Li et al., Supplemental Figures

Size: px
Start display at page:

Download "Li et al., Supplemental Figures"

Transcription

1 Li et al., Supplemental Figures Fig. S1. Suppressing TGM2 expression with TGM2 sirnas inhibits migration and invasion in A549-TR cells. A, A549-TR cells transfected with negative control sirna (NC sirna) or two individual TGM2 sirna. Knockdown of TGM2 expression was confirmed by Western blot. B, The migration assay was performed 48 h post transfection. C, Invasion assay. Data shown are mean ± S.D; **P< 0.01 (compared to NC). Fig. S2. Overexpression of TGM2 in A549-WT cells increases migration and invasion. A, A549-WT cells were transfected with an empty vector (pcdna) or pcdna-tgm2. Stable transfectant clones were selected and TGM2 expression was confirmed by Western blot. Note that the ectopic expressed TGM2 has a similar size as that of the endogenous TGM2. B, Migration assay. C, Invasion assay. Data shown are mean ± S.D; **P< 0.01 (compared to NC).

2 Fig. S3. Restoration of TGM2 expression alleviates TGM2 sirna s inhibition on migration in A549-TR cells. A, A549-TR cells were stably transfected with TGM2-expressing or an empty vector. The cells were transiently transfected with negative control sirna (NC sirna) or an individual TGM2 sirna (#4). Overexpression and knockdown of TGM2 expression were confirmed by Western blot. Note that the ectopically expressed TGM2 overlaps the endogenous TGM2. The slight reduction of TGM2 level in the TGM2-transfected cells is likely due to removal of endogenous TGM2 by the sirna. B, Migration assay was performed 48 h post transfection. Data shown are mean ± S.D; ** P< Fig. S4. Knockdown of TGM2 expression with individual TGM2 sirna results in MMP-9 suppression in A549-TR cells. A549-TR cells were transfected with negative control sirna (NC sirna) or two individual TGM2 sirna. Expression of the indicated proteins was detected by Western blot. β-actin was detected as a loading control.

3 Fig. S5. Knockdown of TGM2 expression with individual TGM2 sirna sensitizes TRAIL s cytotoxicity in A549-TR cells. A549-TR cells were transfected with negative control sirna (NC sirna) or two individual TGM2 sirna. Expression of the indicated proteins was detected by Western blot as shown in Fig. S1. The cells were treated with TRAIL (150 ng/ml) for 30h. Cell death was detected by LDH leakage assay. Fig. S6. Restoration of TGM2 expression inhibits TGM2 sirna s potetiation on TRAIL s cytotoxicity in A549-TR cells. A549-TR cells were transfected with negative control sirna (NC sirna) or two individual TGM2 sirna. Knockdown of TGM2 expression of TGM2 was shown in Fig. S3. The cells were treated with TRAIL (150 ng/ml) for 30h. Cell death was detected by LDH leakage assay. Data shown are mean ± S.D; ** P< 0.01.

4 Fig. S7. Overexpression of TGM2 in A549-WT cells suppresses TRAIL s cytotoxicity in A549-WT cells. Stable transfectant clones shown in Fig. S2 were treated with TRAIL (150 ng/ml) for 30h. Cell death was detected by LDH leakage assay. Data shown are mean ± S.D; **P< 0.01, *P<0.05 (compared to NC).

5 Fig. S8. Confirmation of the effectiveness of inhibitors in blocking the respective signaling pathways. A, A549-WT cells were pretreated with the EGFR inhibitor (10 µm) for 30 min or left untreated followed by exposure to TGF-α (10 ng/ml) for the indicated times. Phosphorylated and total Akt were detected by Western blot. B, A549-WT cells were pretreated with LY (10 µm) for 30 min or left untreated followed by exposure to TGF-α (10 ng/ml) for the indicated times. Phosphorylated and total Akt were detected by Western blot. C, A549-WT cells were pretreated with U0126 (10 µm) for 30 min or left untreated followed by exposure to TGF-α (10 ng/ml) for the indicated times. Phosphorylated and total ERK were detected by Western blot. D, A549-WT cells were pretreated with SB (10 µm) for 30 min or left untreated following by exposure to UVB (100 mj/cm 2 ) and culture for 30 min. Phosphorylated and total p38 were detected by Western blot. E, A549-Luc (a cell line with a NF-κB-driven luciferase reporter) cells were pretreated with IKK inhibitor II (10 µm) for 30 min or left untreated following by exposure to TNF-α (10 ng/ml) for 6 h. Luciferase was measured. Data shown are mean ± S.D. D, A549- WT cells were pretreated with SP (10 µm) for 30 min or left untreated followed by exposure to TNF-α (10 ng/ml). Phosphorylated and total JNK were detected by Western blot.

