-RT-nested PCR KARIM BOUGATEF 1, RAJA T. MARRAKCHI 1, HOUSSEIN K. EL KHIL 1, MOHAMED A. JARBOUI 2 and AMEL B. AMMAR

More information

LAMP User Guide Assay Design & Primers

LAMP User Guide Assay Design & Primers Contents Page Page Content 2 Assay Design overview 3 Assay Design Custom Design Service 4 Assay Design - Software 5 Assay Design Target Sequence 7 Primers Primer Concentrations 9 Primers Preparing Primer

More information

Hammer blot-mediated RNA extraction: an inexpensive, labor-saving method to extract RNA for plant virus detection

Hammer blot-mediated RNA extraction: an inexpensive, labor-saving method to extract RNA for plant virus detection Hammer blot-mediated RNA extraction: an inexpensive, labor-saving method to extract RNA for plant virus detection Md. Shamim Akhter et al. Online Supplementary Materials Supplementary methods Preparation

More information

Hānai Ai / The Food Provider June - July - August 2011

Hānai Ai / The Food Provider June - July - August 2011 Evaluations of Tomato Yellow Leaf Curl Virus Resistant Varieties for Commercial Production Jari Sugano, Michael Melzer, Archana Pant, Ted Radovich, Steve Fukuda, and Susan Migita Tomatoes are an important

More information

Unit 3.notebook June 03, Genetic Counseling. May 11 12:18 PM. Genetic Counseling

Unit 3.notebook June 03, Genetic Counseling. May 11 12:18 PM. Genetic Counseling Genetic Counseling Until recently, it was very difficult to determine the health of an unborn baby. Today, with new research and technology, information can be gathered during: > fetal development > before

More information

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità Detection of Enterotoxigenic Escherichia coli in food by Real Time PCR amplification of the lt, sth, and stp genes, encoding the heat-labile and heat-stable enterotoxins 1. Aim and field of application

More information

Int. J. Biosci Dolores et al.

Int. J. Biosci Dolores et al. International Journal of Biosciences IJB ISSN: 2220-6655 (Print), 2222-5234 (Online) http://www.innspub.net Vol. 8, No. 2, p. 149-158, 2016 RESEARCH PAPER OPEN ACCESS Isolation and identification of Hibiscus

More information

CaMV promoter & NOS terminator detection

CaMV promoter & NOS terminator detection Primerdesign TM Ltd GMO event quantification CaMV promoter & NOS terminator detection Detection and quantification of GMO integration events in Soya by real-time PCR 100 tests Kit contents CaMV-GM primer/probe

More information

Supplemental Materials. DNA preparation. Dehalogenimonas lykanthroporepellens strain BL-DC-9 T (=ATCC

Supplemental Materials. DNA preparation. Dehalogenimonas lykanthroporepellens strain BL-DC-9 T (=ATCC Supplemental Materials DNA preparation. Dehalogenimonas lykanthroporepellens strain BL-DC-9 T (=ATCC BAA-1523 = JCM 15061) was grown in defined basal medium amended with 0.5 mm 1,1,2- trichloroethane (1,1,2-TCA)

More information

Student Learning Outcomes (SLOS)

Student Learning Outcomes (SLOS) Student Learning Outcomes (SLOS) KNOWLEDGE AND LEARNING SKILLS USE OF KNOWLEDGE AND LEARNING SKILLS - how to use Annhyb to save and manage sequences - how to use BLAST to compare sequences - how to get

More information

NOTES - CH 15 (and 14.3): DNA Technology ( Biotech )

NOTES - CH 15 (and 14.3): DNA Technology ( Biotech ) NOTES - CH 15 (and 14.3): DNA Technology ( Biotech ) Vocabulary Genetic Engineering Gene Recombinant DNA Transgenic Restriction Enzymes Vectors Plasmids Cloning Key Concepts What is genetic engineering?

More information

Journal of Virological Methods

Journal of Virological Methods Journal of Virological Methods 171 (2011) 190 194 Contents lists available at ScienceDirect Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet Detection of Tomato black ring

More information

Complete genome sequence of a potyvirus infecting yam beans (Pachyrhizus spp.) in Peru.

