Supplemental Figure 1
|
|
- Christine Theodora Jefferson
- 5 years ago
- Views:
Transcription
1 Supplemental Fig. 1. Kinetics of,,, AKT and ERK activation in BMMCs following SCF stimulation. Starved BMMCs were stimulated with 250ng/mL of SCF for the indicated time. Soluble Cell Lysates (SCLs) were analysed by western-blotting (60µg of proteins per lane). KIT,,,, AKT and ERK activation were assessed using specific phospho-antibody and each membrane was then stripped and reprobed with their respective antibodies. The last lane was loaded with a lysate of BMMCs obtained from KIT-D816V transgenic mice (BMMC16M). Supplemental Fig. 2. Effect of jak3 sirna on STAT phosphorylation. P815 cells, treated either with control (c) or jak3 sirna, were starved and lysed. The SCLs were immunoblotted with phopho-stat specific antibodies as indicated and anti-erk as loading control. Supplemental Fig. 3. GSK3, p38, PKA, PKG, and CAMKII are not implicated in, -3, - 5 serine phosphorylation. P815 and HMC-1 cells were starved overnight and subsequently treated with the indicated chemical inhibitors. The SCLs were immunoprecipitated using anti-stat specific antibodies. Immunocomplexes were resolved by SDS-PAGE and probed with anti-phosphoserine specific antibodies, stripped and reprobed with the corresponding anti-stat antibodies. (A) H-89 is a PKA inhibitor, PKG is a PKG inhibitor and SB is a GSK3 inhibitor. (B) SB is a p38 inhibitor. (C) KN-93 is a CAMKII inhibitor. (D) SB216763, SB and U0126 were controlled on their respective molecular targets in both HMC-1 and P815 cells. The inhibitors did not show activity on KIT tyrosine phosphorylation. Supplemental Fig. 4. Controls for the interaction between KIT and STAT proteins. (A) Interaction of KIT and in HMC-1 cells. Co-immunoprecipitations were done as in Fig. 4. Lysates were immunoprecipitated either with anti-kit or control IgG1 (c) antibodies. Dasatinib was used at 1 µm. (B) Co-immunoprecipitations of STAT proteins with KIT were done as in Fig. 4. The lysate (SCL) is shown to compare protein expression in the lysate with the bound fraction. The panel showing was deliberately overexposed to show some remaining KIT phosphorylation. Supplemental Fig. 5. Peptide pull down assays using KIT and control peptides. HMC-1 lysate was used for affinity pull-down assay with 2 nmol of either non phosphorylated peptide (Y568Y570), or mono-phosphorylated peptides (py568 and py570) or bi-phosphorylated peptide (py568py570). Non phosphorylated (YXXM) and phosphorylated (pyxxm) CD28 derived peptides were used to control the binding specificity. Bound and were revealed with specific antibodies. Lysate (SCL) was used as positive control. Anti-phosphotyrosine (4G10) was used to control the phosphorylation state of the peptides.