Supplementary Fig. 1 Kinetics of appearence of the faster migrating form of Bcl-10.

Supplementary Fig. 1 Kinetics of appearence of the faster migrating form of Bcl-10. α-cd3 + α-cd28: Time (min): + + + + + + + + + 0 5 15 30 60 120 180 240 300 360 360 n.s. Supplementary Fig. 1 Kinetics of appearence of the faster migrating form of. Immunoblot of lysates from Jurkat cells

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figures Supplementary Figure 1. MLK1-4 phosphorylate MEK in the presence of RAF inhibitors. (a) H157 cells were transiently transfected with Flag- or HA-tagged MLK1-4

More information

3 P p25. p43 p41 28 FADD. cflips. PE-Cy5 [Fluorescence intensity]

3 P p25. p43 p41 28 FADD. cflips. PE-Cy5 [Fluorescence intensity] L S p4 3 D3 76 N S L Ve ct or p4 3 D3 76 N S L Ve ct or A aspase 8 FADD TRAF2 D95-R - + Vector D95L TL I S L D376N T RAIL-R1 T RAIL-R2 D95-R E-y5 [Fluorescence intensity] Supplemental Fig. 1 Different

More information

Inhibition of Twist1 mediated invasion by Chk2 promotes premature senescence in p53 defective cancer cells

Inhibition of Twist1 mediated invasion by Chk2 promotes premature senescence in p53 defective cancer cells Inhibition of Twist1 mediated invasion by Chk2 promotes premature senescence in p53 defective cancer cells Debasis Nayak, a,1 Anmol Kumar, b Souneek Chakraborty, a,1 Reyaz ur Rasool, a,1 Hina Amin, a Archana

More information

Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency.

Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency. Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency. (a) Transfection of different concentration of GAS5-overexpressing

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation

More information

Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated

Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated reporter luciferase constructs, HEK293T cells were stimulated

More information

Supplemental Figure 1. HepG2 cells were transfected with GLI luciferase reporter construct

Supplemental Figure 1. HepG2 cells were transfected with GLI luciferase reporter construct Supplemental Figure 1. HepG2 cells were transfected with GLI luciferase reporter construct (pgl38xgli), EWS-FLI1 luciferase reporter construct (NROB1-Luc) with or without GLI1, EWS- FLI1 and cdnas respectively.

More information

Journal of Cell Science Supplementary Material

Journal of Cell Science Supplementary Material 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 SUPPLEMENTARY FIGURE LEGENDS Figure S1: Eps8 is localized at focal adhesions and binds directly to FAK (A) Focal

More information

SUPPLEMENTAL FIGURES AND TABLES

SUPPLEMENTAL FIGURES AND TABLES SUPPLEMENTAL FIGURES AND TABLES A B Flag-ALDH1A1 IP: α-ac HEK293T WT 91R 128R 252Q 367R 41/ 419R 435R 495R 412R C Flag-ALDH1A1 NAM IP: HEK293T + + - + D NAM - + + E Relative ALDH1A1 activity 1..8.6.4.2

More information

Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr

Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr Supplemental figure legends Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr A, LβT2 cells were transfected with either scrambled or PEA-15 sirna. Cells were then

More information

Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).

Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). 1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well

More information

AIP1 functions as an endogenous inhibitor of VEGFR2-mediated signaling and inflammatory angiogenesis

AIP1 functions as an endogenous inhibitor of VEGFR2-mediated signaling and inflammatory angiogenesis SUPPLEMENTAL MATERIALS functions as an endogenous inhibitor of VEGFR2-mediated signaling and inflammatory angiogenesis Haifeng Zhang 1*, Yun He 1*, Shengchuan Dai 1*, Zhe Xu 2*, Yan Luo 2, Ting Wan 2,

More information

SUPPLEMENTAL EXPERIMENTAL PROCEDURES

SUPPLEMENTAL EXPERIMENTAL PROCEDURES SUPPLEMENTAL EXPERIMENTAL PROCEDURES Luciferase Assays Cells were seeded on 24well plates and grown to 7% confluency. Cells were then transfected with ng of reporter constructs and 1 ng of the renilla

More information

CDK5 is essential for TGF-β1-induced epithelial-mesenchymal transition and breast cancer progression