Complete genome sequence of a potyvirus infecting yam beans (Pachyrhizus spp.) in Peru. Arch Virol (2012) 157:773 776; DOI 10.1007/s00705-011-1214-6 Complete genome sequence of a potyvirus infecting yam beans (Pachyrhizus spp.) in Peru. Segundo Fuentes, Bettina Heider, Ruby Carolina Tasso,

More information

First Molecular Characterization of Strawberry Vein Banding Virus Naturally Spread in Mixed Infection with Fruit Phyllody Phytoplasma in Egypt

First Molecular Characterization of Strawberry Vein Banding Virus Naturally Spread in Mixed Infection with Fruit Phyllody Phytoplasma in Egypt International Journal of Virology and Molecular Biology 2015, 4(2): 23-36 DOI: 10.5923/j.ijvmb.20150402.02 First Molecular Characterization of Strawberry Vein Banding Virus Naturally Spread in Mixed Infection

More information

Recombinant DNA Technology

Recombinant DNA Technology History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists

More information

Differentiation and Distribution of Cordyline Viruses 1 4 in Hawaiian ti Plants (Cordyline fruticosa L.)

Differentiation and Distribution of Cordyline Viruses 1 4 in Hawaiian ti Plants (Cordyline fruticosa L.) Viruses 2013, 5, 1655-1663; doi:10.3390/v5071655 Article OPEN ACCESS viruses ISSN 1999-4915 www.mdpi.com/journal/viruses Differentiation and Distribution of Cordyline Viruses 1 4 in Hawaiian ti Plants

More information

August 2015 PEST Report - THE NETHERLANDS

August 2015 PEST Report - THE NETHERLANDS August 2015 PEST Report - THE NETHERLANDS National Plant Protection Organization POBox 9102 6700 HC Wageningen 1.1 Finding of Strawberry crinkle virus (SCV) in Fragaria plants for planting, variety Fleurette,

More information

Product# TM Intended Use. use only and not for use in diagnostic procedures.

Product# TM Intended Use. use only and not for use in diagnostic procedures. 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Norovirus TaqMan RT-PCR Kit Product# TM41400 Product Insert Intended

More information

Sarajevo April Regional Workshop on Implementation of Phytosanitary Standards in Forestry PLANT PROTECTION DIRECTORATE

Sarajevo April Regional Workshop on Implementation of Phytosanitary Standards in Forestry PLANT PROTECTION DIRECTORATE Sarajevo 15-18 April 2013 Regional Workshop on Implementation of Phytosanitary Standards in Forestry PLANT PROTECTION DIRECTORATE Plant Health and Plant Quarantine Department Lidija Ristić-Matijević To

More information

Required Reading. Functional Genomics Research Stream. Pay Attention III III

Required Reading. Functional Genomics Research Stream. Pay Attention III III Required Reading Functional Genomics Research Stream Research Meeting: March 1, 2011 PCR Mediated Gene Deletion, Transformation of Yeast Screening for Gene Deletions by PCR Genomics Research Agenda Pay

More information

PRESENTING SEQUENCES 5 GAATGCGGCTTAGACTGGTACGATGGAAC 3 3 CTTACGCCGAATCTGACCATGCTACCTTG 5

PRESENTING SEQUENCES 5 GAATGCGGCTTAGACTGGTACGATGGAAC 3 3 CTTACGCCGAATCTGACCATGCTACCTTG 5 Molecular Biology-2017 1 PRESENTING SEQUENCES As you know, sequences may either be double stranded or single stranded and have a polarity described as 5 and 3. The 5 end always contains a free phosphate

More information

Ammonia-Oxidizing Bacteria in Biofilters Removing. Trihalomethanes are Related to Nitrosomonas oligotropha

Ammonia-Oxidizing Bacteria in Biofilters Removing. Trihalomethanes are Related to Nitrosomonas oligotropha AEM Accepts, published online ahead of print on January 0 Appl. Environ. Microbiol. doi:0./aem.0-0 Copyright 0, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.

