Supplemental Figure 1
|
|
- Elmer Smith
- 5 years ago
- Views:
Transcription
1 Supplemental Figure 1 A C19 B Mα p27 TL p27-/- p27-/- Supplemental Figure 1: Altered expression of p27 and p27 in the brain. Immunostaining for p27 was performed on brain frozen sections. Brain sections were stained with a polyclonal anti-p27 (C19) antibody (A) or with a monoclonal anti-p27 (clone 57, BD-Transduction Laboratories (TL)) antibody (B). Note that the latter antibody does not recognize p27.
2 Supplemental Figure 2 CHX + Olo + Rosco CHX + Olo + Rosco CHX + Olo + Rosco Supplemental Figure 3: CDK inhibition does not prevent p27 degradation in G0. Wild type or p27 were serum starved for 72 h, cells were treated with 25 µg/ml cycloheximide (CHX) and, where indicated, with 50 µm Olomoucine or Roscovitine. Lysates were collected in sample buffer at the indicated time. Samples were resolved on SDS-PAGE, transferred and membranes were probed with a polyclonal p27 antibody (C19), stripped and reprobed with a monoclonal Grb2 antibody to evaluate protein loading.
3 Supplemental Figure 3 Cyclin D1-/- Cyclin E1/E2-/- Cyclin D1/D2-/- CDK2-/- CDK4-/- Supplemental Figure 4: p27 half-life in G0 is not affected by the absence of specific cyclins or CDKs. Cyclin D1 -/-, cyclin D1/D2 -/-, cyclin E1/E2 -/-, CDK2 -/-, CDK4 -/- and their corresponding wild type MEFs were serum starved for 72 h, cells were treated with 25 µg/ml cycloheximide (CHX) and collected in sample buffer at the indicated time. Samples were resolved on SDS-PAGE, transferred and membranes were probed with a polyclonal p27 antibody (C19), stripped and reprobed with a monoclonal Grb2 antibody to evaluate protein loading. Cyclin D1 -/-, cyclin D1/D2 -/-, cyclin E1/E2 -/- MEFs were kindly provided by Piotr Sicinsky, Dana Farber Cancer Institute, Boston. CDK2 -/- MEFs were kindly provided by Philipp Kaldis, National Cancer Institute, Frederick. CDK4 -/- MEFs were a gift from Hiroaki Kiyokawa, University of Illinois College of Medicine, Chicago.
4 Supplemental Figure 4 Exponentially growing cells p27-/- pqh-p27 p27-/- pqh- p27-/- pqh-/ CHX in h Supplemental Figure 2: Stabilization of a p27 mutant that cannot bind cyclins and CDKs (p27 /) in exponentially growing cells. p27-null MEFs were retrovirally infected with either wild type p27 (p27-/-lnsx-p27), p27 (p27-/-pqh-), or p27 / (p27-/-lnsx-/). After selection of infected MEFs, cells were treated with 25 µg/ml cycloheximide (CHX) and collected in sample buffer at the indicated time. Samples were resolved on SDS-PAGE, transferred and membranes were probed with a polyclonal p27 antibody (C19), stripped and reprobed with a monoclonal Grb2 antibody to evaluate protein loading.
5 Supplemental Figure 5 A Serum starved IP Rα Cyclin A (H432) Exponentially growing Mα p27f8 B Serum starved IP Rα Cyclin E Exponentially growing Mα p27f8 Mα CDK2 Supplemental Figure 5: Increased association of p27 with cyclin-cdk complexes. IPs with a polyclonal cyclin A antibody (A) or with a polyclonal cyclin E antibody (B) in serum starved and exponentially growing primary MEFs. Membranes were probed with a monoclonal antibody to p27. In B, the membrane was reprobed with a monoclonal CDK2 anitbody.
6 Supplemental Figure 6 A Mα p27 Hoescht 0.1% FCS B 0.1% FCS 10% FCS 4 h 10% FCS 8 h +MG132 +MG132 Supplemental Figure 6: p27 is sequestered in the nucleus. In this experiment, wild type and p27 -/- cells were co-cultured, thus providing an internal control for non-specific staining by the p27 antibody. Exposure time was set so that the p27 -/- barely appear on the images, and the same setting was used to acquire all the images. A. monoclonal p27 antibody stain of wild type and p27 -/- MEFs (left) and Hoescht stain to visualize the nuclei of both cell types (right); wild type cells are indicated by arrowheads (right). B. Staining with the monoclonal p27 antibody as in (A) of wild type, p27 -/-, and p27 MEFs either serum starved for 48 h, or starved and stimulated with 10% FCS for 4 h or 8 h, in the presence or absence of the proteasome inhibitor MG132.