2 Supplemental Figure 1 SCF (min/h) WT BMMC h 24h BMMC 16M py701- py705- py694- pt202/y204-erk ps473-akt AKT
3 Supplemental Figure 2 P815 sirna C JAK3 JAK3 py701- py705- py694- ERK2
4 Supplemental Figure 3 A IP: pser727- IP: pser727- IP: pser726/731- H-89 (2 µm) : PKG Inhibitor (2 µm) : SB (2 µm) : P815
5 Supplemental Figure 3 B C pser727- pser727- pser726/731- IP: IP: IP: pser727- pser727- pser726/731- IP: IP: IP: SB (2 µm) : P815 HMC-1 KN-93 (2 µm) : P815 HMC-1
6 Supplemental Figure 3 D HMC-1 P815 SB (2 µm) : ps9-gsk3 GSK3 HMC-1 P815 SB (2 µm) : pt180/y182-p38 p38 HMC-1 P815 U0126 (2 µm) : pt202/y204-erk ERK2
7 Supplemental Figure 4 A IP B IP: KIT SCL KIT C KIT C SCL - + Dasatinib (1 µm) Dasatinib KIT KIT
8 4G10 pyxxm YXXM SCL py568py570 py568 py570 Y568Y570 Supplemental Figure 5
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Bays et al., http://www.jcb.org/cgi/content/full/jcb.201309092/dc1 Figure S1. Specificity of the phospho-y822 antibody. (A) Total cell
More informationSupplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated
Supplementary Figure Legends Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated with either vehicle (left; n=3) or CCl 4 (right; n=3) were co-immunostained for NRP-1 (green)
More informationPost-translational modification
Protein expression Western blotting, is a widely used and accepted technique to detect levels of protein expression in a cell or tissue extract. This technique measures protein levels in a biological sample
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Nakajima and Tanoue, http://www.jcb.org/cgi/content/full/jcb.201104118/dc1 Figure S1. DLD-1 cells exhibit the characteristic morphology
More informationLi et al., Supplemental Figures
Li et al., Supplemental Figures Fig. S1. Suppressing TGM2 expression with TGM2 sirnas inhibits migration and invasion in A549-TR cells. A, A549-TR cells transfected with negative control sirna (NC sirna)
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature09732 Supplementary Figure 1: Depletion of Fbw7 results in elevated Mcl-1 abundance. a, Total thymocytes from 8-wk-old Lck-Cre/Fbw7 +/fl (Control) or Lck-Cre/Fbw7 fl/fl (Fbw7 KO) mice
More informationSupplementary Figure 1.
Supplementary Figure 1. Quantification of western blot analysis of fibroblasts (related to Figure 1) (A-F) Quantification of western blot analysis for control and IR-Mut fibroblasts. Data are expressed
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Han et al., http://www.jcb.org/cgi/content/full/jcb.201311007/dc1 Figure S1. SIVA1 interacts with PCNA. (A) HEK293T cells were transiently
More informationSupplementary methods Shoc2 In Vitro Ubiquitination Assay
Supplementary methods Shoc2 In Vitro Ubiquitination Assay 35 S-labelled Shoc2 was prepared using a TNT quick Coupled transcription/ translation System (Promega) as recommended by manufacturer. For the
More informationSupplementary Fig. 1 Identification of Nedd4 as an IRS-2-associated protein in camp-treated FRTL-5 cells.
Supplementary Fig. 1 Supplementary Fig. 1 Identification of Nedd4 as an IRS-2-associated protein in camp-treated FRTL-5 cells. (a) FRTL-5 cells were treated with 1 mm dibutyryl camp for 24 h, and the lysates
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/304/ra104/dc1 Supplementary Materials for Lysine Methylation Promotes VEGFR-2 Activation and Angiogenesis Edward J. Hartsough, Rosana D. Meyer, Vipul Chitalia,
More informationThis is the author's accepted version of the manuscript.
This is the author's accepted version of the manuscript. The definitive version is published in Nature Communications Online Edition: 2015/4/16 (Japan time), doi:10.1038/ncomms7780. The final version published
More informationRecruitment of Grb2 to surface IgG and IgE provides antigen receptor-intrinsic costimulation to class-switched B cells
SUPPLEMENTARY FIGURES Recruitment of Grb2 to surface IgG and IgE provides antigen receptor-intrinsic costimulation to class-switched B cells Niklas Engels, Lars Morten König, Christina Heemann, Johannes
More informationNature Structural & Molecular Biology: doi: /nsmb.1583
Acetylation by GCN5 regulates CDC6 phosphorylation in the S-phase of the cell cycle Roberta Paolinelli 1,2, Ramiro Mendoza-Maldonado 2, Anna Cereseto 1 and Mauro Giacca 2 1 Molecular Biology Laboratory,
More informationSupplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53
Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -
More informationSupplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr
Supplemental figure legends Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr A, LβT2 cells were transfected with either scrambled or PEA-15 sirna. Cells were then
More informationModule 2: Systems Engineering (M2D6)
Module 2: Systems Engineering (M2D6) Reminder of goals of Module 2 Scale it up! (For real this time!) Densitometry -- how to analyze your WB data. M2D7 -- to robot or not to robot... Module 2 overview:
More informationJournal of Cell Science Supplementary Material
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 SUPPLEMENTARY FIGURE LEGENDS Figure S1: Eps8 is localized at focal adhesions and binds directly to FAK (A) Focal
More informationSUPPLEMENTAL MATERIAL. Supplemental Methods:
SUPPLEMENTAL MATERIAL Supplemental Methods: Immunoprecipitation- As we described but with some modifications [22]. As part of another ongoing project, lysate from human umbilical vein endothelial cells
More informationMutagenesis and generation of expression vectors Gene expression profiling Lentiviral production and infection of TF1 cells
Mutagenesis and generation of expression vectors Human c-kit wild-type cdna encoding the short c-kit isoform was excised from vector pbshkitwt (kind gift from Dr. L Gros, France) by Sal I-Acc65 I digestion.