More information

ISOLATION AND MOLECULAR CHARACTERIZATION OF THERMOTOLERANT BACTERIA FROM MANIKARAN THERMAL SPRING OF HIMACHAL PRADESH, INDIA ABSTRACT

ISOLATION AND MOLECULAR CHARACTERIZATION OF THERMOTOLERANT BACTERIA FROM MANIKARAN THERMAL SPRING OF HIMACHAL PRADESH, INDIA ABSTRACT ISOLATION AND MOLECULAR CHARACTERIZATION OF THERMOTOLERANT BACTERIA FROM MANIKARAN THERMAL SPRING OF HIMACHAL PRADESH, INDIA Ambika Verma 1*, & Poonam Shirkot 2 1*Ph.D Scholar, Department of Biotechnology,

More information

Detection of Erysiphe necator fungicide resistant alleles in environmental samples

Detection of Erysiphe necator fungicide resistant alleles in environmental samples Detection of Erysiphe necator fungicide resistant alleles in environmental samples Jesse Yamagata 1, Brent Warneke 2, Tara Neill 3, Walt Mahaffee 3, Timothy Miles 1 1 California State University Monterey

More information

Plum Pox Virus Survey of Sweet and Sour Cherry in Bulgaria

Plum Pox Virus Survey of Sweet and Sour Cherry in Bulgaria 732 Bulgarian Journal of Agricultural Science, 19 (No 4) 2013, 732-736 Agricultural Academy Plum Pox Virus Survey of Sweet and Sour Cherry in Bulgaria I. KAMENOVA 1, V. MAVRODIEVA 2, L. LEVY 2, S. MILUSHEVA

More information

Production of virus Free Plants

Production of virus Free Plants Production of virus Free Plants Tissue culture is an excellent tool for multiplying, maintaining, storing and distributing plants. Maintaining unique plants for breeding, propagation, or distribution can

More information

Amplicon Sequencing Template Preparation

Amplicon Sequencing Template Preparation Amplicon Sequencing Template Preparation The DNA sample preparation procedure for Amplicon Sequencing consists of a simple PCR amplification reaction, but uses special Fusion Primers (Figure 1-1). The

More information

Optimizing Multiplex qpcr for Detecting Infectious Diseases

Optimizing Multiplex qpcr for Detecting Infectious Diseases Optimizing Multiplex qpcr for Detecting Infectious Diseases Aurita Menezes Ph.D, qpcr Product Manager Integrated DNA Technologies Agenda Establishing robust multiplex assays In the context of Gene expression

More information

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright

More information

CELLTECHGEN For Research Only. Construction of sgrna expression vector for Lenti-virus system (Example: Lenti-U6 sgrna-ef1 -Puro vector)

CELLTECHGEN For Research Only. Construction of sgrna expression vector for Lenti-virus system (Example: Lenti-U6 sgrna-ef1 -Puro vector) Construction of sgrna expression vector for Lenti-virus system (Example: Lenti-U6 sgrna-ef1 -Puro vector) Catalog number: CTG-CAS9-11 Introduction The vector Lenti-U6 sgrna-ef1 -Puro is designed for expression

More information

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can

More information

Intended Use Norgen s Giardia intestinalis End-Point RT-PCR Kit is designed for the detection of Giardia

Intended Use Norgen s Giardia intestinalis End-Point RT-PCR Kit is designed for the detection of Giardia 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Giardia intestinalis End-Point RT-PCR Kit Product# EP43800 Product

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing

More information

CELLTECHGEN For Research Only. Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector)

CELLTECHGEN For Research Only. Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector) Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector) Catalog number: CTG-CAS9-18 Introduction The vector Lenti-EF1 -Cas9-EGFP-U6 sgrna is designed for

More information

Mycobacterium tuberculosis End-Point PCR Kit Product# EP42100

Mycobacterium tuberculosis End-Point PCR Kit Product# EP42100 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Mycobacterium tuberculosis End-Point PCR Kit Product# EP42100

More information

Development of TaqMan Assays Towards the Detection of Parsnip yellow fleck virus and Anthriscus yellows virus

Development of TaqMan Assays Towards the Detection of Parsnip yellow fleck virus and Anthriscus yellows virus Latvijas Entomologs, 24, 41: 87-92. 87 Development of TaqMan Assays Towards the Detection of Parsnip yellow fleck virus and Anthriscus yellows virus JULIE NORTH 1, ANNE MORTON 2, DEZ BARBARA 2, NICOLA