Supplementary methods Shoc2 In Vitro Ubiquitination Assay
Supplementary methods Shoc2 In Vitro Ubiquitination Assay 35 S-labelled Shoc2 was prepared using a TNT quick Coupled transcription/ translation System (Promega) as recommended by manufacturer. For the
More informationSupplemental Figure 1
Supplemental Fig. 1. Kinetics of,,, AKT and ERK activation in BMMCs following SCF stimulation. Starved BMMCs were stimulated with 250ng/mL of SCF for the indicated time. Soluble Cell Lysates (SCLs) were
More informationSupplemental Figure Legends:
Supplemental Figure Legends: Fig S1. GFP-ABRO1 localization. U2OS cells were infected with retrovirus expressing GFP- ABRO1. The cells were fixed with 3.6% formaldehyde and stained with antibodies against
More informationSupplementary Fig. 1 Kinetics of appearence of the faster migrating form of Bcl-10.
α-cd3 + α-cd28: Time (min): + + + + + + + + + 0 5 15 30 60 120 180 240 300 360 360 n.s. Supplementary Fig. 1 Kinetics of appearence of the faster migrating form of. Immunoblot of lysates from Jurkat cells
More informationPost-translational modification
Protein expression Western blotting, is a widely used and accepted technique to detect levels of protein expression in a cell or tissue extract. This technique measures protein levels in a biological sample
More informationSupplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified by primers used for mrna expression analysis. Gray
More informationSupplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53
Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -
More informationRecruitment of Grb2 to surface IgG and IgE provides antigen receptor-intrinsic costimulation to class-switched B cells
SUPPLEMENTARY FIGURES Recruitment of Grb2 to surface IgG and IgE provides antigen receptor-intrinsic costimulation to class-switched B cells Niklas Engels, Lars Morten König, Christina Heemann, Johannes
More informationSupplemental Data Supplementary Figure Legends and Scheme Figure S1.
Supplemental Data Supplementary Figure Legends and Scheme Figure S1. UTK1 inhibits the second EGF-induced wave of lamellipodia formation in TT cells. A and B, EGF-induced lamellipodia formation in TT cells,
More informationSupplementary Figure 1. GST pull-down analysis of the interaction of GST-cIAP1 (A, B), GSTcIAP1
Legends Supplementary Figure 1. GST pull-down analysis of the interaction of GST- (A, B), GST mutants (B) or GST- (C) with indicated proteins. A, B, Cell lysate from untransfected HeLa cells were loaded
More informationSupplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and
Supplementary Figure Legend: Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and ATRIP protein peptides identified from our mass spectrum analysis were shown. Supplementary
More informationDescription of supplementary material file
Description of supplementary material file In the supplementary results we show that the VHL-fibronectin interaction is indirect, mediated by fibronectin binding to COL4A2. This provides additional information
More informationXu et al., Supplementary Figures 1-7
Xu et al., Supplementary Figures 1-7 Supplementary Figure 1. PIPKI is required for ciliogenesis. (a) PIPKI localizes at the basal body of primary cilium. RPE-1 cells treated with two sirnas targeting to
More informationArtificial targeting of misfolded cytosolic proteins to endoplasmic reticulum as a mechanism for clearance
Supplementary Information Artificial targeting of misfolded cytosolic proteins to endoplasmic reticulum as a mechanism for clearance Fen Liu 1, Deanna M. Koepp 2, and Kylie J. Walters 1* 1 Protein Processing
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature09732 Supplementary Figure 1: Depletion of Fbw7 results in elevated Mcl-1 abundance. a, Total thymocytes from 8-wk-old Lck-Cre/Fbw7 +/fl (Control) or Lck-Cre/Fbw7 fl/fl (Fbw7 KO) mice
More informationHossain_Supplemental Figure 1
Hossain_Supplemental Figure 1 GFP-PACT GFP-PACT Motif I GFP-PACT Motif II A. MG132 (1µM) GFP Tubulin GFP-PACT Pericentrin GFP-PACT GFP-PACT Pericentrin Fig. S1. Expression and localization of Orc1 PACT
More informationSupplementary Information