More informationRabbit (polyclonal) Anti-IRS-1 [ps 616 ] Phosphospecific Antibody, Unconjugated
Rabbit (polyclonal) Anti-IRS-1 [ps 616 ] Phosphospecific Antibody, Unconjugated PRODUCT ANALYSIS SHEET Catalog Number: Lot Number: Volume: 44-550G (10 mini-blot size) See product label 100 μl Form of Antibody:
More informationAttenuation of synaptic toxicity and MARK4/PAR1-mediated Tau phosphorylation by
Supplementary Methods and Figures Attenuation of synaptic toxicity and MARK4/PAR1-mediated Tau phosphorylation by methylene blue for Alzheimer s disease treatment Wenchao Sun 1, Seongsoo Lee 1,2, Xiaoran
More informationMSD Immuno-Dot-Blot Assays. A division of Meso Scale Diagnostics, LLC.
MSD Immuno-Dot-Blot Assays Example: High Throughput Western Blots Replacements Traditional Western Blots High content Molecular weight and immunoreactivity Labor and protein intensive Inherently low throughput
More informationSupplementary material for: Materials and Methods:
Supplementary material for: Iron-responsive degradation of iron regulatory protein 1 does not require the Fe-S cluster: S.L. Clarke, et al. Materials and Methods: Fe-S Cluster Reconstitution: Cells treated
More informationRab5 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Rab5 Activation Assay Kit Catalog Number: 83701 20 assays 24 Whitewoods Lane 1 Table of Content Product
More informationSupplemental Figure 1
Supplemental Figure 1 A C19 B Mα p27 TL p27-/- p27-/- Supplemental Figure 1: Altered expression of p27 and p27 in the brain. Immunostaining for p27 was performed on brain frozen sections. Brain sections
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using
More information2D Gel PhosphoTyrosine Western blotting. Nancy Kendrick, Jon Johansen & Matt Hoelter, Kendrick Labs Inc
2D Gel PhosphoTyrosine Western blotting Nancy Kendrick, Jon Johansen & Matt Hoelter, Kendrick Labs Inc www.kendricklabs.com Talk Outline Kendrick Labs, 2DE Importance of focusing on protein subsets P-Tyrosine
More informationTechnical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD
Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Developed for: Aerius, Odyssey Classic, Odyssey CLx and Odyssey Sa Imaging Systems
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2271 Supplementary Figure a! WM266.4 mock WM266.4 #7 sirna WM266.4 #10 sirna SKMEL28 mock SKMEL28 #7 sirna SKMEL28 #10 sirna WM1361 mock WM1361 #7 sirna WM1361 #10 sirna 9 WM266. WM136
More informationIMMUNOPRECIPITATION TROUBLESHOOTING TIPS
IMMUNOPRECIPITATION TROUBLESHOOTING TIPS Creative Diagnostics Abstract Immunoprecipitation (IP) is the technique of precipitating a protein antigen out of solution using an antibody that specifically binds
More informationCdc42 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Cdc42 Activation Assay Kit Catalog Number: 80701 20 assays 1 Table of Content Product Description 3 Assay
More informationhours after food deprivation hours after food deprivation
Figure S.6 protein (fasted / control).2.8.4 p47 p97 Rpt Ufd 3 24 48 hours after food deprivation mrn (fasted / control) C mrn (denervated / control) 2.5 2.5.5 3.5 3 2.5 2.5.5 p97 ** Npl4 Ufd p47 2 3 4
More information7.06 Problem Set #3, 2006
7.06 Problem Set #3, 2006 1. You are studying the EGF/Ras/MAPK pathway in cultured cells. When the pathway is activated, cells are signaled to proliferate. You generate various mutants described below.