CDK5 is essential for TGF-β1-induced epithelial-mesenchymal transition and breast cancer progression Supplementary information for: CDK5 is essential for TGF-β1-induced epithelial-mesenchymal transition and breast cancer progression Qian Liang, Lili Li, Jianchao Zhang, Yang Lei, Liping Wang, Dong-Xu Liu,

More information

Fig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of

Fig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of Fig. S1 TGF RI inhibitor SB525334 effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of different concentrations of SB525334. Cells were lysed and

More information

Supplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2

Supplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2 Molecular Cell, Volume 65 Supplemental Information The TRAIL-Induced Cancer Secretome Promotes a Tumor-Supportive Immune Microenvironment via CCR2 Torsten Hartwig, Antonella Montinaro, Silvia von Karstedt,

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Rainero et al., http://www.jcb.org/cgi/content/full/jcb.201109112/dc1 Figure S1. The expression of DGK- is reduced upon transfection

More information

Genetic screening for synthetic lethal partners of polynucleotide kinase/phosphatase: potential for targeting SHP-1 depleted cancers

Genetic screening for synthetic lethal partners of polynucleotide kinase/phosphatase: potential for targeting SHP-1 depleted cancers Genetic screening for synthetic lethal partners of polynucleotide kinase/phosphatase: potential for targeting SHP-1 depleted cancers T.R. Mereniuk et al. Supplemental tlmt Material: il Supplemental l Figures

More information

Table 1. Primers, annealing temperatures, and product sizes for PCR amplification.

Table 1. Primers, annealing temperatures, and product sizes for PCR amplification. Table 1. Primers, annealing temperatures, and product sizes for PCR amplification. Gene Direction Primer sequence (5 3 ) Annealing Temperature Size (bp) BRCA1 Forward TTGCGGGAGGAAAATGGGTAGTTA 50 o C 292

More information

Supplemental Figure 1

Supplemental Figure 1 Supplemental Fig. 1. Kinetics of,,, AKT and ERK activation in BMMCs following SCF stimulation. Starved BMMCs were stimulated with 250ng/mL of SCF for the indicated time. Soluble Cell Lysates (SCLs) were

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Han et al., http://www.jcb.org/cgi/content/full/jcb.201311007/dc1 Figure S1. SIVA1 interacts with PCNA. (A) HEK293T cells were transiently

More information

TE5 KYSE510 TE7 KYSE70 KYSE140

TE5 KYSE510 TE7 KYSE70 KYSE140 TE5 KYSE5 TT KYSE7 KYSE4 Supplementary Figure. Hockey stick plots showing input normalized, rank ordered H3K7ac signals for the candidate SE-associated lncrnas in this study. Rpm Rpm Rpm Chip-seq H3K7ac

More information

Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation

Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation 1 2 3 4 5 SUPPLEMENTAL DATA Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation Magalí Nazar, Juan Pablo Nicola, María Laura

More information

transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected with the wwp-luc reporter, and FLAG-tagged FHL1,

transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected with the wwp-luc reporter, and FLAG-tagged FHL1, Supplementary Data Supplementary Figure Legends Supplementary Figure 1 FHL-mediated TGFβ-responsive reporter transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected

More information

Bronchial epithelium and its associated tissues act as a

Bronchial epithelium and its associated tissues act as a The Journal of Immunology A JNK-Independent Signaling Pathway Regulates TNF -Stimulated, c-jun-driven FRA-1 Protooncogene Transcription in Pulmonary Epithelial Cells 1 Pavan Adiseshaiah,* Dhananjaya V.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2271 Supplementary Figure a! WM266.4 mock WM266.4 #7 sirna WM266.4 #10 sirna SKMEL28 mock SKMEL28 #7 sirna SKMEL28 #10 sirna WM1361 mock WM1361 #7 sirna WM1361 #10 sirna 9 WM266. WM136

More information

SUPPLEMENTAL FIGURE LEGENDS

SUPPLEMENTAL FIGURE LEGENDS SUPPLEMENTAL FIGURE LEGENDS Suppl. Fig. 1. Notch and myostatin expression is unaffected in the absence of p65 during postnatal development. A & B. Myostatin and Notch-1 expression levels were determined

More information

FSC-H FSC-H FSC-H

FSC-H FSC-H FSC-H Supplement Figure A 4 h control + h B 4 h control + h Supplement Figure A-H BV6/TNF-α + ctrl A B 9 h C D h E F 8 h G H Supplement Figure I-P + ctrl I J 8 h K L 4 h M N h O P Supplement Figure 3 A Survival

