Next Generation Sequencing Data Analysis with BioHPC. Updated for

Size: px
Start display at page:

Download "Next Generation Sequencing Data Analysis with BioHPC. Updated for"

Transcription

1 Next Generation Sequencing Data Analysis with BioHPC 1 Updated for

2 Next Generation Sequencing Genomic, transcriptomic sequencing now commonplace in projects. Now very cheap! UTSW McDermott Core typical pricing: Whole Genome PE100 $7,500 Whole Transcriptome PE100 $875 Most common experiment across the University: Use RNA-Seq to identify gene expression changes in response to a stimulus / caused by a disease. Let s focus on this today but you can do other things on our systems! 2

3 Typical RNA Seq Workflow A B Prepare/ Obtain Samples for different conditions Extract RNA and prepare library for sequencing Run library on Illumina sequencer Obtain short-read sequences 3

4 Typical RNA Seq Workflow Data Analysis Check quality and/or filter reads Align to the genome or transcriptome Quantify transcript abundance across conditions Identify significant differences in expression between conditions 4

5 Why Use BioHPC? Powerful processing and lots of storage! 72 x 32/48 core nodes to run mapping that can take days on a PC. >1Petabyte of storage. No need to shuffle data between drives when working on large projects. Storage is fast. Best at the things NGS analysis does most (accessing large files sequentially) Tools to help you! NGS Pipeline Galaxy Batch Scripts Standard workflows with little effort. Best for beginners. Powerful environment with many tools, workflow designer. Various NGS tools available as modules on the cluster, for expert users. 5

6 But the sequencing core does it for me. This is NOT an attempt to replace comprehensive services that a sequencing core provides, where data analysis is performed as part of the sequencing service. But Now common to need to integrate existing public data into projects Common to obtain data from collaborators, outside facilities Labs often have students/postdocs who have received NGS analysis training More flexibility many tools available to create complex pipelines Use our services with caution. You *should* have a basic understanding of the limitations of the techniques. 6

7 Option 1 - BioHPC NGS Pipeline BioHPC Portal -> Cloud Services -> NGS Pipeline (ngs.biohpc.swmed.edu) Common workflows, made easy. Currently RNA-SEQ Differential Expression Analysis 7

8 Option 2 - BioHPC Galaxy Service BioHPC Portal -> Cloud Services -> Galaxy (galaxy.biohpc.swmed.edu) Reproducible workflows, with many available tools, via the web. Widely used by many institutions. 8

9 Option 3 - Modules and Sequence Data / Indices module avail /project/apps_database/igenomes Common NGS tools and Illumina igenome databases are available on the cluster Experts can write their own pipelines using cluster sbatch jobs 9

10 Today we are going to Follow a simple and real-world RNA-SEQ differential expression analysis using: The BioHPC NGS Pipeline BioHPC Galaxy Service Try it out with your own data! biohpc-help@utsouthwestern.edu with questions Bring your problems to the BioHPC drop-in coffee session next week! 10

11 Example 1 Brain vs Adrenal A toy example I can show you in real time (hopefully!) 75,000 reads from chr19, extracted from a larger study 2 Conditions brain tissue vs adrenal tissue What s the difference in expression for the limited number of transcripts we can see in this data? Courtesy Galaxy Project, Illumina Body Map: 11

12 Example 2 HIF1α, HIF2α Single and Double sirna knock-down in MCF7 Cells A real study from a lab I used to work in. Public data downloaded via EMBL-EBI ArrayExpress. Extensive regulation of the non coding transcriptome by hypoxia: role of HIF in releasing paused RNApol2 Hani Choudhry, Johannes Schödel, Spyros Oikonomopoulos, Carme Camps, Steffen Grampp, Adrian L Harris, Peter J Ratcliffe, Jiannis Ragoussis, David R Mole DOI /embr Published online EMBO reports (2014) 15, We ll take 4 conditions, all samples MCF7 cells subjected to hypoxia: Control (scrambled sirna) HIF1A knock-down by sirna HIF2A knock-down by sirna HIF1A + HIF2A double knock-down by sirna 2 replicates for each condition. Illumina HiSeq platform. 12

13 13 TopHat / Cufflinks Pipeline

14 NGS Pipeline Demo See Handouts 14

15 Galaxy Demo See Handouts 15

16 Acknowledgements NGS Pipeline Developed by Yi Du in conjunction with CRI, Zhiyu Zhao. Galaxy Many thanks to John Chilton, Martin Chech, Nicola Soranzo, Andrew Robinson, Dannon Baker for assistance incorporating BioHPC required changes into the Galaxy project. 16

Whole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist

Whole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist Whole Transcriptome Analysis of Illumina RNA- Seq Data Ryan Peters Field Application Specialist Partek GS in your NGS Pipeline Your Start-to-Finish Solution for Analysis of Next Generation Sequencing Data

