X2-C/X1-Y X2-C/VCAM-Y. FRET efficiency. Ratio YFP/CFP

Size: px
Start display at page:

Download "X2-C/X1-Y X2-C/VCAM-Y. FRET efficiency. Ratio YFP/CFP"

Transcription

1 FRET efficiency X2-C/X1-Y X2-C/VCAM-Y Ratio YFP/CFP Supplemental Data 1. Analysis of / heterodimers in live cells using FRET. FRET saturation curves were obtained using cells transiently cotransfected with the vector encoding X2-C plasmid (2 μg, ~3 FU) and increasing amounts of X1-Y plasmid (~-8 FU). For negative controls, cells were transfected with X2-C (2 μg. ~4 FU) and increasing amounts of VCAM-YFP plasmid (~1-14 FU). Data are expressed as the mean ± SEM of four independent experiments performed in duplicate.

2 1 3 X1-C/X2-Y 2,% 6,% 1 3 X2-C/X1-Y 22,% 1,6% ,% 9,% 21,9% 4,6% Supplemental Data 2. and are expressed at the cell membrane of transfected cells. Cell surface expression of and in X1-C/X2-Y and X2 C/X1-Y-transiently transfected HEK293T cells was determined by flow cytometry analysis using specific mab. The percentage of positive cells is indicated.

3 X1/X2 X1-C/X1-Y X2-C/X2-Y X1-C/X2-Y X2-C/X1-Y % Response time (sec) Supplemental Data 3. and fused to fluorescent proteins are functional receptors. Calcium mobilization assays were performed in HEK293 cells stably transfected with / (X1/X2), and in cells transiently transfected with different combinations of the same receptors coupled to yellow or cyan fluorescent proteins: -CFP/-YFP (X1-C/X1-Y), - CFP/-YFP (X2-C/X2-Y), -CFP/-YFP (X1-C/X2-Y) and -CFP/-YFP (X2-C/X1-Y). Cells loaded with Fluo-3AM were stimulated with CXCL8 (2nM) and calcium flux monitored in an flow cytometer. FIgure shows a representative experiment of five performed.

4 Mr kda kda 38 kda b-actin Lysate ipp: : Lysate 293 X1 2: Neutrophils ipp: Lane 1: Lane 2: Lane 3: 293 X1/X2 293 X2 293 X1 Supplemental Data 4. Co-immunoprecipitation of / heterodimers in 293X1/X2 cells and primary neutrophils. Unstimulated 293X1/X2, 293X1 and 293X2 cells (A) or human neutrophils () were lysed, extracts immunoprecipitated with anti- mab, and analyzed by Western blot with anti- mab, as indicated; lysates from unstimulated cells were used as controls. The membranes were stripped and reprobed with anti- mab to control protein loading and with β-actin mab. Arrows indicate and bands.

5 X1-CFP X2-CFP pires-x1gfpnuc piresgfpnuc pires-x2gfpnuc piresgfpnuc DIC/GFP CFP/GFP GFP/anti-X2-Cy3 DIC/GFP CFP/GFP GFP/anti-X1-Cy3 upplemental Data. or expression at the plasma membrane of EK293 cells expressing GFP in the nucleus. (A) HEK293T cells were cotransfected ith -CFP (X1-CFP) and pires2-acgfp1-nuc or empty vector, or () with XCR2-CFP (X2-CFP) and pires2-acgfp1-nuc or empty vector. Differential intererence contrast images show nuclear GFP when present (DIC; left columns); confocal cyan luorescence images show expression of the CFP-labeled receptor (middle columns) and lso GFP. The unlabeled receptor was detected by immunostaining using specific mab and y3-goat anti-mouse antibody (right columns); GFP is also shown. Images shown are epresentative of at least five experiments.

6 X1-C/X1-Y/pIRES-Ac X2-C/X2-Y/pIRES-Ac Relative cell number Fluorescence intensity Relative cell number Fluorescence intensity GFPNUC X2-GFPNuc control GFPNUC X1-GFPNuc control Supplemental Data 6. The expression of pires constructs does not modify neither nor expression levels. (A) Cell surface xpression of in HEK293T cells transiently cotransfected with X1- /X1-Y and pires2-acgfp1-nuc or empty vector, as determined in low cytometry. () Cell surface expression of in HEK293T cells traniently cotransfected with X2-C/X2-Y and pires2-acgfp1-nuc or mpty vector, as shown using flow cytometry.