More information

Effects of metformin on Sirt1, Nrf2 and AhR expression in cancer cells

Effects of metformin on Sirt1, Nrf2 and AhR expression in cancer cells A Dissertation for the Degree of Doctor of Philosophy Effects of metformin on Sirt1, Nrf2 and AhR expression in cancer cells Department of Pharmacy Graduate School Chungnam National University By Minh

More information

used at a final concentration of 5 ng/ml. Rabbit anti-bim and mouse anti-mkp2 antibodies were

used at a final concentration of 5 ng/ml. Rabbit anti-bim and mouse anti-mkp2 antibodies were 1 Supplemental Methods Reagents and chemicals: TGFβ was a generous gift from Genzyme Inc. (Cambridge, MA) and was used at a final concentration of 5 ng/ml. Rabbit anti-bim and mouse anti-mkp2 antibodies

More information

Supplementary Methods Plasmid constructs

Supplementary Methods Plasmid constructs Supplementary Methods Plasmid constructs. Mouse cdna encoding SHP-1, amplified from mrna of RAW264.7 macrophages with primer 5'cgtgcctgcccagacaaactgt3' and 5'cggaattcagacgaatgcccagatcacttcc3', was cloned

More information

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6

More information

all samples of a band with a molecular weight close to that expected for the endogenous!-

all samples of a band with a molecular weight close to that expected for the endogenous!- SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1 : Specificity of anti-!-arrestin Abs and levels of!-arrestin in WHIM wt leukocytes. (A and B) HEK 293T cells were transiently transfected using the reagent

More information

Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas.

Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Target Gene Non-target / Control BTG2 BRCA1 NFE2L2 Target Sequence ON-TARGET plus Non-targeting sirna # 1 (Cat# D-001810-01-05) sirna1: GAACCGACAUGCUCCCGGA

More information

Figure S1. GST-MDA-7 toxicity in GBM cells is dependent on cathepsin proteases, and weakly

Figure S1. GST-MDA-7 toxicity in GBM cells is dependent on cathepsin proteases, and weakly Supplemental Figure Legends. Figure S1. GST-MDA-7 toxicity in GBM cells is dependent on cathepsin proteases, and weakly dependent on caspase 8. GBM6 and GBM12 cells were treated 24 h after plating with

More information

Supplementary Methods

Supplementary Methods Supplementary Methods Microarray Data Analysis Gene expression data were obtained by hybridising a total of 24 samples from 6 experimental groups (n=4 per group) to Illumina HumanHT-12 Expression BeadChips.

More information

Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4

Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4 SUPPLEMENTARY FIGURE LEGENDS Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4 directly up-regulates the expression of NIPP1 and CCNF that together inhibit protein phosphatase

More information

Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated

Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated Supplementary Figure Legends Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated with either vehicle (left; n=3) or CCl 4 (right; n=3) were co-immunostained for NRP-1 (green)

More information

Supplementary Figure 1 Validate the expression of mir-302b after bacterial infection by northern

Supplementary Figure 1 Validate the expression of mir-302b after bacterial infection by northern Supplementary Figure 1 Validate the expression of mir-302b after bacterial infection by northern blot. Northern blot analysis of mir-302b expression following infection with PAO1, PAK and Kp in (A) lung

More information

Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide,

Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide, Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide, conjugated with either TAT or Myristic acid and biotin for

More information

Title: The cleaved FAS ligand activates the Na + /H + exchanger NHE1 through. Akt/ROCK1 to stimulate cell motility.

Title: The cleaved FAS ligand activates the Na + /H + exchanger NHE1 through. Akt/ROCK1 to stimulate cell motility. Title: The cleaved FAS ligand activates the Na + /H + exchanger NHE through Akt/ROCK to stimulate cell motility. Authors : Monet Michael, Poët Mallorie, Tauzin Sébastien 2,#, Fouqué Amélie 3, Cophignon

More information

Estradiol-Estrogen Receptor α Mediates the Expression of the CXXC5 Gene through the Estrogen Response Element-Dependent Signaling Pathway

Estradiol-Estrogen Receptor α Mediates the Expression of the CXXC5 Gene through the Estrogen Response Element-Dependent Signaling Pathway Estradiol-Estrogen Receptor α Mediates the Expression of the CXXC5 Gene through the Estrogen Response Element-Dependent Signaling Pathway Pelin Yaşar, Gamze Ayaz and Mesut Muyan SUPPLEMENTARY INFORMATION

More information

1. Primers for PCR to amplify hairpin stem-loop precursor mir-145 plus different flanking sequence from human genomic DNA.