More information

Tagging Low Temperature Responsive Promoters in Banana Using the Luciferase Reporter Gene

Tagging Low Temperature Responsive Promoters in Banana Using the Luciferase Reporter Gene Laboratory of Tropical Crop Improvement Tagging Low Temperature Responsive Promoters in Banana Using the Luciferase Reporter Gene E. Santos, S. Remy, E. Thiry, S. Windelinckx, R. Swennen and L. Sági KATHOLIEKE

More information

Distribution and Characteristics of Groundnut Rosette Disease in Kenya

Distribution and Characteristics of Groundnut Rosette Disease in Kenya Distribution and Characteristics of Groundnut Rosette Disease in Kenya A. W. Wangai, Department of Plant Pathology, S. S. Pappu, Department of Entomology, H. R. Pappu, Department of Plant Pathology, University

More information

Activities of Plum and Prune WG in 2015

Activities of Plum and Prune WG in 2015 Activities of Plum and Prune WG in 2015 E. Kaufmane, Dr.biol. Latvia State Institute of Fruit Growing Graudu Str.1, Dobele, LV 3701, LATVIA, www.lvai.lv III EUFRIN Plum and Prune Working Group Meeting

More information

Comparative Virus Resistance and Fruit Yield of Transgenic Squash with Single and Multiple Coat Protein Genes

Comparative Virus Resistance and Fruit Yield of Transgenic Squash with Single and Multiple Coat Protein Genes Comparative Virus Resistance and Fruit Yield of Transgenic Squash with Single and Multiple Coat Protein Genes Marc Fuchs, Department of Plant Pathology, Cornell University, New York State Agricultural

More information

Genetic Engineering & Recombinant DNA

Genetic Engineering & Recombinant DNA Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied

More information

White spot syndrome virus

White spot syndrome virus TM Primerdesign Ltd White spot syndrome virus Anti-apoptosis Protein Gene genesig Advanced Kit 150 tests For general laboratory and research use only 1 Introduction to White spot syndrome virus White spot

More information

ifp Institut für Produktqualität GmbH (Institute for Product Quality), Teltowkanalstr. 2, Berlin, Germany

ifp Institut für Produktqualität GmbH (Institute for Product Quality), Teltowkanalstr. 2, Berlin, Germany Determination of apricot kernel components in marzipan and semi-finished marzipan products with realtime (probe) PCR Wolfgang Weber* and Wolfgang Hauser ifp Institut für Produktqualität GmbH (Institute

More information

The Polymerase Chain Reaction. Chapter 6: Background

The Polymerase Chain Reaction. Chapter 6: Background The Polymerase Chain Reaction Chapter 6: Background PCR Amplify= Polymerase Chain Reaction (PCR) Invented in 1984 Applications Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off

More information

Operational Guidelines. Export of Fresh Blueberry Fruit from Oregon to Korea. April 10, 2012

Operational Guidelines. Export of Fresh Blueberry Fruit from Oregon to Korea. April 10, 2012 Operational Guidelines Export of Fresh Blueberry Fruit from Oregon to Korea April 10, 2012 This document provides guidance on the operational aspects for the export to Korea of fresh blueberry fruit produced

More information

pfb and pfb-neo Retroviral Vectors

pfb and pfb-neo Retroviral Vectors pfb and pfb-neo Retroviral Vectors INSTRUCTION MANUAL Catalog #217563 (pfb Retroviral Vector) and #217561 (pfb-neo Retroviral Vector) Revision A For In Vitro Use Only 217561-12 LIMITED PRODUCT WARRANTY

More information

Molecular Genetics Techniques. BIT 220 Chapter 20

Molecular Genetics Techniques. BIT 220 Chapter 20 Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant

More information

Roche Molecular Biochemicals Technical Note No. LC 10/2000

Roche Molecular Biochemicals Technical Note No. LC 10/2000 Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce

More information

Genetics and Genomics in Medicine Chapter 3. Questions & Answers

Genetics and Genomics in Medicine Chapter 3. Questions & Answers Genetics and Genomics in Medicine Chapter 3 Multiple Choice Questions Questions & Answers Question 3.1 Which of the following statements, if any, is false? a) Amplifying DNA means making many identical