Supplementary Information Figure S1. Transiently overexpressed ECFP-TIAF1/EYFP-TIAF1 causes apoptosis of Mv1Lu cells. Mv1Lu cells were transfected by electroporation with ECFP, EYFP, ECFP-TIAF1, EYFP-
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2271 Supplementary Figure a! WM266.4 mock WM266.4 #7 sirna WM266.4 #10 sirna SKMEL28 mock SKMEL28 #7 sirna SKMEL28 #10 sirna WM1361 mock WM1361 #7 sirna WM1361 #10 sirna 9 WM266. WM136
More informationJCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Kimura et al.,
Supplemental material JCB Kimura et al., http://www.jcb.org/cgi/content/full/jcb.201503023/dc1 THE JOURNAL OF CELL BIOLOGY Figure S1. TRIMs regulate IFN-γ induced autophagy. (A and B) HC image analysis
More informationSupplementary information
Supplementary information The E3 ligase RNF8 regulates KU80 removal and NHEJ repair Lin Feng 1, Junjie Chen 1 1 Department of Experimental Radiation Oncology, The University of Texas M. D. Anderson Cancer
More informationMutagenesis and generation of expression vectors Gene expression profiling Lentiviral production and infection of TF1 cells
Mutagenesis and generation of expression vectors Human c-kit wild-type cdna encoding the short c-kit isoform was excised from vector pbshkitwt (kind gift from Dr. L Gros, France) by Sal I-Acc65 I digestion.
More informationSupporting Information
Supporting Information Su et al. 10.1073/pnas.1211604110 SI Materials and Methods Cell Culture and Plasmids. Tera-1 and Tera-2 cells (ATCC: HTB- 105/106) were maintained in McCoy s 5A medium with 15% FBS
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Kunduri et al., http://www.jcb.org/cgi/content/full/jcb.201405020/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Subcellular localization and interactions of PAPLA1.
More informationSupplementary Figures 1-12
Supplementary Figures 1-12 Supplementary Figure 1. The specificity of anti-abi1 antibody. Total Proteins extracted from the wild type seedlings or abi1-3 null mutant seedlings were used for immunoblotting
More informationSupporting Information
Supporting Information Stavru et al. 0.073/pnas.357840 SI Materials and Methods Immunofluorescence. For immunofluorescence, cells were fixed for 0 min in 4% (wt/vol) paraformaldehyde (Electron Microscopy
More informationSupplementary Fig.1 Luton
Supplementary Fig.1 Luton a 175 Brain Thymus Spleen Small Intestine Kidney Testis HeLa b 250 Lung Kidney MDCK c EFA6B si Control si Mismatch #637 #1564 #1770 83 62 47.5 175 IB: anti-efa6b #B1 130 66 Lysates
More informationHyper sensitive protein detection by Tandem-HTRF reveals Cyclin D1
Hyper sensitive protein detection by Tandem-HTRF reveals Cyclin D1 dynamics in adult mouse Alexandre Zampieri, Julien Champagne, Baptiste Auzemery, Ivanna Fuentes, Benjamin Maurel and Frédéric Bienvenu
More informationInput. Pulldown GST. GST-Ahi1
A kd 250 150 100 75 50 37 25 -GST-Ahi1 +GST-Ahi1 kd 148 98 64 50 37 22 GST GST-Ahi1 C kd 250 148 98 64 50 Control Input Hap1A Hap1 Pulldown GST GST-Ahi1 Hap1A Hap1 Hap1A Hap1 Figure S1. (A) Ahi1 western
More informationFigure S1 Proteasome inhibition leads to formation of aggregates in human cells and tissues. (a)
SUPPLEMENTARY MATERIAL Figure S1 Proteasome inhibition leads to formation of aggregates in human cells and tissues. (a) Flow cytometry. Cells were treated with MG132 for the indicated times. Cells were
More informationSupplementary Figure 1. RAD51 and RAD51 paralogs are enriched spontaneously onto
Supplementary Figure legends Supplementary Figure 1. and paralogs are enriched spontaneously onto the S-phase chromatin during DN replication. () Chromatin fractionation was carried out as described in
More informationSupplemental Figure 1: GB-induced cell death is ROS-dependent. (a-b) K562 cells pre-incubated or not with NAC for 1h were treated with a sublytic
Supplemental Figure 1: GB-induced cell death is ROS-dependent. (a-b) K562 cells pre-incubated or not with NAC for 1h were treated with a sublytic dose of P +/- GB. ROS production (a) and cell death (b)
More informationSupplementary Figure S1. N-terminal fragments of LRRK1 bind to Grb2.