More informationNature Medicine doi: /nm.3554
SUPPLEMENTARY FIGURES LEGENDS Supplementary Figure 1: Generation, purification and characterization of recombinant mouse IL-35 (ril-35). High-Five insect cells expressing high levels of the bicistronic
More informationHossain_Supplemental Figure 1
Hossain_Supplemental Figure 1 GFP-PACT GFP-PACT Motif I GFP-PACT Motif II A. MG132 (1µM) GFP Tubulin GFP-PACT Pericentrin GFP-PACT GFP-PACT Pericentrin Fig. S1. Expression and localization of Orc1 PACT
More informationFigure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43
More informationNongenetic Reprogramming of the Ligand Specificity. of Growth Factor Receptors by Bispecific DNA Aptamers
Supporting Information For Nongenetic Reprogramming of the Ligand Specificity of Growth Factor Receptors by Bispecific DNA Aptamers Ryosuke Ueki,* Saki Atsuta, Ayaka Ueki and Shinsuke Sando* Department
More informationSingle cell imaging of Bruton's Tyrosine Kinase using an irreversible inhibitor
SUPPLEMENTARY INFORMATION Single cell imaging of Bruton's Tyrosine Kinase using an irreversible inhibitor Anna Turetsky 1,a, Eunha Kim 1,a, Rainer H. Kohler 1, Miles A. Miller 1, Ralph Weissleder 1,2,
More informationSupplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb.
Supplementary Figure 1 α-synuclein is truncated in PD and LBD brains. (a) Specificity of anti-n103 antibody. Anti-N103 antibody was coated on an ELISA plate and different concentrations of full-length
More informationSUPPLEMENTARY INFORMATION
The Supplementary Information (SI) Methods Cell culture and transfections H1299, U2OS, 293, HeLa cells were maintained in DMEM medium supplemented with 10% fetal bovine serum. H1299 and 293 cells were
More informationJCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Hong et al.,
Supplemental material JCB Hong et al., http://www.jcb.org/cgi/content/full/jcb.201412127/dc1 THE JOURNAL OF CELL BIOLOGY Figure S1. Analysis of purified proteins by SDS-PAGE and pull-down assays. (A) Coomassie-stained
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationArf6 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Arf6 Activation Assay Kit Catalog Number: 82401 20 assays NewEast Biosciences 1 Table of Content Product
More informationMeso Scale Discovery Applications
A Suite of Assays to Detect hosphorylated Receptor Tyrosine Kinases Associated with Neoplasia Timothy S. Schaefer, Jane Zhang, Sean Higgins, Laura K. Schaefer, Robert M. Umek and Jacob N. Wohlstadter Reversible
More informationFlag-Rac Vector V12 V12 N17 C40. Vector C40 pakt (T308) Akt1. Myc-DN-PAK1 (N-SP)
a b FlagRac FlagRac V2 V2 N7 C4 V2 V2 N7 C4 p (T38) p (S99, S24) p Flag (Rac) NIH 3T3 COS c +Serum p (T38) MycDN (NSP) Mycp27 3 6 2 3 6 2 3 6 2 min p Myc ( or p27) Figure S (a) Effects of Rac mutants on
More informationSite-Directed Mutagenesis. Mutations in four Smad4 sites of mouse Gat1 promoter
Supplement Supporting Materials and Methods Site-Directed Mutagenesis. Mutations in four Smad4 sites of mouse Gat1 promoter were independently generated using a two-step PCR method. The Smad4 binding site
More informationSupplementary Materials
Supplementary Materials Supplementary Figure 1. PKM2 interacts with MLC2 in cytokinesis. a, U87, U87/EGFRvIII, and HeLa cells in cytokinesis were immunostained with DAPI and an anti-pkm2 antibody. Thirty
More informationRheB Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based RheB Activation Assay Kit Catalog Number: 81201 20 assays NewEast Biosciences 1 FAX: 610-945-2008 Table
More informationRegulation of autophagic activity by ζ proteins associated with class III. phosphatidylinositol-3 kinase. Mercedes Pozuelo Rubio
ONLINE SUPPORTING INFORMATION Regulation of autophagic activity by 14-3-3ζ proteins associated with class III phosphatidylinositol-3 kinase Mercedes Pozuelo Rubio entro Andaluz de Biología Molecular y
More informationSUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL Materials and Methods Circular dichroism (CD) spectroscopy. Far ultraviolet (UV) CD spectra of apo- and holo- CaM and the CaM mutants were recorded on a Jasco J-715 spectropolarimeter
More informationSupplementary Figure 1. Confirmation of sirna in PC3 and H1299 cells PC3 (a) and H1299 (b) cells were transfected with sirna oligonucleotides
Supplementary Figure 1. Confirmation of sirna in PC3 and H1299 cells PC3 (a) and H1299 (b) cells were transfected with sirna oligonucleotides targeting RCP (SMARTPool (RCP) or two individual oligos (RCP#1
More informationPlease read manual carefully before starting experiment
RayBio Cell-Based Phosphorylation ELISA Kit - Preliminary For the semi-quantitative detection of both phosphorylated and pan human, mouse or rat proteins in adherent whole cell lines. User Manual (Revised
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Thompson et al., http://www.jcb.org/cgi/content/full/jcb.200909067/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Modification-specific antibodies do not detect unmodified
More informationSupplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1.
Supplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1. Percent of original fluorescence was plotted as a function of time following photobleaching
More informationPlease read manual carefully before starting experiment
RayBio Cell Based Human STAT5 (Tyr694) Phosphorylation ELISA Kit For the semi quantitative detection of phosphorylated human STAT5 (Tyr694) and total STAT5 in adherent whole cell lines. User Manual (Revised
More informationPKA α/β CAT (Phospho-Thr197)
Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 PKA α/β CAT (Phospho-Thr197) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG01634 Please read the provided manual
More informationSupplemental Information: Phosphorylation of CLIP-170 by Both Plk1 and CK2 Is Involved in the Timely Formation of Kinetochore-microtubule Attachments
Supplemental Information: Phosphorylation of CLIP-170 by Both Plk1 and CK2 Is Involved in the Timely Formation of Kinetochore-microtubule Attachments Hongchang Li, X. Shawn Liu, Xiaoming Yang, Yingmin
More informationSupplementary Information
Supplementary Information Supplementary Figures Supplementary Figure 1. MLK1-4 phosphorylate MEK in the presence of RAF inhibitors. (a) H157 cells were transiently transfected with Flag- or HA-tagged MLK1-4
More informationFor the quantitative measurement of human, mouse and rat phosphorylated STAT3 (Tyr705) concentrations in cell lysates.
ab126458 - STAT3 (py705) ELISA Kit Instructions for Use For the quantitative measurement of human, mouse and rat phosphorylated STAT3 (Tyr705) concentrations in cell lysates. This product is for research
More informationRabbit (polyclonal) Anti-Rac1/cdc42 [ps 71 ] Phosphospecific Antibody, Unconjugated
Rabbit (polyclonal) Anti-Rac1/cdc42 [ps 71 ] Phosphospecific Antibody, Unconjugated PRODUCT ANALYSIS SHEET Catalog Number: Lot Number: 0101 Volume: 100 µl (10 mini-blot size) Form of Antibody: Rabbit polyclonal
More informationAndrogen Receptor (Phospho-Tyr363) Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG02138
Androgen Receptor (Phospho-Tyr363) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02138 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research
More informationSupplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various
Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various GST-tagged N-terminal truncated APP fragments including GST-APP full-length (FL), APP (123-695), APP (189-695), or
More informationSupplemental Data. Sethi et al. (2014). Plant Cell /tpc
Supplemental Data Supplemental Figure 1. MYC2 Binds to the E-box but not the E1-box of the MPK6 Promoter. (A) E1-box and E-box (wild type) containing MPK6 promoter fragment. The region shown in red denotes
More informationRayBio Phospho- Akt (Ser473) ELISA Kit
RayBio Phospho- Akt (Ser473) ELISA Kit For Measuring Phosphorylated Akt (Ser473) in Human, Mouse and Rat Cell Lysates User Manual (Revised Mar 1, 2012) RayBio Akt (Ser473) ELISA Kit Protocol (Cat#: PEL-Akt-S473-001)
