TTT: 7 WT: Text book by N.C.E.R.T. 2. Reference book by Dinesh Publications.

GENETICS. I. Review of DNA/RNA A. Basic Structure DNA 3 parts that make up a nucleotide chains wrap around each other to form a

GENETICS I. Review of DNA/RNA A. Basic Structure DNA 3 parts that make up a nucleotide 1. 2. 3. chains wrap around each other to form a Chains run in opposite direction known as Type of bond between the

Study Guide for Chapter 12 Exam DNA, RNA, & Protein Synthesis

Name: Date: Period: Study Guide for Chapter 12 Exam DNA, RNA, & Protein Synthesis ***Completing this study guide in its entirety will result in extra credit on the exam. You must show me the DAY OF the

NON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH

NON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH MONDAY TUESDAY WEDNESDAY THURSDAY FRIDAY 11/14 11/15 11/16 11/17 11/18 Non-Mendelian Genetics DNA Structure and Replication 11/28

Biology 40S: Course Outline Monday-Friday Slot 1, 8:45 AM 9:45 AM Room 311 Teacher: John Howden Phone:

The course is designed to help students develop and demonstrate an understanding of the biological concepts of genetics and biodiversity through scientific inquiry, problem solving, personal reflection

CBA #4 Practice Exam Genetics. 1) (TEKS 5A) Which of the diagrams below shows the process of transcription:

CBA #4 Practice Exam Genetics 1) (TEKS 5A) Which of the diagrams below shows the process of transcription: 2) (TEKS 5C) All of the following are true statements about cell differentiation EXCEPT A. Cell

DNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted

DNA RNA PROTEIN Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA Molecule of heredity Contains all the genetic info our cells inherit Determines

Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)

Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) I. General Principles (Chapter 7 introduction) a. Morse code distinct series of dots and dashes encode the 26 letters of the

Protein Synthesis Transcription And Translation Lab Answers

Lab Answers Free PDF ebook Download: Lab Answers Download or Read Online ebook protein synthesis transcription and translation lab answers in PDF Format From The Best User Guide Database 1.. Anatomy and

(b) Draw a genetic linkage map showing map distances between met, thi, and pur.

Botany 132 Final exam 2002 Name Please show all of your work in answering the questions below. 1. F- bacterial cells of genotype met - thi - pur - were conjugated with F+ cells with the genotype met +

PELLISSIPPI STATE COMMUNITY COLLEGE MASTER SYLLABUS

PELLISSIPPI STATE COMMUNITY COLLEGE MASTER SYLLABUS GENERAL GENETICS BIOL 2120 Class Hours: 3.0 Credit Hours: 4.0 Laboratory Hours: 3.0 Revised Spring 2017 Catalog Course Description Prerequisites Corequisites

What is DNA??? DNA = Deoxyribonucleic acid IT is a molecule that contains the code for an organism s growth and function

Review DNA and RNA 1) DNA and RNA are important organic compounds found in cells, called nucleic acids 2) Both DNA and RNA molecules contain the following chemical elements: carbon, hydrogen, oxygen, nitrogen

Manitoba Education, Citizenship and Youth

Manitoba Education, Citizenship and Youth SENIOR 4 BIOLOGY 40S Student Specific Learning Outcomes DRAFT / Unedited Version April 2005 Demonstrating Understanding Cluster 0: Biology Skills and Attitudes

Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype)

Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype) Question#1: One-Gene, One-Polypeptide The figure below shows the results of feeding trials with one auxotroph strain of Neurospora

Rapid Learning Center Presents. Teach Yourself AP Biology in 24 Hours

Rapid Learning Center Chemistry :: Biology :: Physics :: Math Rapid Learning Center Presents Teach Yourself AP Biology in 24 Hours 1/35 *AP is a registered trademark of the College Board, which does not

DNA & DNA Replication

DNA & DNA Replication DNA Structure How did Watson and Crick contribute to our understanding of genetics? Watson and Crick developed the double helix model for DNA DNA Structure What is a double helix?