7 CFP-Pre YFP-Pre CFP-Post YFP-Post FRET on bleached areas X1-C/X1-Y piresgfpnuc pires-x2gfpnuc %FRET efficiency %FRET efficiency X2-C/X2-Y piresgfpnuc pires-x1gfpnuc CFP-Pre YFP-Pre CFP-Post YFP-Post FRET on bleached areas %FRET efficiency %FRET efficiency Supplemental Data 7. FRET analysis by photobleaching of X1/X1 and X2/X2 homodimers in the presence of X2 or X1. (A) FRET was measured in unstimulated HEK293T cells transiently cotransfected with X1-C, X1 Y, and pires2-acgfp1-nuc or pires2-x2- AcGFP1-Nuc. One representative image (of >) shows CFP and YFP staining before (CFP-pre, YFP-pre) and after photobleaching (CFP-post, YFP-post), with a zoom image of FRET at the photobleached area (inset). FRET efficiency ± SEM is shown (right). The DIC image of both cell types is shown (left panels). Areas showing a ~1:1 YFP/CFP ratio were selected for bleaching and analysis (white outline). () FRET was measured in unstimulated HEK293T cells transiently cotransfected with X2-C, X2 Y, and pires2-acgfp1-nuc or pires2-x1-acgfp1-nuc and analyzed as in (A).

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using

More information

Supplemental Information. A Versatile Tool for Live-Cell Imaging. and Super-Resolution Nanoscopy Studies. of HIV-1 Env Distribution and Mobility

Supplemental Information. A Versatile Tool for Live-Cell Imaging. and Super-Resolution Nanoscopy Studies. of HIV-1 Env Distribution and Mobility Cell Chemical Biology, Volume 24 Supplemental Information A Versatile Tool for Live-Cell Imaging and Super-Resolution Nanoscopy Studies of HIV-1 Env Distribution and Mobility Volkan Sakin, Janina Hanne,

More information

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

More information

mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet

mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet Details

More information

SANTA CRUZ BIOTECHNOLOGY, INC.

SANTA CRUZ BIOTECHNOLOGY, INC. TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same

More information

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- #1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals

More information

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6

More information

Xfect Protein Transfection Reagent

Xfect Protein Transfection Reagent Xfect Protein Transfection Reagent Mammalian Expression Systems Rapid, high-efficiency, low-toxicity protein transfection Transfect a large amount of active protein Virtually no cytotoxicity, unlike lipofection

More information

over time using live cell microscopy. The time post infection is indicated in the lower left corner.

over time using live cell microscopy. The time post infection is indicated in the lower left corner. Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Supplementary Movie 1 Description: Fusion of NBs. BSR cells were infected

More information

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary

More information

The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit

The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Cell Reports, Volume 5 Supplemental Information The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Andrey Poleshko, Katelyn M. Mansfield, Caroline

More information

Supplementary Figure 1. Isolation of GFPHigh cells.

Supplementary Figure 1. Isolation of GFPHigh cells. Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding

More information

Resolution of Microscopes Visible light is nm Dry lens(0.5na), green(530nm light)=0.65µm=650nm for oil lens (1.4NA) UV light (300nm) = 0.13µm f

Resolution of Microscopes Visible light is nm Dry lens(0.5na), green(530nm light)=0.65µm=650nm for oil lens (1.4NA) UV light (300nm) = 0.13µm f Microscopes and Microscopy MCB 380 Good information sources: Alberts-Molecular Biology of the Cell http://micro.magnet.fsu.edu/primer/ http://www.microscopyu.com/ Approaches to Problems in Cell Biology

More information

Comparison of the Ca2+-Sensitive Dyes Fluo-3 and Fluo-4 Used with the FLIPR Fluorometric Imaging Plate Reader System

Comparison of the Ca2+-Sensitive Dyes Fluo-3 and Fluo-4 Used with the FLIPR Fluorometric Imaging Plate Reader System FLIPR Application Note Comparison of the Ca2+-Sensitive Dyes Fluo-3 and Fluo-4 Used with the FLIPR Fluorometric Imaging Plate Reader System INTRODUCTION In the FLIPR System, fluorescence-based measurement

More information

NEW! CHOgro Expression System

NEW! CHOgro Expression System NEW! CHOgro Expression System At Mirus Bio, we know it s all about expression. Introducing the new CHOgro Expression System, a transient transfection platform that finally gets high protein titers with

More information

Nature Immunology: doi: /ni Supplementary Figure 1

Nature Immunology: doi: /ni Supplementary Figure 1 Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact

More information

Immunofluorescence images of different core histones and different histone exchange assay.

