Chen et al. Supplemental Information. Supplemental Materials and Methods

Transcription

1 Supplemental Information Supplemental Materials and Methods Mouse histological analysis and immunohistochemistry Number 4 (inguinal) mammary glands were analyzed by carmine whole mount staining as described (Rasmussen et al., 2000). Mammary tissue was fixed in 4% paraformaldehyde (PFA) at 4 C, paraffin-embedded, sectioned (at 5 μm), and stained with hematoxylin and eosin. For BrdU labeling, mice were injected with BrdU at 30 μg/g (BrdU/body weight) 2 h prior to dissection. Apoptosis was detected by In Situ Cell Death Detection Kit, TMR Red (Roche) following the manufacturer s protocol. Primary antibodies used for immunofluorescence (IF) were: Cy3-anti-α-smooth muscle actin (Sigma, 1:200), rabbit anti- (Cell Signaling, 1:100), mouse anti- (Sigma, 1:100), rabbit anti-aqp5 (Alpha Diagnostics, 1:50), rabbit anti- NKCC1 (gift from Dr. James Turner, 1:500), rabbit anti-beta casein (gift from Dr. Margaret C. Neville, 1:1200), rabbit anti-npt2b (gift from Dr. Jürg Biber, 1:300), rabbit anti-p-stat5 (Cell Signaling, 1:400), rabbit anti-keratin 14 (Covance, 1:400), mouse anti-brdu(1:100) and rat anti- Keratin 8(1:250) (Developmental Studies Hybridoma Bank). Cy3-conjugated goat anti-mouse (1:250) and Alexa488-conjugated goat anti-rabbit secondary antibodies (1:250) (Molecular Probes) were used for immunofluorescence. Immunohistochemistry (IHC) staining was performed on paraffin sections using a Vectastain ABC kit according to manufacturer's instructions (Vector Laboratories, Burlingame, CA). Primary antibodies used for IHC were: rabbit anti- (Cell Signaling, 1:100), rabbit anti-p- (Cell Signaling, 1:400), rabbit anti-phistone H3 (Millipore, 1:400) and rabbit anti-cleaved Caspase-3 (Cell Signaling, 1:100). Western blotting, RT-PCR and qpcr Whole cell extracts were prepared from mammary glands and the extracted proteins were analyzed. Primary antibodies used for western blot were: rabbit anti- (Cell Signaling, 1:1000), rabbit anti-/taz (Cell Signaling, 1:1000) and anti-actin (Millipore, 1:5000). Signals were quantified by LI-COR Infrared Imaging System.

2 RNA from mammary glands was extracted using the TRIzol reagent (Invitrogen). The RNA was treated with RNase-free DNase I and reverse-transcribed with oligo(dt) primer using the SuperScript First-Strand Synthesis System for RT-PCR (Invitrogen). Primers for RT-PCR are as follow: Yap, 5 -CAGAATGCTGCGAGGTCATA -3 (forward) and 5 - ATGGCCTCAAATGACTGACC-3 (reverse); Sav1, 5 - GTCATCCCCTTGAACGAGAA -3 (forward) and 5 - ATACCACTGCTGCCTCTGCT -3 (reverse); Gapdh, 5 - TGTTCCTACCCCCAATGTGT-3 (forward) and 5 - TGTGAGGGAGATGCTCAGTG -3 (reverse).quantitative Real-time PCR (qpcr) was performed using the iq SYBR Green Supermix (Bio-Rad) on a iq5 multicolor Real-time PCR Detection System (Applied Biosystems). qpcr was done in triplicate, using Gapdh as a housekeeping control. Relative differences in the expression of the candidate genes in different experimental mouse livers were determined using 2- Ct method (Livak and Schmittgen, 2001). Primers for qpcr are as follow: TAZ, 5 - GAAGGTGATGAATCAGCCTCTG -3 (forward) and 5 - GTTCTGAGTCGGGTGGTTCTG- 3 (reverse); Gapdh, 5 - CCCAATGTGTCCGTCGTGGAT-3 (forward) and 5 - TGTAGCCCAAGATGCCCTTCAG-3 (reverse). Mammary organoid culture Organoid cultures were prepared as previously described (Ewald et al., 2008), but culture conditions were optimized for pregnancy derived tissues through the addition of hydrocortisone and prolactin. Briefly, glands were minced and then shaken for 30 min at 37 degrees C in a 50 ml DMEM/F12 (GIBCO-BRL) medium containing 0.1 g trypsin (GIBCO-BRL), 0.1 g collagenase (Sigma C5138), 5 ml fetal calf serum, 250 µl of 1 µg/ml insulin, and 50 µl of 50 µg/ml gentamicin (GIBCO-BRL). The collagenase solution was centrifuged at 1500 rpm for 10 min, dispersed through 10 ml DMEM/F12, centrifuged at 1500 rpm for 10 min, and then resuspended in 4 ml DMEM/F µl DNase (2U/µl) (Sigma). Organoids were separated from single cells through four differential centrifugations (pulse to 1500 rpm in 10 ml DMEM/F12). The final pellet was resuspended in the desired amount of Growth Factor Reduced Matrigel (BD Biosciences), supplemented with standard FGF2 organoid media (DMEM/F12, 1% ITS-X (Invitrogen ), 1% penicillin/streptomycin (Sigma P4333), 2.5 nm FGF2 (Sigma F0291))