More informationSupplementary Materials and Methods
Supplementary Materials and Methods sirna sequences used in this study The sequences of Stealth Select RNAi for ALK and FLOT-1 were as follows: ALK sense no.1 (ALK): 5 -AAUACUGACAGCCACAGGCAAUGUC-3 ; ALK
More informationpt7ht vector and over-expressed in E. coli as inclusion bodies. Cells were lysed in 6 M
Supplementary Methods MIG6 production, purification, inhibition, and kinase assays MIG6 segment 1 (30mer, residues 334 364) peptide was synthesized using standard solid-phase peptide synthesis as described
More informationGα i Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Gα i Activation Assay Kit Catalog Number 80301 20 assays NewEast Biosciences, Inc 1 Table of Content Product
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/5/233/ra50/dc1 Supplementary Materials for Epidermal Growth Factor Receptor Is Essential for Toll-Like Receptor 3 Signaling Michifumi Yamashita, Saurabh Chattopadhyay,
More informationData Supplement Plasmin Triggers Cytokine Induction in Human Monocyte-Derived Macrophages
Data Supplement Plasmin Triggers Cytokine Induction in Human Monocyte-Derived Macrophages Qun Li, Yves Laumonnier, Tatiana Syrovets, and Thomas Simmet Methods Antibodies and Reagents Antibodies for immunoblotting:
More informationSupplementary Information
Supplementary Information Supplementary Figure 1: Over-expression of CD300f in NIH3T3 cells enhances their capacity to phagocytize AC. (a) NIH3T3 cells were stably transduced by EV, CD300f WT or CD300f
More informationImmunoprecipitation Protocol
Immunoprecipitation Protocol Immunoprecipitation is a general method to obtain the enrichment of a specific protein from tissue lysate and cell lysate. It can be used to purify a specific protein, to identify
More informationab Ran Activation Assay Kit
ab173247 Ran Activation Assay Kit Instructions for Use For the simple and fast measurement of Ran activation. This product is for research use only and is not intended for diagnostic use. Version 1 Last
More informationEasy-WESTERN-II Super
Easy-WESTERN-II Super Primary Antibody Detection Reagent for Western Blots User Manual for High Sensitivity and Strong Signal Detection Immediately after receiving the kit, read the section titled COMPONENTS
More informationGα 13 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Gα 13 Activation Assay Kit Catalog Number: 80401 20 assays NewEast Biosciences 1 Table of Content Product
More informationFig. S1. CrgA intracellular levels in M. tuberculosis. Ten and twenty micrograms of
Supplementary data Fig. S1. CrgA intracellular levels in M. tuberculosis. Ten and twenty micrograms of cell free protein lysates from WT M. tuberculosis (Rv) together with various known concentrations
More informationEasy-WESTERN-II Super
Easy-WESTERN-II Super Primary Antibody Detection Reagent for Western Blots User Manual for High Sensitivity and Strong Signal Detection Immediately after receiving the kit, read the section titled COMPONENTS
More informationRayBio Phospho- Stat 3 (Tyr705) ELISA Kit
RayBio Phospho- Stat 3 (Tyr705) ELISA Kit For Measuring Phosphorylated Stat3 (Tyr705) in Human, Mouse and Rat Cell Lysates User Manual (Revised Mar 1, 2012) RayBio Stat3 (Tyr705) ELISA Kit Protocol (Cat#:
More informationSupplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered
Supplementary Information: Materials and Methods Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered saline (PBS) and lysed in TNN lysis buffer (50mM Tris at ph 8.0, 120mM NaCl
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2386 Figure 1 Src-containing puncta are not focal adhesions, podosomes or endosomes. (a) FAK-/- were stained with anti-py416 Src (green) and either (in red) the focal adhesion protein paxillin,
More information1. Primers for PCR to amplify hairpin stem-loop precursor mir-145 plus different flanking sequence from human genomic DNA.