Myc- HA-Grb2 Mr(K) 105 IP HA 75 25 105 1-1163 1-595 - + - + - + 1164-1989 Blot Myc HA total lysate 75 25 Myc HA Supplementary Figure S1. N-terminal fragments of bind to Grb2. COS7 cells were cotransfected
More informationsupplementary information
DOI: 10.1038/ncb2116 Figure S1 CDK phosphorylation of EZH2 in cells. (a) Comparison of candidate CDK phosphorylation sites on EZH2 with known CDK substrates by multiple sequence alignments. (b) CDK1 and
More informationab Ubiquitylation Assay Kit
ab139467 Ubiquitylation Assay Kit Instructions for Use For the activation of ubiquitin for use in ubiquitylation experiments This product is for research use only and is not intended for diagnostic use.
More informationPei et al. Supplementary Figure S1
Pei et al. Supplementary Figure S1 C H-CUL9: + + + + + Myc-ROC1: - - + + + U2OS/pcDN3 U2OS/H-CUL9 U2OS/ + H-CUL9 IP: -H -myc input -H -myc 1 2 3 4 5 H-CUL9 Myc-ROC1 -H -H -H -H H-CUL9: wt RR myc-roc1:
More informationSupplementary methods
Supplementary methods Cell culture and transfection and infection WT, VDAC isoforms specific knockouts, bax/bak -/- (kindly provided by late Dr. Stanley J Korsmeyer, Dana Farber Cancer Institute), bak
More informationSupplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr
Supplemental figure legends Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr A, LβT2 cells were transfected with either scrambled or PEA-15 sirna. Cells were then
More informationFigure S1. USP-46 is expressed in several tissues including the nervous system
Supplemental Figure legends Figure S1. USP-46 is expressed in several tissues including the nervous system Transgenic animals expressing a transcriptional reporter (P::GFP) were imaged using epifluorescence
More informationCdc42 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Cdc42 Activation Assay Kit Catalog Number: 80701 20 assays 1 Table of Content Product Description 3 Assay
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Ono et al., http://www.jcb.org/cgi/content/full/jcb.201208008/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Chromatin-binding properties of MCM2 and condensin II during
More informationPHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF
YFP-PHF1 CFP-PHT1;2 PHT1;2-CFP YFP-PHF + PHT1;2-CFP YFP-PHF + CFP-PHT1;2 Negative control!-gfp Supplemental Figure 1: PHT1;2 accumulation is PHF1 dependent. Immunoblot analysis on total protein extract
More informationSupplementary Fig. 1 Identification of Nedd4 as an IRS-2-associated protein in camp-treated FRTL-5 cells.
Supplementary Fig. 1 Supplementary Fig. 1 Identification of Nedd4 as an IRS-2-associated protein in camp-treated FRTL-5 cells. (a) FRTL-5 cells were treated with 1 mm dibutyryl camp for 24 h, and the lysates
More informationAntibodies used in this study Figure S1. Akt expression in neutrophils from WT and individual Akt isoform knockout mice
ntibodies used in this study The anti β-actin monoclonal antibody (Sigma-ldrich, St. Louis, MO) was generated against a slightly modified human β-actin N-terminal peptide, c-sp-sp-sp-ile-la-la-leu-val-ile-
More informationsupplementary information
DOI: 10.1038/ncb2172 Figure S1 p53 regulates cellular NADPH and lipid levels via inhibition of G6PD. (a) U2OS cells stably expressing p53 shrna or a control shrna were transfected with control sirna or
More informationReally high sensitivity mass spectrometry and Discovery and analysis of protein complexes
Really high sensitivity mass spectrometry and Discovery and analysis of protein complexes The PRIME lab and AMS Importance of protein complexes in biology Methods for isolation of protein complexes In
More informationMEFs were treated with the indicated concentrations of LLOMe for three hours, washed
Supplementary Materials and Methods Cell Fractionation MEFs were treated with the indicated concentrations of LLOMe for three hours, washed with ice-cold PBS, collected by centrifugation, and then homogenized
More informationSupplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators.
Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators. (a) A graphic depiction of the approach to determining the stability of
More informationCell death analysis using the high content bioimager BD PathwayTM 855 instrument (BD
Supplemental information Materials and Methods: Cell lines, reagents and antibodies: Wild type (A3) and caspase-8 -/- (I9.2) Jurkat cells were cultured in RPMI 164 medium (Life Technologies) supplemented
More informationSupplemental Information
Supplemental Information Intrinsic protein-protein interaction mediated and chaperonin assisted sequential assembly of a stable Bardet Biedl syndome protein complex, the BBSome * Qihong Zhang 1#, Dahai
More informationDOI: 10.1038/ncb3259 A Ismail et al. Supplementary Figure 1 B 60000 45000 SSC 30000 15000 Live cells 0 0 15000 30000 45000 60000 FSC- PARR 60000 45000 PARR Width 30000 FSC- 15000 Single cells 0 0 15000
More informationSUPPLEMENTARY MATERIALS AND METHODS
SUPPLEMENTARY MATERIALS AND METHODS Chemicals. All chemicals used in supplementary experiments were the same as in the manuscript except the following. Methyl-methanesulfonate (MMS) was from Fluka. NU1025
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/4/167/ra20/dc1 Supplementary Materials for Poly(ADP-Ribose) (PAR) Binding to Apoptosis-Inducing Factor Is Critical for PAR Polymerase-1 Dependent Cell Death (Parthanatos)
More informationEndogenous MYC was detected by Western blotting using the N-262 polyclonal antibody (Santa
SUPPLEMENTARY METHODS Antibodies Endogenous MYC was detected by Western blotting using the N-262 polyclonal antibody (Santa Cruz) or the 9E10 monoclonal antibody (Vanderbilt Antibody and Protein Resource).
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Han et al., http://www.jcb.org/cgi/content/full/jcb.201311007/dc1 Figure S1. SIVA1 interacts with PCNA. (A) HEK293T cells were transiently
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Thompson et al., http://www.jcb.org/cgi/content/full/jcb.200909067/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Modification-specific antibodies do not detect unmodified
More informationPromotion of HDF Cell Attachment and Proliferation
Promotion of HDF Cell Attachment and Proliferation Objectives To qualitatively assess the effect of fibronectin (Fn) on HDF cell attachment Fn Attachment Assay To observe HDF cell proliferation and position
More informationMCF10A cells were trypsinized and attached onto fibronectin-coated petri dishes
Supplemental Information Supplemental figure legends Figure S. Supplemental figure for Fig... Different methods of cell detachment similarly induce YP phosphorylation. MCF0 cells were trypsinized and attached
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2386 Figure 1 Src-containing puncta are not focal adhesions, podosomes or endosomes. (a) FAK-/- were stained with anti-py416 Src (green) and either (in red) the focal adhesion protein paxillin,
More informationSupplemental Data. Sun et al. Plant Cell. (2012) /tpc FLS2 -cmyc -GFP FLS2 -HA. FLS2-FLAG FLS2 -HA BAK1-HA flg22 (10mM)
Supplemental Data. Sun et al. Plant ell. ()..5/tpc..9599 A FLS-FLA FLS -HA BAK-HA flg (mm) - B FLS -cmyc -FP FLS -HA IP antibody cmyc FLA FP cmyc IP ; WB: α-ha IP; WB: α-ha IP: α-fla; WB: α-ha IP ; WB:
More informationSUPPLEMENTAL MATERIALS
SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURES Supplemental Figure S1. Analyses of the CRY1-SPA1 interaction (A) An auxotrophy growth assay (left) and a filter-based -galactosidase colorimetric assay (right)
More informationImmunohistochemistry guide
Immunohistochemistry guide overview immunohistochemistry Overview Immunohistochemistry is a laboratory technique utilized for the visual detection of antigens in tissue. When working with cells this technique
More informationPKA α/β CAT (Phospho-Thr197)
Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 PKA α/β CAT (Phospho-Thr197) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG01634 Please read the provided manual