1. Primers for PCR to amplify hairpin stem-loop precursor mir-145 plus different flanking sequence from human genomic DNA. Supplemental data: 1. Primers for PCR to amplify hairpin stem-loop precursor mir-145 plus different flanking sequence from human genomic DNA. Strategy#1: 20nt at both sides: #1_BglII-Fd primer : 5 -gga

More information

SUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells

SUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells SUPPLEMENTARY INFORMATION Small molecule activation of the TRAIL receptor DR5 in human cancer cells Gelin Wang 1*, Xiaoming Wang 2, Hong Yu 1, Shuguang Wei 1, Noelle Williams 1, Daniel L. Holmes 1, Randal

More information

Figure S1: NIK-deficient cells resist to Tweak/TNFα-induced cell death (a) Two independent clones of NIK WT and NIK KO MEFs were treated for 24 hours with Tweak (200 ng/ml) and TNFα (200 U/ml) and cell

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Contents: Supplementary Figure 1. Additional structural and binding data for designed tuim peptides. Supplementary Figure 2. Subcellular localization patterns of designed tuim

More information

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

More information

Legend for Supplemental Figures and Tables

Legend for Supplemental Figures and Tables Legend for Supplemental Figures and Tables Supplemental Fig. 1. Negative regulation of the CYP27B1 promoter in a ligand-dependent manner (A) OK-P cells were transfected with pcdna-trα, pcdna-trβ1 or pcdna3

More information

Stabilization of the Transcription Factor Foxp3 by the Deubiquitinase USP7 Increases Treg-Cell-Suppressive Capacity

Stabilization of the Transcription Factor Foxp3 by the Deubiquitinase USP7 Increases Treg-Cell-Suppressive Capacity Immunity, Volume 39 Supplemental Information Stabilization of the Transcription Factor Foxp3 by the Deubiquitinase USP7 Increases Treg-Cell-Suppressive Capacity Jorg van Loosdregt, Veerle Fleskens, Juan

More information

Gene Sequence Fragment size ΔEGFR F 5' GGGCTCTGGAGGAAAAGAAAG GT 3' 116 bp R 5' CTTCTTACACTTGCGGACGC 3'

Gene Sequence Fragment size ΔEGFR F 5' GGGCTCTGGAGGAAAAGAAAG GT 3' 116 bp R 5' CTTCTTACACTTGCGGACGC 3' Supplementary Table 1: Real-time PCR primer sequences for ΔEGFR, wtegfr, IL-6, LIF and GAPDH. Gene Sequence Fragment size ΔEGFR F 5' GGGCTCTGGAGGAAAAGAAAG GT 3' 116 bp R 5' CTTCTTACACTTGCGGACGC 3' wtegfr

More information

Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR

Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR Supplementary Methods Antibodies Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR (Cat#2646), anti-igf1r (Cat#3018), anti-insr (Cat#3020), anti-akt (pan, Cat#4691), anti-phospho-akt

More information

Supplementary Figure 1. (A) Cell proliferative ability and (B) the invasiveness of

Supplementary Figure 1. (A) Cell proliferative ability and (B) the invasiveness of LEGEND FOR SUPPLEMENTARY FIGURES Supplementary Figure 1. (A) Cell proliferative ability and (B) the invasiveness of LLC-1, LLC-3, and LLC-5 cell line series were quantified by BrdU assay after 72 h of

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/5/233/ra50/dc1 Supplementary Materials for Epidermal Growth Factor Receptor Is Essential for Toll-Like Receptor 3 Signaling Michifumi Yamashita, Saurabh Chattopadhyay,

More information

Online Supplementary Information

Online Supplementary Information Online Supplementary Information NLRP4 negatively regulates type I interferon signaling by targeting TBK1 for degradation via E3 ubiquitin ligase DTX4 Jun Cui 1,4,6,7, Yinyin Li 1,5,6,7, Liang Zhu 1, Dan

More information

Wnt16 smact merge VK/AB

Wnt16 smact merge VK/AB A WT Wnt6 smact merge VK/A KO ctrl IgG WT KO Wnt6 smact DAPI SUPPLEMENTAL FIGURE I: Wnt6 expression in MGP-deficient aortae. Immunostaining for Wnt6 and smooth muscle actin (smact) in aortae from 7 day

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2743 Figure S1 stabilizes cellular protein level, post-transcriptionally. (a, b) and DDR1 were RNAi-depleted from HEK.293.-CBG cells. Western blots with indicated antibodies (a). RT-PCRs

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1

Nature Biotechnology: doi: /nbt Supplementary Figure 1 Supplementary Figure 1 Generation of the AARE-Gene system construct. (a) Position and sequence alignment of AAREs extracted from human Trb3, Chop or Atf3 promoters. AARE core sequences are boxed in grey.