Immunofluorescence images of different core histones and different histone exchange assay. Molecular Cell, Volume 51 Supplemental Information Enhanced Chromatin Dynamics by FACT Promotes Transcriptional Restart after UV-Induced DNA Damage Christoffel Dinant, Giannis Ampatziadis-Michailidis,

More information

Identification of Microprotein-Protein Interactions via APEX Tagging

Identification of Microprotein-Protein Interactions via APEX Tagging Supporting Information Identification of Microprotein-Protein Interactions via APEX Tagging Qian Chu, Annie Rathore,, Jolene K. Diedrich,, Cynthia J. Donaldson, John R. Yates III, and Alan Saghatelian

More information

Amersham * ECL * Gel horizontal electrophoresis system

Amersham * ECL * Gel horizontal electrophoresis system GE Healthcare Life Sciences Data file 28-9970-20 AB Electrophoresis products Amersham * ECL * Gel horizontal electrophoresis system Amersham ECL Gel and Amersham ECL Gel Box constitute a horizontal mini-gel

More information

7.17: Writing Up Results and Creating Illustrations

7.17: Writing Up Results and Creating Illustrations 7.17: Writing Up Results and Creating Illustrations A Results Exercise: Kansas and Pancakes Write a 5-sentence paragraph describing the results illustrated in this figure: - Describe the figure: highlights?

More information

Partha Roy

Partha Roy Fluorescence microscopy http://micro.magnet.fsu.edu/primer/index.html Partha Roy 1 Lecture Outline Definition of fluorescence Common fluorescent reagents Construction ti of a fluorescence microscope Optical

More information

Supplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons

Supplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons Neuron, Volume 61 Supplemental Data LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons Kaumudi Joshi, Seunghee Lee, Bora Lee, Jae W. Lee, and Soo-Kyung Lee Supplemental

More information

Biochimie II. Assistants Ben Brankatschk Eleonora Torti

Biochimie II.  Assistants Ben Brankatschk Eleonora Torti Biochimie II Purification de protéines exprimées dans des cellules humaines en culture Daniel Abegg Christophe Berthier Pauline Bonvin abegg6@etu.unige.ch berthie4@etu.unige.ch bonvinp0@etu.unige.ch Assistants

More information

Multiplex Fluorescence Assays for Adherence Cells without Trypsinization

Multiplex Fluorescence Assays for Adherence Cells without Trypsinization Multiplex Fluorescence Assays for Adherence Cells without Trypsinization The combination of a bright field and three fluorescent channels allows the Celigo to perform many multiplexed assays. A gating

More information

Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System

Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System Plasmid DNA transfection of human colorectal cancer cells with the Biontex K2 Transfection System Stephanie Hehlgans and Franz Rödel, Department of Radiotherapy and Oncology, Goethe- University Frankfurt,

More information

MSD Immuno-Dot-Blot Assays. A division of Meso Scale Diagnostics, LLC.

MSD Immuno-Dot-Blot Assays. A division of Meso Scale Diagnostics, LLC. MSD Immuno-Dot-Blot Assays Example: High Throughput Western Blots Replacements Traditional Western Blots High content Molecular weight and immunoreactivity Labor and protein intensive Inherently low throughput

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid

More information

Azure Biosystems Western Blotting Workflow

Azure Biosystems Western Blotting Workflow Azure Biosystems Western Blotting Workflow PROBE PLAN SEPARATE ANALYZE VISUALIZE PLAN Plan your experiment and choose your detection method Chemiluminescent Western Blotting The most common method for

More information

Nucleofector technology and transient protein production

Nucleofector technology and transient protein production amaxa xxxxxxxxxxxx Nucleofector technology research Nucleofector technology and transient protein production your link to transfection The Nucleofector technology and transient protein production Transient

More information

Challenges to measuring intracellular Ca 2+ Calmodulin: nature s Ca 2+ sensor

Challenges to measuring intracellular Ca 2+ Calmodulin: nature s Ca 2+ sensor Calcium Signals in Biological Systems Lecture 3 (2/9/0) Measuring intracellular Ca 2+ signals II: Genetically encoded Ca 2+ sensors Henry M. Colecraft, Ph.D. Challenges to measuring intracellular Ca 2+

More information

Technical Note. Housekeeping Protein Validation Protocol

Technical Note. Housekeeping Protein Validation Protocol Technical Note Housekeeping Protein Validation Protocol Published March 2017. The most recent version of this Technical Note is posted at licor.com/bio/support. Visit us on protocols.io! Explore an interactive