More information

Course Presentation. Ignacio Medina Presentation

Course Presentation. Ignacio Medina Presentation Course Index Introduction Agenda Analysis pipeline Some considerations Introduction Who we are Teachers: Marta Bleda: Computational Biologist and Data Analyst at Department of Medicine, Addenbrooke's Hospital

More information

Sanger vs Next-Gen Sequencing

Sanger vs Next-Gen Sequencing Tools and Algorithms in Bioinformatics GCBA815/MCGB815/BMI815, Fall 2017 Week-8: Next-Gen Sequencing RNA-seq Data Analysis Babu Guda, Ph.D. Professor, Genetics, Cell Biology & Anatomy Director, Bioinformatics

More information

Long and short/small RNA-seq data analysis

Long and short/small RNA-seq data analysis Long and short/small RNA-seq data analysis GEF5, 4.9.2015 Sami Heikkinen, PhD, Dos. Topics 1. RNA-seq in a nutshell 2. Long vs short/small RNA-seq 3. Bioinformatic analysis work flows GEF5 / Heikkinen

More information

RNA-Seq analysis using R: Differential expression and transcriptome assembly

RNA-Seq analysis using R: Differential expression and transcriptome assembly RNA-Seq analysis using R: Differential expression and transcriptome assembly Beibei Chen Ph.D BICF 12/7/2016 Agenda Brief about RNA-seq and experiment design Gene oriented analysis Gene quantification

More information

Genomic Data Analysis Services Available for PL-Grid Users

Genomic Data Analysis Services Available for PL-Grid Users Domain-oriented services and resources of Polish Infrastructure for Supporting Computational Science in the European Research Space PLGrid Plus Domain-oriented services and resources of Polish Infrastructure

More information

RNA-seq Data Analysis

RNA-seq Data Analysis Lecture 3. Clustering; Function/Pathway Enrichment analysis RNA-seq Data Analysis Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Lecture 1. Map RNA-seq read to genome Lecture

More information

How much sequencing do I need? Emily Crisovan Genomics Core

How much sequencing do I need? Emily Crisovan Genomics Core How much sequencing do I need? Emily Crisovan Genomics Core How much sequencing? Three questions: 1. How much sequence is required for good experimental design? 2. What type of sequencing run is best?

More information

RNAseq Differential Gene Expression Analysis Report

RNAseq Differential Gene Expression Analysis Report RNAseq Differential Gene Expression Analysis Report Customer Name: Institute/Company: Project: NGS Data: Bioinformatics Service: IlluminaHiSeq2500 2x126bp PE Differential gene expression analysis Sample

More information

Illumina TruSeq RNA Access Library Prep Kit Automated on the Biomek FX P Dual-Hybrid Liquid Handler

Illumina TruSeq RNA Access Library Prep Kit Automated on the Biomek FX P Dual-Hybrid Liquid Handler Illumina TruSeq RNA Access Library Prep Kit Automated on the Biomek FX P Dual-Hybrid Liquid Handler Introduction David Horvath, M.S., Senior Applications Scientist, Beckman Coulter, Inc.; Tim Hill, Scientist,

More information

Introduction to RNA-Seq

Introduction to RNA-Seq Introduction to RNA-Seq Monica Britton, Ph.D. Sr. Bioinformatics Analyst March 2015 Workshop Overview of RNA-Seq Activities RNA-Seq Concepts, Terminology, and Work Flows Using Single-End Reads and a Reference

More information

SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA

SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA The most sensitive cdna synthesis technology, combined with next-generation

More information

SCALABLE, REPRODUCIBLE RNA-Seq

SCALABLE, REPRODUCIBLE RNA-Seq SCALABLE, REPRODUCIBLE RNA-Seq SCALABLE, REPRODUCIBLE RNA-Seq Advances in the RNA sequencing workflow, from sample preparation through data analysis, are enabling deeper and more accurate exploration

More information

RNA-Seq Software, Tools, and Workflows

RNA-Seq Software, Tools, and Workflows RNA-Seq Software, Tools, and Workflows Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 1, 2016 Some mrna-seq Applications Differential gene expression analysis Transcriptional profiling Assumption:

More information

Introduction to Next Generation Sequencing (NGS) Data Analysis and Pathway Analysis. Jenny Wu

Introduction to Next Generation Sequencing (NGS) Data Analysis and Pathway Analysis. Jenny Wu Introduction to Next Generation Sequencing (NGS) Data Analysis and Pathway Analysis Jenny Wu Outline Introduction to NGS data analysis in Cancer Genomics NGS applications in cancer research Typical NGS

More information

Introduction to Microarray Analysis

Introduction to Microarray Analysis Introduction to Microarray Analysis Methods Course: Gene Expression Data Analysis -Day One Rainer Spang Microarrays Highly parallel measurement devices for gene expression levels 1. How does the microarray