More information

Transport of Potato Lipoxygenase into the Vacuole Larsen, Mia Kruse Guldstrand; Welinder, Karen Gjesing; Jørgensen, Malene

Transport of Potato Lipoxygenase into the Vacuole Larsen, Mia Kruse Guldstrand; Welinder, Karen Gjesing; Jørgensen, Malene Aalborg Universitet Transport of Potato Lipoxygenase into the Vacuole Larsen, Mia Kruse Guldstrand; Welinder, Karen Gjesing; Jørgensen, Malene Publication date: 2009 Document Version Publisher's PDF, also

More information

DNA Technology. Asilomar Singer, Zinder, Brenner, Berg

DNA Technology. Asilomar Singer, Zinder, Brenner, Berg DNA Technology Asilomar 1973. Singer, Zinder, Brenner, Berg DNA Technology The following are some of the most important molecular methods we will be using in this course. They will be used, among other

More information

Chapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi

Chapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi Chapter 17. PCR the polymerase chain reaction and its many uses Prepared by Woojoo Choi Polymerase chain reaction 1) Polymerase chain reaction (PCR): artificial amplification of a DNA sequence by repeated

More information

Material and methods. Samples

Material and methods. Samples 290 Material and methods Samples Six strains, derived from single females collected in the wild, from different D. gouveai population were analyzed: J79L67 (Ibotirama/BA); J18E2 (Pireno polis/go); H27S1

More information

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics

More information

CHAPTER 9 DNA Technologies

CHAPTER 9 DNA Technologies CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes

More information

Transformation of Nicotiana tabacum cv. Samsun by the Coat Protein Gene of PVY NTN

Transformation of Nicotiana tabacum cv. Samsun by the Coat Protein Gene of PVY NTN Phyton (Austria) Special issue: "Plant Physiology" Vol. 39 Fasc. 3 (271M276) 3. 11. 1999 Transformation of Nicotiana tabacum cv. Samsun by the Coat Protein Gene of PVY NTN Darja STANIC, Borut STRUKELJ

More information

Comparison of ELISA and RT-PCR for the detection of PNRSV and PDV in Australian almond trees

Comparison of ELISA and RT-PCR for the detection of PNRSV and PDV in Australian almond trees Comparison of ELISA and RT-PCR for the detection of PNRSV and PDV in Australian almond trees Mekuria G., Ramesh S.A., Bertozzi T., Wirthensohn M.G., Collins G., Sedgley M., Alberts E. in Oliveira M.M.

More information

Microarrays: since we use probes we obviously must know the sequences we are looking at!

Microarrays: since we use probes we obviously must know the sequences we are looking at! These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression

More information

PCR settings, pitfalls and artefacts

PCR settings, pitfalls and artefacts De gekoppelde afbeelding kan niet worden weergegeven. Het bestand is mogelijk verplaatst, heeft een andere naam gekregen of is verwijderd. Controleer of de koppeling verwijst naar het juiste bestand en

More information

Antibiotic Resistance: Ampicillin Bacterial Backbone: pbluescriptksii(+), Agilent Technologies

Antibiotic Resistance: Ampicillin Bacterial Backbone: pbluescriptksii(+), Agilent Technologies G0656 pfiv3.2rsvmcs Coordinates Plasmid Features 1-682 CMV/5 LTR hybrid 958-1468 Partial Gag 1494-1653 Central Polypurine Tract 1695-2075 RSV Promoter 2104-2222 Multiple Cloning Sites 2244-2839 WPRE 2868-3009

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name collagen, type IV, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID COL4A1 Human This gene encodes the major type IV alpha

More information

The Isolation and Sequence Analysis of the Cryptochrome (Cry1) Gene From a Petunia hybrida Plant. By Jenalyn Quevedo

The Isolation and Sequence Analysis of the Cryptochrome (Cry1) Gene From a Petunia hybrida Plant. By Jenalyn Quevedo The Isolation and Sequence Analysis of the Cryptochrome (Cry1) Gene From a Petunia hybrida Plant By Jenalyn Quevedo Biology 115L June 6, 2005 1 Abstract The blue-light photoreceptor cryptochrome (cry1)

More information

PCR MultiScan for quick disease diagnosis. By Sukhi Pannu CSP Labs California Seed and Plant Lab., Inc.