More information

Data Supplement Plasmin Triggers Cytokine Induction in Human Monocyte-Derived Macrophages

Data Supplement Plasmin Triggers Cytokine Induction in Human Monocyte-Derived Macrophages Data Supplement Plasmin Triggers Cytokine Induction in Human Monocyte-Derived Macrophages Qun Li, Yves Laumonnier, Tatiana Syrovets, and Thomas Simmet Methods Antibodies and Reagents Antibodies for immunoblotting:

More information

Data Sheet. SBE Reporter Kit (TGFβ/SMAD signaling pathway) Catalog #: 60654

Data Sheet. SBE Reporter Kit (TGFβ/SMAD signaling pathway) Catalog #: 60654 Data Sheet SBE Reporter Kit (TGFβ/SMAD signaling pathway) Catalog #: 60654 Background The transforming growth factor beta (TGFβ) signaling pathway is involved in a diverse range of cell processes such

More information

Supplementary Figure 1: Overexpression of EBV-encoded proteins Western blot analysis of the expression levels of EBV-encoded latency III proteins in

Supplementary Figure 1: Overexpression of EBV-encoded proteins Western blot analysis of the expression levels of EBV-encoded latency III proteins in Supplementary Figure 1: Overexpression of EBV-encoded proteins Western blot analysis of the expression levels of EBV-encoded latency III proteins in BL2 cells. The Ponceau S staining of the membranes or

More information

14_integrins_EGFR

14_integrins_EGFR α1 Integrin α1 -/- fibroblasts from integrin α1 knockout animals Figure S1. Serum-starved fibroblasts from α -/- 1 and +/+ mice were stimulated with 10% FBS for 30 min. (FBS) or plated on collagen I (CI)

More information

(a) Immunoblotting to show the migration position of Flag-tagged MAVS

(a) Immunoblotting to show the migration position of Flag-tagged MAVS Supplementary Figure 1 Characterization of six MAVS isoforms. (a) Immunoblotting to show the migration position of Flag-tagged MAVS isoforms. HEK293T Mavs -/- cells were transfected with constructs expressing

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/429/ra54/dc1 Supplementary Materials for Dephosphorylation of the adaptor LAT and phospholipase C by SHP-1 inhibits natural killer cell cytotoxicity Omri Matalon,

More information

Glutamine activates STAT3 to control cancer cell proliferation. independently of glutamine metabolism

Glutamine activates STAT3 to control cancer cell proliferation. independently of glutamine metabolism Glutamine activates STAT3 to control cancer cell proliferation S1 independently of glutamine metabolism Andrea Cacace, Martina Sboarina, Thibaut Vazeille, and Pierre Sonveaux Supplementary tables: Table

More information

b alternative classical none

b alternative classical none Supplementary Figure. 1: Related to Figure.1 a d e b alternative classical none NIK P-IkBa Total IkBa Tubulin P52 (Lighter) P52 (Darker) RelB (Lighter) RelB (Darker) HDAC1 Control-Sh RelB-Sh NF-kB2-Sh

More information

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p5 activity H6 5 5 H58 A59 H6 H58 A59 anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα

More information

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm

More information

Regulation of transcription by the MLL2 complex and MLL complex-associated AKAP95

Regulation of transcription by the MLL2 complex and MLL complex-associated AKAP95 Supplementary Information Regulation of transcription by the complex and MLL complex-associated Hao Jiang, Xiangdong Lu, Miho Shimada, Yali Dou, Zhanyun Tang, and Robert G. Roeder Input HeLa NE IP lot:

More information

promote ROS production and metastasis of HCC cells

promote ROS production and metastasis of HCC cells MCU-dependent mitochondrial Ca 2+ inhibits NAD+/SIRT3/SOD2 pathway to promote ROS production and metastasis of HCC cells Tingting Ren 1#, Hui Zhang 2#, Jiaojiao Wang 1, Jianjun Zhu 1, Mingpeng Jin 1,Yousheng

More information

Supplemental Methods Cell lines and culture

Supplemental Methods Cell lines and culture Supplemental Methods Cell lines and culture AGS, CL5, BT549, and SKBR were propagated in RPMI 64 medium (Mediatech Inc., Manassas, VA) supplemented with % fetal bovine serum (FBS, Atlanta Biologicals,

More information

CELL LINES TEST TOXICITY, PROTEIN INTERACTIONS, GENE ACTIVATION & INHIBITION. Explore at the cellular level.