3 with 1X hydrocortisone (1µg/ml) (Sigma H4001) and 10 µg/ml prolactin (sigma L6520) after 1 day of embedding in matrigel. Tumor growth and metastasis in PyMT transgenic mice Male MMTV-Cre; Yap flox/+ ; PyMT mice were bred with Yap flox/flox mice to obtain female mice heterozygous for the PyMT transgene on a FVB/129/C57BL6 mixed background. Littermates were used as controls. Virgin mice were examined by palpation for tumors on a weekly basis. To examine metastasis, lungs were resected and surface metastatic foci were examined under a dissection microscope. Mammary tissues were fixed and analyzed for histology. Breast Cancer Cell Culture MDA-MB-361 cells and MDA-MB-453 cells were maintained in DMEM medium supplemented with 10% fetal bovine serum and antibiotics. T47D cells, ZR-75-1 cells and BT-483 cells were maintained in RPMI medium supplemented with 10% fetal bovine serum and antibiotics. MCF- 10A cells and MCF-12A cells were maintained in DMEM/F12 media with 5% horse serum, 20 ng/ml EGF, 100 ng/ml cholera toxin, 0.01 mg/ml insulin, 500 ng/ml hydrocortisone and antibiotics. SK-BR-3 cells were maintained in McCoys 5A media supplemented with 10% fetal bovine serum and antibiotics. Verteporfin was purchased from USP Reference Standards. Human breast cancer cell lines were seeded in 96-well plates with 0, 1, 3 or 10µm of verteporfin for 0-5 days followed by MTT assay (Promega; G4000). The experiments were repeated three times, and data represented as the mean of triplicate wells ± SD. Supplemental References Ewald,A.J., A.Brenot, M.Duong, B.S.Chan, and Z.Werb Collective epithelial migration and cell rearrangements drive mammary branching morphogenesis. Dev. Cell 14: Rasmussen,S.B., L.J.Young, and G.H.Smith Preparing mammary gland whole mounts from mice. in Methods in Mammary Gland Biology and Breast Cancer Research pp Springer.

4 Supplemental Figures. S1-S7 Figure S1. Dynamic changes of expression in mammary gland development revealed by immunohistochemical staining. (A-B) Low (A) and high (B) magnification images of terminal end buds in 6-week-old virgin gland. Note the nuclear staining in Cap cells (arrows) and the uniform intracellular distribution of in body cells (arrowheads). (C) 8-week-old virgin. Note the nuclear staining in myoepithelial cells (arrows) and the uniform intracellular distribution of in luminal cells (arrowheads). (D) Day 13.5 of pregnancy. Note the elevated levels and nuclear accumulation of protein in alveolar epithelial cells (arrowheads). (E) Day 1 of lactation. Note the significant reduction of protein levels in the alveoli compared to (B), and the presence of a few scattered -positive alveolar cells (arrowheads). (F) 3 weeks of involution. Note the nuclear staining in myoepithelial cells (arrow) and the uniform intracellular distribution of in luminal cells (arrowhead). Scale bar = 20 m.

5 Figure S1 A B C Virgin (6wks) D Virgin (6wks) E Virgin (8wks) F Preg. (13.5d) Lact. (1d) Invol. (3wks)

6 Figure S2. Characterization of Yap- and Sav1-deficient mammary glands. (A) RT-PCR analysis of Yap mrna in mammary glands from virgin and P13.5 control (MMTV- Cre only) and MMTV-Cre; Yap flox/flox mice. (B) immunostaining of mammary glands from virgin and P13.5 control (MMTV-Cre only) and MMTV-Cre; Yap flox/flox mice (with nuclear counterstaining by hematoxylin). Note the absence of protein in MMTV-Cre; Yap flox/flox mammary epithelia (compare arrows). (C) RT-PCR analysis of Sav1 mrna in mammary glands from virgin and P13.5 control (MMTV-Cre only) and MMTV-Cre; Sav1 flox/flox mice. (D) P13.5 control (MMTV-Cre only) and Sav1-deficient mammary glands stained by phospho- S112- antibody (corresponding to S127 of human ). Note the significant decrease of P- signal in Sav1-deficient mammary epithelia (compare arrows). Scale bar = 20 m. (E) Real-time PCR analysis of Taz mrna in mammary glands from 6-week-old virgin wild-type, MMTV-Cre; Yap flox/+ and MMTV-Cre; Yap flox/flox mice. Values are mean ±SEM, n=4. P>0.05, t- test. Note the similar Taz mrna level in mammary glands from different genotypes. (F) Control (MMTV-Cre only) and Sav1-deficient mammary glands at day 18.5 of pregnancy (P18.5) were stained for the luminal cell marker Keratin 8 (green) and the myoepithelial cell marker Keratin 14 (red). Scale bars = 20 m.