More information

mcherry Rat Monoclonal Antibody

mcherry Rat Monoclonal Antibody mcherry Rat Monoclonal Antibody Catalog no. M11217 Table 1 Contents and storage Material Amount Concentration Storage Stability mcherry Rat Monoclonal Antibody, unconjugated 100 μl 2 mg/ml in 1X PBS, 0.09%

More information

Supplementary Figures and Legends

Supplementary Figures and Legends Supplementary Figures and Legends Figure S1. Tests of the optical alignment and focal properties of the confocal microscope. (A) Images of the optical cross-section of fluorescent microspheres differing

More information

Regulation of Synaptic Structure and Function by FMRP- Associated MicroRNAs mir-125b and mir-132

Regulation of Synaptic Structure and Function by FMRP- Associated MicroRNAs mir-125b and mir-132 Neuron, Volume 65 Regulation of Synaptic Structure and Function by FMRP- Associated MicroRNAs mir-125b and mir-132 Dieter Edbauer, Joel R. Neilson, Kelly A. Foster, Chi-Fong Wang, Daniel P. Seeburg, Matthew

More information

Protocol for induction of expression and cell lysate production

Protocol for induction of expression and cell lysate production Protocol for induction of expression and cell lysate production AV-04 Doxycyclin induction and cell lysate 1.0 Introduction / Description This method is intended for the treatment of the previously transfected

More information

NTM486-04, NTM174-04,

NTM486-04, NTM174-04, Transfection of transformed human trabecular meshwork TM5, and primary human NTM210-05, NTM486-04, NTM174-04, and NTM153-00 cells with Metafectene Easy Adnan Dibas1A,C, Ming Jiang1A,C, Thomas Yorio1A,C.

More information

The Conserved Isoleucine Valine Phenylalanine Motif Couples Activation State and Endocytic Functions of b-arrestins

The Conserved Isoleucine Valine Phenylalanine Motif Couples Activation State and Endocytic Functions of b-arrestins Traffic 2007 Blackwell Munksgaard # 2007 The Authors doi: 10.1111/j.1600-0854.2007.00578.x The Conserved Isoleucine Valine Phenylalanine Motif Couples Activation State and Endocytic Functions of b-arrestins

More information

ab Hypoxic Response Human Flow Cytometry Kit

ab Hypoxic Response Human Flow Cytometry Kit ab126585 Hypoxic Response Human Flow Cytometry Kit Instructions for Use For measuring protein levels by flow cytometry: hypoxia-inducible factor 1-alpha (HIF1A) and BCL2/adenovirus E1B 19 kda proteininteracting

More information

The Alternatively Spliced e13 Transcript of the Rabbit Calcitonin Receptor Dimerizes with the C1a Isoform and Inhibits Its Surface Expression*

The Alternatively Spliced e13 Transcript of the Rabbit Calcitonin Receptor Dimerizes with the C1a Isoform and Inhibits Its Surface Expression* THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 278, No. 25, Issue of June 20, pp. 23085 23093, 2003 2003 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. The Alternatively

More information

Supplemental Movie Legend.

Supplemental Movie Legend. Supplemental Movie Legend. Transfected T cells were dropped onto SEE superantigen-pulsed Raji B cells (approximate location indicated by circle). Maximum-intensity projections from Z-stacks (17 slices,

More information

Supplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing

Supplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing Supplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing Chase L. Beisel, Yvonne Y. Chen, Stephanie J. Culler, Kevin G. Hoff, & Christina

More information

Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation

Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation 1 2 3 4 5 SUPPLEMENTAL DATA Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation Magalí Nazar, Juan Pablo Nicola, María Laura

More information

JUNE 25, 2010 VOLUME 285 NUMBER 26 JOURNAL OF BIOLOGICAL CHEMISTRY 20343

JUNE 25, 2010 VOLUME 285 NUMBER 26 JOURNAL OF BIOLOGICAL CHEMISTRY 20343 THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 285, NO. 26, pp. 20343 20357, June 25, 2010 Printed in the U.S.A. Helicobacter pylori Induces ERK-dependent Formation of a Phospho-c-Fos c-jun Activator Protein-1

More information

Purification of Lactate Dehydrogenase

Purification of Lactate Dehydrogenase Dominican University of California Dominican Scholar Scholarly & Creative Works Conference 2018 Scholarly and Creative Works Conference 2016 Apr 15th, 1:30 PM - 2:00 PM Purification of Lactate Dehydrogenase

More information

Lecture 25 (11/15/17)

Lecture 25 (11/15/17) Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);

More information

Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 CSRP2 PFKP ADFP ADM C10orf10 GPI LOX PLEKHA2 WIPF1

Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 CSRP2 PFKP ADFP ADM C10orf10 GPI LOX PLEKHA2 WIPF1 Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 4.52E-18 PDK1 6.77E-18 CSRP2 4.42E-17 PFKP 1.23E-14 MSH2 3.79E-13 NARF_A 5.56E-13 ADFP 5.56E-13 FAM13A1 1.56E-12 FAM29A_A 1.22E-11 CA9 1.54E-11

More information

One-step split GFP staining for sensitive protein detection and localization in mammalian cells

One-step split GFP staining for sensitive protein detection and localization in mammalian cells Supplementary Materials For: One-step split GFP staining for sensitive protein detection and localization in mammalian cells Lara Kaddoum 1,3, Eddy Magdeleine 1,3, Geoffrey S. Waldo 4, Etienne Joly 1,3,

More information

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin

More information

Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD

Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Developed for: Aerius, Odyssey Classic, Odyssey CLx and Odyssey Sa Imaging Systems

More information

ab GFP ELISA Kit Instructions for Use For the quantitative measurement of GFP protein expression

ab GFP ELISA Kit Instructions for Use  For the quantitative measurement of GFP protein expression ab117992 GFP ELISA Kit Instructions for Use For the quantitative measurement of GFP protein expression This product is for research use only and is not for diagnostic use. intended www.abcam.com Table

More information

Supplemental Information. Loss of MicroRNA-7 Regulation Leads. to a-synuclein Accumulation and. Dopaminergic Neuronal Loss In Vivo

Supplemental Information. Loss of MicroRNA-7 Regulation Leads. to a-synuclein Accumulation and. Dopaminergic Neuronal Loss In Vivo YMTHE, Volume 25 Supplemental Information Loss of MicroRNA-7 Regulation Leads to a-synuclein Accumulation and Dopaminergic Neuronal Loss In Vivo Kirsty J. McMillan, Tracey K. Murray, Nora Bengoa-Vergniory,

More information

by Neurobasal medium (supplemented with B27, 0.5mM glutamine, and 100 U/mL

by Neurobasal medium (supplemented with B27, 0.5mM glutamine, and 100 U/mL Supplementary Materials and methods Neuronal cultures and transfection The hippocampus was dissected from E8 rat embryos, dissociated, and neurons plated onto glass coverslips coated with poly-ornithine

More information

GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts

GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts Current Biology, Volume 24 Supplemental Information GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts Wei Zhou, Jin Chang, Xin Wang, Masha G. Savelieff, Yinyin Zhao, Shanshan

More information

Title: Production and characterisation of monoclonal antibodies against RAI3 and its expression in human breast cancer

Title: Production and characterisation of monoclonal antibodies against RAI3 and its expression in human breast cancer Author's response to reviews Title: Production and characterisation of monoclonal antibodies against RAI3 and its expression in human breast cancer Authors: Hannah Jörißen (hannah.joerissen@molbiotech.rwth-aachen.de)

More information

Protein Purification Products. Complete Solutions for All of Your Protein Purification Applications

Protein Purification Products. Complete Solutions for All of Your Protein Purification Applications Protein Purification Products Complete Solutions for All of Your Protein Purification Applications FLAG-Tagged Protein Products EXPRESS with the pcmv-dykddddk Vector Set Fuse your protein of interest to

More information

TECHNICAL BULLETIN. In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits

TECHNICAL BULLETIN. In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits Catalog Numbers APPA001 In Vitro Bacterial Split GFP "Fold 'n' Glow" Solubility Assay Kit (Green) APPA008 In Vitro Bacterial

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 PCR-genotyping of the three mouse models used in this study and controls for behavioral experiments after semi-chronic Pten inhibition. a-c. DNA from App/Psen1 (a), Pten tg (b) and

More information

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with

More information

Supporting Information

Supporting Information Supporting Information Shao et al. 10.1073/pnas.1504837112 SI Materials and Methods Immunofluorescence and Immunoblotting. For immunofluorescence, cells were fixed with 4% paraformaldehyde and permeabilized

More information

Spectral Separation of Multifluorescence Labels with the LSM 510 META

Spectral Separation of Multifluorescence Labels with the LSM 510 META Microscopy from Carl Zeiss Spectral Separation of Multifluorescence Labels with the LSM 510 META Indians living in the South American rain forest can distinguish between almost 200 hues of green in their

More information

RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit

RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit Catalog #: TFEH-p65 User Manual Mar 13, 2017 3607 Parkway Lane, Suite 200 Norcross, GA 30092 Tel: 1-888-494-8555 (Toll Free) or 770-729-2992,