CELL LINES TEST TOXICITY, PROTEIN INTERACTIONS, GENE ACTIVATION & INHIBITION. Explore at the cellular level. CELL LINES Reporter Lines Stable Lines Custom Services TEST TOXICITY, PROTEIN INTERACTIONS, GENE ACTIVATION & INHIBITION Explore at the cellular level www.bpsbioscience.com USE THESE CELL LINES FOR: BINDING

More information

supplementary information

supplementary information DOI: 10.1038/ncb2156 Figure S1 Depletion of p114rhogef with different sirnas. Caco-2 (a) and HCE (b) cells were transfected with individual sirnas, pools of the two sirnas or the On Target (OnT) sirna

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Nakajima and Tanoue, http://www.jcb.org/cgi/content/full/jcb.201104118/dc1 Figure S1. DLD-1 cells exhibit the characteristic morphology

More information

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG. Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination

More information

monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal antibody was examined in

monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal antibody was examined in Supplementary information Supplementary figures Supplementary Figure 1 Determination of the s pecificity of in-house anti-rhbdd1 mouse monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal

More information

Fig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector.

Fig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector. Fig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector. (a) Western blotting analysis and (b) qpcr analysis of eif6 expression in HEK293 T cells transfected with either

More information

TITLE: Elucidating Mechanisms of Farnesyltransferase Inhibitor Action and Resistance in Breast Cancer by Bioluminescence Imaging

TITLE: Elucidating Mechanisms of Farnesyltransferase Inhibitor Action and Resistance in Breast Cancer by Bioluminescence Imaging AD Award Number: W81XWH-07-1-0426 TITLE: Elucidating Mechanisms of Farnesyltransferase Inhibitor Action and Resistance in Breast Cancer by Bioluminescence Imaging PRINCIPAL INVESTIGATOR: David Piwnica-Worms,

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 PTEN promotes virus-induced expression of IFNB1 and its downstream genes. (a) Quantitative RT-PCR analysis of IFNB1 mrna (left) and ELISA of IFN-β (right) in HEK 293 cells (2 10

More information

Plasmid DNA transfection of LN-229 human glioblastoma cells with the Biontex K2 Transfection System

Plasmid DNA transfection of LN-229 human glioblastoma cells with the Biontex K2 Transfection System Plasmid DNA transfection of human glioblastoma cells with the Biontex K2 Transfection System Stephanie Hehlgans and Franz Rödel, Department of Radiotherapy and Oncology, Goethe- University Frankfurt, Theodor-Stern-Kai

More information

Primers used for PCR of conductin, SGK1 and GAPDH have been described in (Dehner et al,

Primers used for PCR of conductin, SGK1 and GAPDH have been described in (Dehner et al, Supplementary METHODS Flow Cytometry (FACS) For FACS analysis, trypsinized cells were fixed in ethanol, rehydrated in PBS and treated with 40μg/ml propidium iodide and 10μ/ml RNase for 30 min at room temperature.

More information

Supplementary Figure 1. The Hsp70 acetylation level is related to the co-chaperone binding of Hsp70 under various stress conditions.

Supplementary Figure 1. The Hsp70 acetylation level is related to the co-chaperone binding of Hsp70 under various stress conditions. Supplementary Figure 1. The Hsp70 acetylation level is related to the co-chaperone binding of Hsp70 under various stress conditions. 1 (a) Etoposide treatment gradually changes acetylation level and co-chaperone

More information

Rer1 and calnexin regulate endoplasmic reticulum retention of a peripheral myelin protein 22 mutant that causes type 1A Charcot-Marie-Tooth disease

Rer1 and calnexin regulate endoplasmic reticulum retention of a peripheral myelin protein 22 mutant that causes type 1A Charcot-Marie-Tooth disease Rer1 and calnexin regulate endoplasmic reticulum retention of a peripheral myelin protein mutant that causes type 1A Charcot-Marie-Tooth disease Taichi Hara, Yukiko Hashimoto, Tomoko Akuzawa, Rika Hirai,

More information

Supplementary Figure Legends. Figure-S1 Molecular basis of ASS1 deficiency in myxofibrosarcoma: (A)

Supplementary Figure Legends. Figure-S1 Molecular basis of ASS1 deficiency in myxofibrosarcoma: (A) Supplementary Figure Legends Figure-S1 Molecular basis of ASS1 deficiency in myxofibrosarcoma: (A) High-resolution oligonucleotide-based array comparative genomic hybridization shows normal DNA copy number

More information

Figure S1 (related to Fig. 1): The prototypical mitochondrial pathway of apoptosis is involved in cell-death of v-src-transformed cells.