Population and Community Dynamics. The Hardy-Weinberg Principle

Population and Community Dynamics The Hardy-Weinberg Principle Key Terms Population: same species, same place, same time Gene: unit of heredity. Controls the expression of a trait. Can be passed to offspring.

DNA segment: T A C T G T G G C A A A

DNA Structure, Replication, Protein Synthesis & Name Period Genetics Study Guide Chapter 12 and 13 Structure of DNA and Protein Synthesis 1. What macromolecule is coded for by genes located on DNA? Provide

Bundle 5 Test Review

Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic

Genetics module. DNA Structure, Replication. The Genetic Code; Transcription and Translation. Principles of Heredity; Gene Mapping

Genetics module Lectures DNA Structure, Replication The Genetic Code; Transcription and Translation Principles of Heredity; Gene Mapping Controlling Gene Expression Mutation and Cancer Textbook: Introduction

http://www.simonmawer.com/mendel's_garden.jpg 1 http://khzs.fme.vutbr.cz/iahrwg2009/img/map_cz.gif 2 http://www.haverford.edu/biology/meneely/brno.htm 3 http://biology.clc.uc.edu/fankhauser/travel/berlin/for_web/

An introduction to genetics and molecular biology

An introduction to genetics and molecular biology Cavan Reilly September 5, 2017 Table of contents Introduction to biology Some molecular biology Gene expression Mendelian genetics Some more molecular

Molecular Genetics Student Objectives

Molecular Genetics Student Objectives Exam 1: Enduring understanding 3.A: Heritable information provides for continuity of life. Essential knowledge 3.A.1: DNA, and in some cases RNA, is the primary source

Read each question, and write your answer in the space provided. 2. How did Mendel s scientific work differ from the work of T. A. Knight?

Name Date Class CHAPTER 8 DIRECTED READING Mendel and Heredity Section 8-1: The Origins of Genetics Mendel and Others Studied Garden-Pea Traits 1. What did T. A. Knight discover? 2. How did Mendel s scientific

From Gene to Protein via Transcription and Translation i

How do genes influence our characteristics? From Gene to Protein via Transcription and Translation i A gene is a segment of DNA that provides the instructions for making a protein. Proteins have many different

MOLECULAR BASIS OF INHERITANCE

CHAPTER 6 MOLECULAR BASIS OF INHERITANCE POINTS TO REMEMBER Anticodon : A sequence of three nitrogenous bases on trna which is complementary to the codon on mrna. Transformation : The phenomenon by which

Bio 101 Sample questions: Chapter 10

Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information

GENETICS: BIOLOGY HSA REVIEW

GENETICS: BIOLOGY HSA REVIEW HSA Review A. Matching: On the lines provided, write the letter of the definition of each term. a. genetics f. gamete b. trait g. probability c. hybrid h. Punnett square d.

Chapter 14: Mendel and the Gene Idea

Chapter 14: Mendel and the Gene Idea Name Period If you have completed a first-year high school biology course, some of this chapter will serve as a review for the basic concepts of Mendelian genetics.

DO NOT OPEN UNTIL TOLD TO START

DO NOT OPEN UNTIL TOLD TO START BIO 312, Section 1, Spring 2011 February 21, 2011 Exam 1 Name (print neatly) Instructor 7 digit student ID INSTRUCTIONS: 1. There are 11 pages to the exam. Make sure you

DNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.

Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray

Bio 311 Learning Objectives

Bio 311 Learning Objectives This document outlines the learning objectives for Biol 311 (Principles of Genetics). Biol 311 is part of the BioCore within the Department of Biological Sciences; therefore,

DNA Structure & the Genome. Bio160 General Biology

DNA Structure & the Genome Bio160 General Biology Lecture Outline I. DNA A nucleic acid II. Chromosome Structure III. Chromosomes and Genes IV. DNA vs. RNA I. DNA A Nucleic Acid Structure of DNA: Remember:

Biology Genetics Practice Quiz

Biology Genetics Practice Quiz Multiple Choice Identify the choice that best completes the statement or answers the question. 1. The table above shows information related to blood types. What genotype(s)

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

Read and take notes on pages

Protein Synthesis Read and take notes on pages 336-340 What is protein? Proteins Polypeptide chains of amino acids Are enzymes that catalyze biochemical reactions and are vital to metabolism. They have

Protein Synthesis

HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?