More information

A 5 P degradation hot spot influences molecular farming of anticancerogenic nuclease TBN1 in tobacco cells

A 5 P degradation hot spot influences molecular farming of anticancerogenic nuclease TBN1 in tobacco cells Plant Cell, Tissue and Organ Culture (PCTOC) A 5 P degradation hot spot influences molecular farming of anticancerogenic nuclease TBN1 in tobacco cells Anna Týcová a,b, Rajen J. J. Piernikarczyk c, Michael

More information

FLUORESCENT PEPTIDES. Outstanding Performance and Wide Application Range

FLUORESCENT PEPTIDES. Outstanding Performance and Wide Application Range FLUORESCENT PEPTIDES Peptides and amino acids labeled with and Tide Quencher TM We offer peptides and amino acids tagged with fluorescent dyes. They meet highest demands in fluorescence intensity and photo-stability,

More information

Supplementary Figure 1 Activated B cells are subdivided into three groups

Supplementary Figure 1 Activated B cells are subdivided into three groups Supplementary Figure 1 Activated B cells are subdivided into three groups according to mitochondrial status (a) Flow cytometric analysis of mitochondrial status monitored by MitoTracker staining or differentiation

More information

Product: Arrest-In TM Transfection Reagent for RNAi

Product: Arrest-In TM Transfection Reagent for RNAi Product: Arrest-In TM Transfection Reagent for RNAi Catalog #: ATR1740, ATR1741, ATR1742, ATR1743 Product Description Arrest-In transfection reagent is a proprietary polymeric formulation, developed and

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/1137999/dc1 Supporting Online Material for Disrupting the Pairing Between let-7 and Enhances Oncogenic Transformation Christine Mayr, Michael T. Hemann, David P. Bartel*

More information

Cationic Vector Intercalation into the Lipid Membrane Enables Intact Polyplex DNA Escape from Endosomes for Gene Delivery

Cationic Vector Intercalation into the Lipid Membrane Enables Intact Polyplex DNA Escape from Endosomes for Gene Delivery Cationic Vector Intercalation into the Lipid Membrane Enables Intact Polyplex DNA Escape from Endosomes for Gene Delivery Sriram Vaidyanathan, 1 Junjie Chen, 2 Bradford G. Orr, 3 Mark M. Banaszak Holl

More information

Immunochromatographic Assay for Ultrasensitive Detection of

Immunochromatographic Assay for Ultrasensitive Detection of Supporting Information Immunochromatographic Assay for Ultrasensitive Detection of Aflatoxin B 1 in Maize by Highly Luminescent Quantum Dot Beads Meiling Ren, #,, Hengyi Xu, #, Xiaolin Huang,, Min Kuang,

More information

Supplementary Figure 1: MYCER protein expressed from the transgene can enhance

Supplementary Figure 1: MYCER protein expressed from the transgene can enhance Relative luciferase activity Relative luciferase activity MYC is a critical target FBXW7 MYC Supplementary is a critical Figures target 1-7. FBXW7 Supplementary Material A E-box sequences 1 2 3 4 5 6 HSV-TK

More information

β-arrestin mediated localization of Smoothened to the primary cilium

β-arrestin mediated localization of Smoothened to the primary cilium Published as: Science. 2008 June 27; 320(5884): 1777 1781. β-arrestin mediated localization of Smoothened to the primary cilium Jeffrey J. Kovacs 1,2, Erin J. Whalen 1, Renshui Liu 1, Kunhong Xiao 3, Jihee

More information

Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin

Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin Carla Tripisciano 1, René Weiss 1, Tanja Eichhorn 1,

More information

Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila

Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila Cell Supplemental Information Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila Bo Liu, Yonggang Zheng, Feng Yin, Jianzhong Yu, Neal Silverman, and Duojia Pan Supplemental Experimental

More information

Flow Cytometry - The Essentials

Flow Cytometry - The Essentials Flow Cytometry - The Essentials Pocket Guide to Flow Cytometry: 1. Know your Cytometer 2. Understanding Fluorescence and Fluorophores 3. Gating Process 4. Controls 5. Optimization 6. Panel Building 7.