Figure S1 (related to Fig. 1): The prototypical mitochondrial pathway of apoptosis is involved in cell-death of v-src-transformed cells. Figure S1 (related to Fig. 1): The prototypical mitochondrial pathway of apoptosis is involved in cell-death of v-src-transformed cells. (A) Non-transformed (Control cells) and v-srctransformed 3T3 cells

More information

Cancer cells that survive radiation therapy acquire HIF-1 activity and translocate toward tumor blood vessels Supplementary Information

Cancer cells that survive radiation therapy acquire HIF-1 activity and translocate toward tumor blood vessels Supplementary Information Cancer cells that survive radiation therapy acquire HIF-1 activity and translocate toward tumor blood vessels Supplementary Information 1. Supplementary Figure S1-S10: Pages 2-11 2. Supplementary References:

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2386 Figure 1 Src-containing puncta are not focal adhesions, podosomes or endosomes. (a) FAK-/- were stained with anti-py416 Src (green) and either (in red) the focal adhesion protein paxillin,

More information

Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System

Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System Plasmid DNA transfection of human colorectal cancer cells with the Biontex K2 Transfection System Stephanie Hehlgans and Franz Rödel, Department of Radiotherapy and Oncology, Goethe- University Frankfurt,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTAY INOMATION igure S1 Knockdown of endogenous HI-1α by short-interference NA (sina) reverts EMT and metastatic phenotypes in H1299 cells and in ADU or MC-7 cells undergoing hypoxia. a. Western

More information

Supplementary Information

Supplementary Information Supplementary Information Figure S1. Transiently overexpressed ECFP-TIAF1/EYFP-TIAF1 causes apoptosis of Mv1Lu cells. Mv1Lu cells were transfected by electroporation with ECFP, EYFP, ECFP-TIAF1, EYFP-

More information

Post-translational modification

Post-translational modification Protein expression Western blotting, is a widely used and accepted technique to detect levels of protein expression in a cell or tissue extract. This technique measures protein levels in a biological sample

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature09732 Supplementary Figure 1: Depletion of Fbw7 results in elevated Mcl-1 abundance. a, Total thymocytes from 8-wk-old Lck-Cre/Fbw7 +/fl (Control) or Lck-Cre/Fbw7 fl/fl (Fbw7 KO) mice

More information

MCF10A cells were trypsinized and attached onto fibronectin-coated petri dishes

MCF10A cells were trypsinized and attached onto fibronectin-coated petri dishes Supplemental Information Supplemental figure legends Figure S. Supplemental figure for Fig... Different methods of cell detachment similarly induce YP phosphorylation. MCF0 cells were trypsinized and attached

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/258/rs3/dc1 Supplementary Materials for A Genome-Wide sirna Screen Reveals Positive and Negative Regulators of the NOD2 and NF-κB Signaling Pathways Neil Warner,

More information

Table S1. Primer sequences

Table S1. Primer sequences Table S1. Primer sequences Primers for quantitative PCR Tgf 1 Forward Tgf 1 Reverse Tgf 2Forward Tgf 2Reverse Tgf 3 Forward Tgf 3 Reverse Tgf r1 Forward Tgf r1 Reverse Tgf r2 Forward Tgf r2 Reverse Thbs1

More information

Transcription Factor Runx3 Is Induced by Influenza A Virus and Double-Strand RNA and

Transcription Factor Runx3 Is Induced by Influenza A Virus and Double-Strand RNA and Transcription Factor Is Induced by Influenza A Virus and Double-Strand RNA and Mediates Airway Epithelial Cell Apoptosis Huachen Gan 1, Qin Hao 1, Steven Idell 1,2 & Hua Tang 1 1 Department of Cellular

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION The Supplementary Information (SI) Methods Cell culture and transfections H1299, U2OS, 293, HeLa cells were maintained in DMEM medium supplemented with 10% fetal bovine serum. H1299 and 293 cells were

More information

Supporting Information

Supporting Information Supporting Information Casson et al. 10.1073/pnas.1421699112 Sl Materials and Methods Macrophage Infections. In experiments where macrophages were primed with LPS, cells were pretreated with 0.5 μg/ml

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/428/ra5/1 Supplementary Materials for ameliorates liver steatosis by decreasing stearoyloa desaturase 1 (S1) abundance and altering hepatic lipid metabolism

More information

SureSilencing sirna Array Technology Overview

SureSilencing sirna Array Technology Overview SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference

More information