2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine

Heredity and DNA Assignment 1

Heredity and DNA Assignment 1 Name 1. Which sequence best represents the relationship between DNA and the traits of an organism? A B C D 2. In some people, the lack of a particular causes a disease. Scientists

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication

Basic Concepts of Human Genetics

Basic Concepts of Human Genetics The genetic information of an individual is contained in 23 pairs of chromosomes. Every human cell contains the 23 pair of chromosomes. One pair is called sex chromosomes

What Are the Chemical Structures and Functions of Nucleic Acids?

THE NUCLEIC ACIDS What Are the Chemical Structures and Functions of Nucleic Acids? Nucleic acids are polymers specialized for the storage, transmission, and use of genetic information. DNA = deoxyribonucleic

Genetics and Heredity. Mr. Gagnon

Genetics and Heredity Mr. Gagnon Key Terms: Traits Heredity Genetics Purebred Genes Alleles Recessive Allele Dominant Allele Hybrids Key Concepts: What factors control the inheritance of traits in organisms?

3. INHERITED MUTATIONS

THE CENTRAL DOGMA OF BIOLOGY 1. DNA B4.2 The genetic information encoded in DNA molecules provides instructions for assembling protein molecules. Genes are segments of DNA molecules. Inserting, deleting,

Transcription. Unit: DNA. Central Dogma. 2. Transcription converts DNA into RNA. What is a gene? What is transcription? 1/7/2016

Warm Up Questions 1. Where is DNA located? 2. Name the 3 parts of a nucleotide. 3. Enzymes can catalyze many different reactions (T or F) 4. How many variables should you have in an experiment? 5. A red

Section DNA: The Molecule of Heredity

Ch 11: DNA and Genes - DNA: The Molecule of Heredity Inside This Section... What is DNA? The Structure of DNA DNA Replication What is DNA? Acid DNA is the blueprint of all living organisms. It controls

4.1. Genetics as a Tool in Anthropology

4.1. Genetics as a Tool in Anthropology Each biological system and every human being is defined by its genetic material. The genetic material is stored in the cells of the body, mainly in the nucleus of

2. From the first paragraph in this section, find three ways in which RNA differs from DNA.

Name Chapter 17: From Gene to Protein Begin reading at page 328 Basic Principles of Transcription and Translation. Work on this chapter a single concept at a time, and expect to spend at least 6 hours

DNA DNA Profiling 18. Discuss the stages involved in DNA profiling 19. Define the process of DNA profiling 20. Give two uses of DNA profiling

Name: 2.5 Genetics Objectives At the end of this sub section students should be able to: 2.5.1 Heredity and Variation 1. Discuss the diversity of organisms 2. Define the term species 3. Distinguish between

Protein Synthesis: Transcription and Translation

Protein Synthesis: Transcription and Translation Proteins In living things, proteins are in charge of the expression of our traits (hair/eye color, ability to make insulin, predisposition for cancer, etc.)

DNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th. Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video

DNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video 17 History of DNA 18 Lecture: DNA Structure Worksheet 19 Lecture:

AGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1

AGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1 - Genetics: Progress from Mendel to DNA: Gregor Mendel, in the mid 19 th century provided the

From Gene to Protein Transcription and Translation i

How do genes influence our characteristics? From Gene to Protein Transcription and Translation i A gene is a segment of DNA that provides the instructions for making a protein. Proteins have many different

Genes and human health - the science and ethics

Deoxyribonucleic acid (DNA) - why is it so important? Genes and human health - the science and ethics DNA is essential to all living organisms, from bacteria to man, as it contains a code which specifies

Downloaded from SAMPLE PAPER-1 (Solved)

CLASS-XII SAMPLE PAPER-1 (Solved) ANSWERS SECTION-A 1. Oogenesis completed when sperm comes in contact with zona pellucida of ovum. Oogenesis is initiated during embryonic development. 2. Hydrarch Succession

Biology 142 Advanced Topics in Genetics and Molecular Biology Course Syllabus Spring 2006