More information

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab. / 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG

More information

JBC Papers in Press. Published on July 17, 2008 as Manuscript M J. Biol. Chem. M8:02239, Revised 6/30/08

JBC Papers in Press. Published on July 17, 2008 as Manuscript M J. Biol. Chem. M8:02239, Revised 6/30/08 JBC Papers in Press. Published on July 17, 2008 as Manuscript M802239200 The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.m802239200 J. Biol. Chem. M8:02239, Revised 6/30/08 Location and

More information

hfab Rhodamine Housekeeping Antibodies

hfab Rhodamine Housekeeping Antibodies hfab Rhodamine Housekeeping Antibodies Catalog # Description 12004163 Anti-Actin hfab Rhodamine Antibody, 200 µl 12004164 Anti-Actin hfab Rhodamine Antibody, 40 µl 12004165 Anti-Tubulin hfab Rhodamine

More information

RNA-Guided Gene Activation by CRISPR-Cas9-Based Transcription Factors

RNA-Guided Gene Activation by CRISPR-Cas9-Based Transcription Factors Supplementary Information RNA-Guided Gene Activation by CRISPR-Cas9-Based Transcription Factors Pablo Perez-Pinera 1, Daniel D. Kocak 1, Christopher M. Vockley 2,3, Andrew F. Adler 1, Ami M. Kabadi 1,

More information

Supplemental Data. Regulating Gene Expression. through RNA Nuclear Retention

Supplemental Data. Regulating Gene Expression. through RNA Nuclear Retention Supplemental Data Regulating Gene Expression through RNA Nuclear Retention Kannanganattu V. Prasanth, Supriya G. Prasanth, Zhenyu Xuan, Stephen Hearn, Susan M. Freier, C. Frank Bennett, Michael Q. Zhang,

More information

RayBio Phospho- Stat 3 (Tyr705) ELISA Kit

RayBio Phospho- Stat 3 (Tyr705) ELISA Kit RayBio Phospho- Stat 3 (Tyr705) ELISA Kit For Measuring Phosphorylated Stat3 (Tyr705) in Human, Mouse and Rat Cell Lysates User Manual (Revised Mar 1, 2012) RayBio Stat3 (Tyr705) ELISA Kit Protocol (Cat#:

More information

Proteome Profiler TM 96

Proteome Profiler TM 96 Proteome Profiler TM 96 Mouse Phospho-RTK Custom Array Catalog Number ARZC03 For the parallel determination of the relative levels of tyrosine phosphorylation of mouse receptor tyrosine kinases (RTKs).

More information

*Corresponding author. Tel: ;

*Corresponding author. Tel: ; 1 SUPPLEMENTARY DATA 2 3 4 5 6 7 8 9 10 11 Integrin 2 1 in nonactivated conformation can induce focal adhesion kinase signaling Maria Salmela 1, Johanna Jokinen 1,2, Silja Tiitta 1, Pekka Rappu 1, Holland

More information

Tropix Chemiluminescent Kits and Reagents For Cell Biology Applications

Tropix Chemiluminescent Kits and Reagents For Cell Biology Applications PRODUCT FAMILY BULLETIN Tropix Chemiluminescent Kits and Reagents Tropix Chemiluminescent Kits and Reagents For Cell Biology Applications Introduction to Chemiluminescence Chemiluminescence is the conversion

More information

Mouse TNF Alpha PicoKine ELISA Kit

Mouse TNF Alpha PicoKine ELISA Kit BOSTER BIOLOGICAL TECHNOLOGY 3942 B Valley Ave, Pleasanton, CA 94566 Phone: 888-466-3604 Fax: 925-215-2184 Email: boster@bosterbio.com Web: www.bosterbio.com Mouse TNF Alpha PicoKine ELISA Kit Catalog

More information

Human IL-1 Alpha PicoKine ELISA Kit

Human IL-1 Alpha PicoKine ELISA Kit BOSTER BIOLOGICAL TECHNOLOGY 3942 B Valley Ave, Pleasanton, CA 94566 Phone: 888-466-3604 Fax: 925-215-2184 Email: boster@bosterbio.com Web: www.bosterbio.com Human IL-1 Alpha PicoKine ELISA Kit Catalog

More information

Practical light microscopy: an introduction

Practical light microscopy: an introduction Practical light microscopy: an introduction Dr. Mark Leake, Oxford University www.physics.ox.ac.uk/users/leake Aim of today s talk: Explanation of the very (very) basics of how a light microscope works

More information

Role of the Regulatory Domain of Protein Kinase D2 in Phorbol Ester Binding, Catalytic Activity, and Nucleocytoplasmic Shuttling

Role of the Regulatory Domain of Protein Kinase D2 in Phorbol Ester Binding, Catalytic Activity, and Nucleocytoplasmic Shuttling Molecular Biology of the Cell Vol. 16, 4375 4385, September 2005 Role of the Regulatory Domain of Protein Kinase D2 in Phorbol Ester Binding, Catalytic Activity, and Nucleocytoplasmic Shuttling Alexandra