PCR MultiScan for quick disease diagnosis. By Sukhi Pannu CSP Labs California Seed and Plant Lab., Inc. PCR MultiScan for quick disease diagnosis By Sukhi Pannu CSP Labs California Seed and Plant Lab., Inc. Agenda About CSP Labs Easy diagnosis - symptoms PCR MultiScan for difficult samples About us 15 years

More information

3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) Fax: (905)

3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) Fax: (905) 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com E.coli O157:H7 End-Point PCR Kit Product# EP41300 Product Insert

More information

Texas A&M AgriLife Research LOWER RIO GRANDE VALLEY REGION RESEARCH GOALS AND IMPACTS. Texas A&M AgriLife Research and Extension Center at Weslaco

Texas A&M AgriLife Research LOWER RIO GRANDE VALLEY REGION RESEARCH GOALS AND IMPACTS. Texas A&M AgriLife Research and Extension Center at Weslaco Texas A&M AgriLife Research LOWER RIO GRANDE VALLEY REGION RESEARCH GOALS AND IMPACTS Texas A&M AgriLife Research and Extension Center at Weslaco 2015 GOAL Protect water quality and increase the amount

More information

Genetic Diversity of a Natural Population of Apple stem pitting virus Isolated from Apple in Korea

Genetic Diversity of a Natural Population of Apple stem pitting virus Isolated from Apple in Korea Plant Pathol. J. 30(2) : 195-199 (2014) http://dx.doi.org/10.5423/ppj.nt.02.2014.0015 pissn 1598-2254 eissn 2093-9280 Note Open Access The Plant Pathology Journal The Korean Society of Plant Pathology

More information

European stone fruit yellows phytoplasmas associated with a decline disease of apricot in southern England

European stone fruit yellows phytoplasmas associated with a decline disease of apricot in southern England Plant Pathology (2000) 49, 635±639 European stone fruit yellows phytoplasmas associated with a decline disease of apricot in southern England D. L. Davies*² and A. N. Adams Horticulture Research International,

More information

Response of Potato Cultivars to Five Isolates Belonging to Four Strains of Potato virus Y

Response of Potato Cultivars to Five Isolates Belonging to Four Strains of Potato virus Y Response of Potato Cultivars to Five Isolates Belonging to Four Strains of Potato virus Y e-xtra* Bihua Nie, National Center for Vegetable Improvement (Central China), MOE Key Laboratory of Horticultural

More information

Cold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual

Cold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual Fusion Cloning technology Cold Fusion Cloning Kit Store the master mixture and positive controls at -20 C Store the competent cells at -80 C. (ver. 120909) A limited-use label license covers this product.

More information

Researchs on phenotypic evaluation of apricot hybrids concerning the genetic resistance to ppv (Plum pox virus)

Researchs on phenotypic evaluation of apricot hybrids concerning the genetic resistance to ppv (Plum pox virus) Volume 18(3), 8-12, 2014 JOURNAL of Horticulture, Forestry and Biotechnology www.journal-hfb.usab-tm.ro Researchs on phenotypic evaluation of apricot hybrids concerning the genetic resistance to ppv (Plum

More information

Identification of the major bacterial groups in the digestive tract of cod and haddock

Identification of the major bacterial groups in the digestive tract of cod and haddock Identification of the major bacterial groups in the digestive tract of cod and haddock Neil McEwan Institute of Biological, Environmental and Rural Sciences, Llanbadarn Campus, Aberystwyth University,

More information

Prevalence and Detection of Tomato Leaf Curl Virus from Low Altitude Subtropical Areas of Jammu and Kashmir

Prevalence and Detection of Tomato Leaf Curl Virus from Low Altitude Subtropical Areas of Jammu and Kashmir International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 5 Number 11 (2016) pp. 768-773 Journal homepage: http://www.ijcmas.com Original Research Article http://dx.doi.org/10.20546/ijcmas.2016.511.088

More information

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR

More information