More informationMarilyn G. Rimando, Hao-Hsiang Wu, Yu-An Liu, Chien-Wei Lee, Shu-Wen Kuo, Yin-
Supplementary Information Glucocorticoid receptor and Histone Deacetylase 6 mediate the differential effect of dexamethasone during osteogenesis of Mesenchymal stromal cells (MSCs) Marilyn G. Rimando,
More informationFIGURE S1. Representative images to illustrate RAD51 foci induction in FANCD2 wild-type (wt) and
Supplementary Figures FIGURE S1. Representative images to illustrate RAD51 foci induction in FANCD2 wild-type (wt) and mutant (mut) cells. Higher magnification is shown in Figure 1A. Arrows indicate cisplatin-induced
More informationSupplemental Material
Supplemental Material 1 Figure S1. Phylogenetic analysis of Cep72 and Lrrc36, comparative localization of Cep72 and Lrrc36 and Cep72 antibody characterization (A) Phylogenetic alignment of Cep72 and Lrrc36
More informationStabilization of the Transcription Factor Foxp3 by the Deubiquitinase USP7 Increases Treg-Cell-Suppressive Capacity
Immunity, Volume 39 Supplemental Information Stabilization of the Transcription Factor Foxp3 by the Deubiquitinase USP7 Increases Treg-Cell-Suppressive Capacity Jorg van Loosdregt, Veerle Fleskens, Juan
More informationC-terminus of HSC70-Interacting Protein (CHIP) Inhibits Adipocyte. Differentiation via Ubiquitin- and Proteasome-Mediated Degradation of.
Cterminus of HSC7Interacting Protein () Inhibits Adipocyte Differentiation via Ubiquitin and ProteasomeMediated Degradation of PPARγ JungHoon Kim, Soyeon Shin, Jinho Seo, EunWoo Lee, Manhyung Joeng, Minsik
More informationCancer cells that survive radiation therapy acquire HIF-1 activity and translocate toward tumor blood vessels Supplementary Information
Cancer cells that survive radiation therapy acquire HIF-1 activity and translocate toward tumor blood vessels Supplementary Information 1. Supplementary Figure S1-S10: Pages 2-11 2. Supplementary References:
More informationASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
More information3 P p25. p43 p41 28 FADD. cflips. PE-Cy5 [Fluorescence intensity]
L S p4 3 D3 76 N S L Ve ct or p4 3 D3 76 N S L Ve ct or A aspase 8 FADD TRAF2 D95-R - + Vector D95L TL I S L D376N T RAIL-R1 T RAIL-R2 D95-R E-y5 [Fluorescence intensity] Supplemental Fig. 1 Different
More informationRer1 and calnexin regulate endoplasmic reticulum retention of a peripheral myelin protein 22 mutant that causes type 1A Charcot-Marie-Tooth disease
Rer1 and calnexin regulate endoplasmic reticulum retention of a peripheral myelin protein mutant that causes type 1A Charcot-Marie-Tooth disease Taichi Hara, Yukiko Hashimoto, Tomoko Akuzawa, Rika Hirai,
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Kanaani et al., http://www.jcb.org/cgi/content/full/jcb.200912101/dc1 Figure S1. The K2 rabbit polyclonal antibody is specific for GAD67,
More informationTitle: The cleaved FAS ligand activates the Na + /H + exchanger NHE1 through. Akt/ROCK1 to stimulate cell motility.
Title: The cleaved FAS ligand activates the Na + /H + exchanger NHE through Akt/ROCK to stimulate cell motility. Authors : Monet Michael, Poët Mallorie, Tauzin Sébastien 2,#, Fouqué Amélie 3, Cophignon
More informationVERIFY Tagged Antigen. Validation Data
VERIFY Tagged Antigen Validation Data Antibody Validation Figure 1. Over-expression cell lysate for human STAT3 (NM_139276) was used to test 3 commercial antibodies. Antibody A shows strong antigen binding.
More informationINOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807
INOS Colorimetric Cell-Based ELISA Kit Catalog #: OKAG00807 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only. Not Intended
More informationPrimers used for PCR of conductin, SGK1 and GAPDH have been described in (Dehner et al,
Supplementary METHODS Flow Cytometry (FACS) For FACS analysis, trypsinized cells were fixed in ethanol, rehydrated in PBS and treated with 40μg/ml propidium iodide and 10μ/ml RNase for 30 min at room temperature.