More information

ENCODE DCC Antibody Validation Document

ENCODE DCC Antibody Validation Document ENCODE DCC Antibody Validation Document Date of Submission 09/12/12 Name: Trupti Kawli Email: trupti@stanford.edu Lab Snyder Antibody Name: SREBP1 (sc-8984) Target: SREBP1 Company/ Source: Santa Cruz Biotechnology

More information

Supplementary Figure. S1

Supplementary Figure. S1 Supplementary Figure. S1 Supplementary Figure S1. Correlation of phagocytic ability measured with YG and YO beads. Fresh human monocytes (2 10 6 /ml) were labelled with APC conjugated anti CD14 mab alone

More information

Protein Sequence-Structure-Function Relationship: Testing KE-50 Modification on Recombinant Green Fluorescent Protein (AcGFP)

Protein Sequence-Structure-Function Relationship: Testing KE-50 Modification on Recombinant Green Fluorescent Protein (AcGFP) The University of Akron IdeaExchange@UAkron Honors Research Projects The Dr. Gary B. and Pamela S. Williams Honors College Spring 2016 Protein Sequence-Structure-Function Relationship: Testing KE-50 Modification

More information

ab Fluo-8 No Wash Calcium Assay Kit

ab Fluo-8 No Wash Calcium Assay Kit ab112129 Fluo-8 No Wash Calcium Assay Kit Instructions for Use For detecting calcium in cells by using our proprietary fluorescence probe. This product is for research use only and is not intended for

More information

Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover

Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and

More information

Heme utilization in the Caenorhabditis elegans hypodermal cells is facilitated by hemeresponsive

Heme utilization in the Caenorhabditis elegans hypodermal cells is facilitated by hemeresponsive Supplemental Data Heme utilization in the Caenorhabditis elegans hypodermal cells is facilitated by hemeresponsive gene-2 Caiyong Chen 1, Tamika K. Samuel 1, Michael Krause 2, Harry A. Dailey 3, and Iqbal

More information

For identifying inhibitors and activators of mitochondrial biogenesis in adherent cultured cells.

For identifying inhibitors and activators of mitochondrial biogenesis in adherent cultured cells. ab110216 MitoBiogenesis TM In-Cell ELISA Kit (IR) Instructions for Use For identifying inhibitors and activators of mitochondrial biogenesis in adherent cultured cells. This product is for research use

More information

Dolphin-Chemi Plus. Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system

Dolphin-Chemi Plus. Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system Application Note 03 Dolphin-Chemi plus 8/22/2007 Dolphin-Chemi Plus Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system INTRODUCTION

More information

2. Sample dilution: Tissue lysate and cell lysate sample should be diluted at least 5-fold with 1x Sample Diluent Buffer.

2. Sample dilution: Tissue lysate and cell lysate sample should be diluted at least 5-fold with 1x Sample Diluent Buffer. Mouse IL-6 (Lysate) ELISA Kit Catalog No: CKM054 Size: 1 x 96 tests I. Introduction The Cell Sciences Mouse IL-6 ELISA (Enzyme-Linked Immunosorbent Assay) kit is an in vitro enzyme-linked immunosorbent

More information

Hsp70 promotes TNF-mediated apoptosis by binding IKK and impairing NF- B survival signaling

Hsp70 promotes TNF-mediated apoptosis by binding IKK and impairing NF- B survival signaling Hsp70 promotes TNF-mediated apoptosis by binding IKK and impairing NF- B survival signaling Ruiqiong Ran, 1,6 Aigang Lu, 1 Lu Zhang, 2 Yang Tang, 1 Hongyan Zhu, 1 Huichun Xu, 1 Yuxin Feng, 2 Chun Han,

More information

Figure 1. Schematic of Ats1p expression plasmid.

Figure 1. Schematic of Ats1p expression plasmid. Abstract: Anita Corbett page 2 The goal of my rotation project was to express, purify, and examine the exchange activity of a putative guanine nucleotide exchange factor, Ats1p. The S. cerevisiae ATS1

More information

Identification of Phosphotyrosine Binding Domain-Containing Proteins as Novel Downstream Targets of the EphA8 Signaling Function

Identification of Phosphotyrosine Binding Domain-Containing Proteins as Novel Downstream Targets of the EphA8 Signaling Function MOLECULAR AND CELLULAR BIOLOGY, Dec. 2007, p. 8113 8126 Vol. 27, No. 23 0270-7306/07/$08.00 0 doi:10.1128/mcb.00794-07 Copyright 2007, American Society for Microbiology. All Rights Reserved. Identification

More information

supplementary information

supplementary information DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /

More information