7 p- Sav1-/- Con Figure S2 A B C D E TAZ p- Con Con 1.5 Con Yap+/- Yap-/- Virgin (6wks) Preg. (13.5d) Preg. (13.5d) GAPDH Sav1 Con Yap Virgin P13.5 Yap-/- GAPDH Con Virgin P13.5 Sav1-/- Con Yap-/- Con Sav1-/- Yap-/- Yap-/- F K8/K14 P18.5 Control K8/K14 P18.5 Sav1-/-

8 Figure S3. Impaired mammary development in Yap-deficient and Sav1-deficient mammary glands. (A) Whole mount staining of control (MMTV-Cre only), Yap-deficient and Sav1-deficient mammary glands from 8-wk-old virgin and day 16.5 of pregnancy (P16.5). Note the normal appearance of Yap or Sav1 virgin glands. Also note the greatly reduced lobuloalveolar structures of Yap-deficient glands, and the tightly packed and un-distended alveoli of Sav1-deficient glands, in P16.5 glands. Scale bar = 500 m. (B) H&E staining of tissue sections from (A). Note the normal appearance of Yap or Sav1 virgin glands. In P16.5 animals, fewer ducts and lobuloalveoli were present in Yap-deficient glands, and the remaining lobuloalveoli were significantly smaller and had fewer cells per alveolus compared to control. In P16.5 animals, Sav1-deficient lobuloalveoli were un-distended but contained normal number of cells per alveolus. Also note the presence of lipid droplets (arrowheads) in control and Yap-mutant glands, but not in Sav1-mutant glands at P16.5. Scale bar = 50 m.

9 Figure S3 A Control Yap-/- Sav1-/- Virgin (8wks) P16.5 B Control Yap-/- Sav1-/- Virgin (8wks) P16.5

10 Figure S4. In vitro organoid cultures of Yap- and Sav1-deficient mammary epithelia show similar defects as the corresponding mutants in vivo. Mammary epithelia from control (MMTV-Cre only), Yap- or Sav1-deficient glands were cultured in vitro in the presence of prolactin to form organoids. A representative organoid is shown for each genotype (top), and a magnified view of the boxed area is also shown (bottom). Note the well-formed structures and the accumulation of lipid droplets (white arrowheads) in the normal organoid. The Yap1-deficient organoid was smaller than normal control but still produced lipid droplets (white arrowheads). In contrast, the Sav1-deficient organoid did not show obvious growth defect but lacked lipid droplets. Scale bar = 25 m.

11 Figure S4 Control Yap-/- Sav1-/-

12 Figure S5. Overexpression of led to mammary gland differentiation defects. (A) Western blotting analysis of mammary glands from day 18.5 pregnant wildtype and MMTVrtTA; TRE- transgenic mice. Note the increased protein levels in transgenic mammary glands. (B) immunostaining of mammary glands from 6-week-old virgin and P18.5 MMTV-rtTA; TRE- mice. Arrow and arrowhead mark mosaic mammary epithelia with and without overexpression, respectively. The virgin duct shown here contained both -overexpressing (arrow) and non-overexpressing (arrowhead) portions, and they displayed similar morphology. The terminal end bud shows normal morphology. Also note the non-distended morphology of -overexpressing alveoli (arrow) compared to the distended morphology of nonoverexpressing alveoli (arrowhead). Scale bars = 50 m. (C) BrdU labeling of -overexpressing and non-overexpressing alveoli at day 18.5 of pregnancy. Arrows (-overexpressing portions) and arrowheads ( non-overexpressing portions) mark selected BrdU-positive cells. The graph shows the percentage of BrdU-positive cells quantified from three mice. Data are mean ± SEM. P>0.05, t-test. Scale bar = 50 m.

13 Figure S5 A Con tg- α- α-actin B Duct TEB P18.5 C P18.5 BrdU P18.5 DAPI P18.5 %BrdU tg- tg- neg. positive

14 Figure S6. Loss of suppresses PyMT-induced tumor growth and metastasis. (A) Western blotting analysis of tissues from 5-month-old wild-type mammary gland and PyMT tumor. Note the increased and TAZ protein levels in PyMT tumor tissues. (B) Lung pictures from 22-week-old PyMT and Yap-deficient PyMT virgin mice. Note the multiple metastatic tumor foci on the surface of PyMT (arrows) but not the Yap-deficient PyMT lung. Scale bar=1cm.

15 Figure S6 A Control PyMT α-taz α- α-actin B PyMT PyMT; Yap-/-

16 Figure S7. expression levels in different human breast cancer cell lines expression levels in different human breast cancer cell lines, analyzed by western blotting (top) and quantified relative to actin protein levels (bottom).

17 Figure S7 ACTIN MCF-10A MDA-MB-361 MDA-MB-453 SK-BR-3 T47D ZR-75-1 MCF-12A BT MCF-10A MDA-MB-361 MDA-MB-453 SK-BR-3 T47D ZR-75-1 MCF-12A BT-483