More informationsomatic transition to was evident into airways in the
Supplementary Fig. 1. A. Activation of an oncogenic K-Ras allele by recombination in somatic cells leads to spontaneous lung cancer in LA1 mice (ref. 20). In this mouse model, subpleural precancerous adenomas
More informationCytoGLOW. IKK-α/β. Colorimetric Cell-Based ELISA Kit. Catalog #: CB5358
CytoGLOW IKK-α/β Colorimetric Cell-Based ELISA Kit Catalog #: CB5358 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only.
More informationSupplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various
Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various GST-tagged N-terminal truncated APP fragments including GST-APP full-length (FL), APP (123-695), APP (189-695), or
More informationMouse Models to Investigate Cell Cycle and Cancer Prof. Philipp Kaldis
Mouse Models to Investigate Institute of Molecular and Cell Biology (IMCB) Cell Division and Cancer Laboratory, Proteos 3-09 Singapore 138673 1 2 Crystal structure of Cdk2/ cyclin A A.A Russo et al., (1996)
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/404/ra120/dc1 Supplementary Materials for The subcellular localization and activity of cortactin is regulated by acetylation and interaction with Keap1 Akihiro
More informationTranscriptional regulation of BRCA1 expression by a metabolic switch: Di, Fernandez, De Siervi, Longo, and Gardner. H3K4Me3
ChIP H3K4Me3 enrichment.25.2.15.1.5 H3K4Me3 H3K4Me3 ctrl H3K4Me3 + E2 NS + E2 1. kb kb +82 kb Figure S1. Estrogen promotes entry of MCF-7 into the cell cycle but does not significantly change activation-associated
More informationColeman et al., Supplementary Figure 1
Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential
More informationSupplementary Materials
Supplementary Materials Supplementary Figure 1. PKM2 interacts with MLC2 in cytokinesis. a, U87, U87/EGFRvIII, and HeLa cells in cytokinesis were immunostained with DAPI and an anti-pkm2 antibody. Thirty
More informationSUPPLEMENTAL FIGURE LEGENDS
SUPPLEMENTAL FIGURE LEGENDS Suppl. Fig. 1. Notch and myostatin expression is unaffected in the absence of p65 during postnatal development. A & B. Myostatin and Notch-1 expression levels were determined
More informationAndrogen Receptor (Phospho-Tyr363) Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG02138
Androgen Receptor (Phospho-Tyr363) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02138 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research
More informationSupplementary Information
Supplementary Information Peroxiredoxin-2 and STAT3 form a redox relay for H 2 O 2 signaling Mirko C. Sobotta 1, Willy Liou 1, Sarah Stöcker 1, Deepti Talwar 1, Michael Oehler 1, Thomas Ruppert 2, Annette
More informationSUPPLEMENTAL EXPERIMENTAL PROCEDURES
SUPPLEMENTAL EXPERIMENTAL PROCEDURES Luciferase Assays Cells were seeded on 24well plates and grown to 7% confluency. Cells were then transfected with ng of reporter constructs and 1 ng of the renilla
More informationseminal vesicle thymus kidney lung liver
a 1 HEK293 1 B 3 3 T GFPSMAD TGFβ (T)/ BMP (B) IB: SMAD1/3TP IB: GFP b wild type mouse tissue kidney thymus seminal vesicle liver lung brain adipose tissue muscle pancreas heart uterus spleen testis IB:
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Ricke et al., http://www.jcb.org/cgi/content/full/jcb.201205115/dc1 Figure S1. Kinetochore localization of mitotic regulators in wild-type
More informationSupplementary Figure 1 Structural modeling and purification of V. cholerae ABH. (a) The migration of the purified rabh and catalytically inactive
Supplementary Figure 1 Structural modeling and purification of V. cholerae ABH. (a) The migration of the purified rabh and catalytically inactive variants rabhs, rabhd, and rabhh are shown on 12% SDS-PAGE
More informationMethods Western blot analysis of plg Quantification of plasminogen accumulation by ELISA Immunohistochemical analysis
Methods Western blot analysis of plg Wild-type mice first received a standardized burn wound and then were intravenously administered 2 mg of human plg (Omnio AB, Umeå, Sweden). 24 hours after wounding
More information