Biology 142 Advanced Topics in Genetics and Molecular Biology Course Syllabus Spring 2006 Faculty Information: Dr. Nitya Jacob, Office: Room 104, Pierce Hall; Phone: 770-784-8346 Office Hours: T 9:30-10:30

DNA Structure and Analysis. Chapter 4: Background

DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com

BA, BSc, and MSc Degree Examinations

Examination Candidate Number: Desk Number: BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Genetics Time Allowed: 1 hour and 30 minutes Marking Scheme: Total marks available

SCI204: Honors Biology

SCI204: Honors Biology This course provides students with a challenging honors-level biology curriculum, focusing on the chemistry of living things: the cell, genetics, evolution, the structure and function

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot

The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?

Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology

BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY

Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested

CHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein

CHAPTER 17 FROM GENE TO PROTEIN Section C: The Synthesis of Protein 1. Translation is the RNA-directed synthesis of a polypeptide: a closer look 2. Signal peptides target some eukaryotic polypeptides to

DNA & Protein Synthesis UNIT D & E

DNA & Protein Synthesis UNIT D & E How this Unit is broken down Chapter 10.1 10.3 The structure of the genetic material Chapter 10.4 & 10.5 DNA replication Chapter 10.6 10.15 The flow of genetic information

R1 12 kb R1 4 kb R1. R1 10 kb R1 2 kb R1 4 kb R1

Bcor101 Sample questions Midterm 3 1. The maps of the sites for restriction enzyme EcoR1 (R1) in the wild type and mutated cystic fibrosis genes are shown below: Wild Type R1 12 kb R1 4 kb R1 _ _ CF probe

Name Class Date. Practice Test

Name Class Date 12 DNA Practice Test Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. What do bacteriophages infect? a. mice. c. viruses.

Developmental Biology BY1101 P. Murphy

Developmental Biology BY1101 P. Murphy Lecture 7 Cellular differentiation and the regulation of gene expression. In this lecture we looked at two main questions: How is gene expression regulated? (revision

PRACTICE TEST ANSWER KEY & SCORING GUIDELINES BIOLOGY

Ohio s State Tests PRACTICE TEST ANSWER KEY & SCORING GUIDELINES BIOLOGY Table of Contents Questions 1 24: Content Summary and Answer Key...iii Question 1: Question and Scoring Guidelines...1 Question

Name: Class: Date: ID: A

Class: _ Date: _ CH 12 Review Multiple Choice Identify the choice that best completes the statement or answers the question. 1. How many codons are needed to specify three amino acids? a. 6 c. 3 b. 12

Gene Expression Transcription/Translation Protein Synthesis

Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino

DNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th. Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video

DNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video 17 History of DNA Create Tellegami or 18 Lecture: DNA Structure

DNA RNA PROTEIN SYNTHESIS -NOTES-

DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there

DNA replication. Begins at specific sites on a double helix. Proceeds in both directions. Is initiated at many points in eukaryotic chromosomes.

DNA replication Begins at specific sites on a double helix. Proceeds in both directions. Is initiated at many points in eukaryotic chromosomes. Figure 10.8 http://www.hhmi.org/biointeractive/media/ DNAi_replication_schematic-lg.mov

8/21/2014. From Gene to Protein

From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information

Observing Patterns in Inherited Traits. Chapter 11

Observing Patterns in Inherited Traits Chapter 11 Impacts, Issues: The Color of Skin Like most human traits, skin color has a genetic basis; more than 100 gene products affect the synthesis and deposition

Chapter 13 - Concept Mapping

Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin

Examination Assignments

Bioinformatics Institute of India H-109, Ground Floor, Sector-63, Noida-201307, UP. INDIA Tel.: 0120-4320801 / 02, M. 09818473366, 09810535368 Email: info@bii.in, Website: www.bii.in INDUSTRY PROGRAM IN

Adv Biology: DNA and RNA Study Guide

Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many

Human linkage analysis. fundamental concepts

Human linkage analysis fundamental concepts Genes and chromosomes Alelles of genes located on different chromosomes show independent assortment (Mendel s 2nd law) For 2 genes: 4 gamete classes with equal