Supplemental data: 1. Primers for PCR to amplify hairpin stem-loop precursor mir-145 plus different flanking sequence from human genomic DNA. Strategy#1: 20nt at both sides: #1_BglII-Fd primer : 5 -gga
More informationab G alpha i Activation Assay Kit
ab173234 G alpha i Activation Assay Kit Instructions for Use For the simple and fast measurement of G alpha i activation. This product is for research use only and is not intended for diagnostic use. Version
More information3 P p25. p43 p41 28 FADD. cflips. PE-Cy5 [Fluorescence intensity]
L S p4 3 D3 76 N S L Ve ct or p4 3 D3 76 N S L Ve ct or A aspase 8 FADD TRAF2 D95-R - + Vector D95L TL I S L D376N T RAIL-R1 T RAIL-R2 D95-R E-y5 [Fluorescence intensity] Supplemental Fig. 1 Different
More informationONE-HOUR Complete IP-Western Kit
ONE-HOUR Complete IP-Western Kit Technical Manual No. 0218 Version 06192009 I Description.. 1 II Kit Contents.. 2 III Related Products 2 IV Key Features.. 2 V Storage.. 2 VI ONE-HOUR Western Protocol 3
More informationRecombinant adenoviruses. A TRB3-expressing adenovirus was generated through
Materials and Methods Recombinant adenoviruses. A -expressing adenovirus was generated through homologous recombination between a linearized transfer vector pad-track and the adenoviral backbone vector
More informationPhos-tag beads as an immunoblotting enhancer for selective detection of phosphoproteins in cell lysates
Notes & Tips Phos-tag beads as an immunoblotting enhancer for selective detection of phosphoproteins in cell lysates Emiko Kinoshita-Kikuta, Eiji Kinoshita *, and Tohru Koike Department of Functional Molecular
More informationSupplemental Materials and Methods
Supplemental Materials and Methods Co-immunoprecipitation (Co-IP) assay Cells were lysed with NETN buffer (20 mm Tris-HCl, ph 8.0, 0 mm NaCl, 1 mm EDT, 0.5% Nonidet P-40) containing 50 mm β-glycerophosphate,
More informationVEGFR2 (Phospho-Tyr1175)
Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 VEGFR2 (Phospho-Tyr1175) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02081 Please read the provided manual
More informationAIP1 functions as an endogenous inhibitor of VEGFR2-mediated signaling and inflammatory angiogenesis
SUPPLEMENTAL MATERIALS functions as an endogenous inhibitor of VEGFR2-mediated signaling and inflammatory angiogenesis Haifeng Zhang 1*, Yun He 1*, Shengchuan Dai 1*, Zhe Xu 2*, Yan Luo 2, Ting Wan 2,
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2743 Figure S1 stabilizes cellular protein level, post-transcriptionally. (a, b) and DDR1 were RNAi-depleted from HEK.293.-CBG cells. Western blots with indicated antibodies (a). RT-PCRs
More informationTECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure
Cell-Based ELISA Sampler Kit for detecting phospho-erk1/2 (pthr 202 /ptyr 204 ), phospho-jnk (pthr 183 /ptyr 185 ), and phospho-p38 MAPK (pthr 180 /ptyr 182 ) in cultured cell lines adequate for 192 assays
More informationMCF10A cells were trypsinized and attached onto fibronectin-coated petri dishes
Supplemental Information Supplemental figure legends Figure S. Supplemental figure for Fig... Different methods of cell detachment similarly induce YP phosphorylation. MCF0 cells were trypsinized and attached
More informationTECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure
Cell-Based ELISA Kit for detecting phospho-stat3 (ptyr 705 ) in cultured cell lines adequate for 96 assays (1 96 well plate) Catalog Number RAB0444 Storage Temperature 20 C TECHNICAL BULLETIN Product Description
More informationTECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure
Cell-Based ELISA Kit for detecting phospho-stat4 (ptyr 693 ) in cultured cell lines adequate for 192 assays (2 96 well plate) Catalog Number RAB0449 Storage Temperature 20 C TECHNICAL BULLETIN Product
More informationSupplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and
Supplementary Figure Legend: Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and ATRIP protein peptides identified from our mass spectrum analysis were shown. Supplementary
More information