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as

Student Sheet 1.1: KWL Chart

Student s Name Date Class Student Sheet 1.1: KWL Chart Topic: K W L What do you Know? What do you Want to know? What did you Learn? Lesson 1 / Pre-Assessment: Genes and Molecular Machines Student s Name

DNA and RNA. Chapter 12

DNA and RNA Chapter 12 History of DNA Late 1800 s scientists discovered that DNA is in the nucleus of the cell 1902 Walter Sutton proposed that hereditary material resided in the chromosomes in the nucleus

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more

LECTURE 26. a) A light-independent repair mechanism that involves three steps:

LECTURE 26 DNA REPAIR A. The capability for repair of damaged DNA is found in one form or another in all organisms. Prokaryotes (e.g., E. coli) have five repair systems, whereas higher organisms (e.g.,

Standards: SC.912.L.16.5: Explain the basic processes of transcription and translation, and how they result in the expression of genes.

Delicious DNA: Transcription and Translation Simulation Using an Edible Model Authors: Darcy Holoweski and Catherine Quist Standards: SC.912.L.16.5: Explain the basic processes of transcription and translation,

CHAPTERS , 17: Eukaryotic Genetics

CHAPTERS 14.1 14.6, 17: Eukaryotic Genetics 1. Review the levels of DNA packing within the eukaryote nucleus. Label each level. (A similar diagram is on pg 188 of your textbook.) 2. How do the coding regions

Gen e e n t e i t c c V a V ri r abi b li l ty Biolo l gy g Lec e tur u e e 9 : 9 Gen e et e ic I n I her e itan a ce

Genetic Variability Biology 102 Lecture 9: Genetic Inheritance Asexual reproduction = daughter cells genetically identical to parent (clones) Sexual reproduction = offspring are genetic hybrids Tendency

Gene Expression and Heritable Phenotype. CBS520 Eric Nabity

Gene Expression and Heritable Phenotype CBS520 Eric Nabity DNA is Just the Beginning DNA was determined to be the genetic material, and the structure was identified as a (double stranded) double helix.

If Dna Has The Instructions For Building Proteins Why Is Mrna Needed

If Dna Has The Instructions For Building Proteins Why Is Mrna Needed if a strand of DNA has the sequence CGGTATATC, then the complementary each strand of DNA contains the info needed to produce the complementary

DNA & Protein Synthesis #21

Name: Period: Date: Living Environment Lab DNA & Protein Synthesis #21 Introduction Of all the molecules that is in the body, DNA is perhaps the most important. DNA or dioxiribosenucleic acid is important

Pre-Lab: Molecular Biology

Pre-Lab: Molecular Biology Name 1. What are the three chemical parts of a nucleotide. Draw a simple sketch to show how the three parts are arranged. 2. What are the rules of base pairing? 3. In double

O C. 5 th C. 3 rd C. the national health museum

Elements of Molecular Biology Cells Cells is a basic unit of all living organisms. It stores all information to replicate itself Nucleus, chromosomes, genes, All living things are made of cells Prokaryote,

Inheritance Biology. Unit Map. Unit

Unit 8 Unit Map 8.A Mendelian principles 482 8.B Concept of gene 483 8.C Extension of Mendelian principles 485 8.D Gene mapping methods 495 8.E Extra chromosomal inheritance 501 8.F Microbial genetics

DNA, Replication and RNA

DNA, Replication and RNA The structure of DNA DNA, or Deoxyribonucleic Acid, is the blue prints for building all of life. DNA is a long molecule made up of units called NUCLEOTIDES. Each nucleotide is

Molecular Biology Primer. CptS 580, Computational Genomics, Spring 09

Molecular Biology Primer pts 580, omputational enomics, Spring 09 Starting 19 th century What do we know of cellular biology? ell as a fundamental building block 1850s+: ``DNA was discovered by Friedrich

Gene Regulation & Mutation 8.6,8.7

Gene Regulation & Mutation 8.6,8.7 Eukaryotic Gene Regulation Transcription factors: ensure proteins are made at right time and in right amounts. One type forms complexes that guide & stabilize binding