More information

Green Center Computational Core ChIP- Seq Pipeline, Just a Click Away

Green Center Computational Core ChIP- Seq Pipeline, Just a Click Away Green Center Computational Core ChIP- Seq Pipeline, Just a Click Away Venkat Malladi Computational Biologist Computational Core Cecil H. and Ida Green Center for Reproductive Biology Science Introduc

More information

Optimization of RNAi Targets on the Human Transcriptome Ahmet Arslan Kurdoglu Computational Biosciences Program Arizona State University

Optimization of RNAi Targets on the Human Transcriptome Ahmet Arslan Kurdoglu Computational Biosciences Program Arizona State University Optimization of RNAi Targets on the Human Transcriptome Ahmet Arslan Kurdoglu Computational Biosciences Program Arizona State University my background Undergraduate Degree computer systems engineer (ASU

More information

Enabling reproducible data analysis for metagenomics. eresearch Africa Conference 2017 Gerrit Botha CBIO H3ABioNet 3 May 2017

Enabling reproducible data analysis for metagenomics. eresearch Africa Conference 2017 Gerrit Botha CBIO H3ABioNet 3 May 2017 Enabling reproducible data analysis for metagenomics eresearch Africa Conference 2017 Gerrit Botha CBIO H3ABioNet 3 May 2017 Outline 16S rrna analysis Current CBIO 16S rrna analysis setup H3ABioNet hackathon

More information

Knowledge-Guided Analysis with KnowEnG Lab

Knowledge-Guided Analysis with KnowEnG Lab Han Sinha Song Weinshilboum Knowledge-Guided Analysis with KnowEnG Lab KnowEnG Center Powerpoint by Charles Blatti Knowledge-Guided Analysis KnowEnG Center 2017 1 Exercise In this exercise we will be doing

More information

Top 5 Lessons Learned From MAQC III/SEQC

Top 5 Lessons Learned From MAQC III/SEQC Top 5 Lessons Learned From MAQC III/SEQC Weida Tong, Ph.D Division of Bioinformatics and Biostatistics, NCTR/FDA Weida.tong@fda.hhs.gov; 870 543 7142 1 MicroArray Quality Control (MAQC) An FDA led community

More information

Biologists on the cloud

Biologists on the cloud Biologists on the cloud our experiences using galaxy for next-gen sequencing analyses Karen Reddy, Johns Hopkins University School of Medicine Mo Heydarian, Johns Hopkins University School of Medicine

More information

Next-Generation Sequencing Services à la carte

Next-Generation Sequencing Services à la carte Next-Generation Sequencing Services à la carte www.seqme.eu ngs@seqme.eu SEQme 2017 All rights reserved The trademarks and names of other companies and products mentioned in this brochure are the property

More information

RNA SEQUINS LABORATORY PROTOCOL

RNA SEQUINS LABORATORY PROTOCOL INSTRUCTIONS FOR ADDITION OF SEQUINS TO RNA SAMPLES (for use with RNA sequins version 2) RNA Sequins are designed, validated and manufactured at the Garvan Institute of Medical Research, Sydney Australia.

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a

More information

RNA-Seq with the Tuxedo Suite

RNA-Seq with the Tuxedo Suite RNA-Seq with the Tuxedo Suite Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 2015 Workshop The Basic Tuxedo Suite References Trapnell C, et al. 2009 TopHat: discovering splice junctions with

More information

RNASEQ WITHOUT A REFERENCE

RNASEQ WITHOUT A REFERENCE RNASEQ WITHOUT A REFERENCE Experimental Design Assembly in Non-Model Organisms And other (hopefully useful) Stuff Meg Staton mstaton1@utk.edu University of Tennessee Knoxville, TN I. Project Design Things

More information

About Strand NGS. Strand Genomics, Inc All rights reserved.

About Strand NGS. Strand Genomics, Inc All rights reserved. About Strand NGS Strand NGS-formerly known as Avadis NGS, is an integrated platform that provides analysis, management and visualization tools for next-generation sequencing data. It supports extensive

More information

RNA SEQUINS LABORATORY PROTOCOL

RNA SEQUINS LABORATORY PROTOCOL INSTRUCTIONS FOR ADDITION OF SEQUINS TO RNA SAMPLES RNA Sequins are designed, validated and manufactured at the Garvan Institute of Medical Research, Sydney Australia. For Research Use Only. Not intended

More information

Introductory Next Gen Workshop

Introductory Next Gen Workshop Introductory Next Gen Workshop http://www.illumina.ucr.edu/ http://www.genomics.ucr.edu/ Workshop Objectives Workshop aimed at those who are new to Illumina sequencing and will provide: - a basic overview

More information

WELCOME. Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS)

WELCOME. Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS) WELCOME Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS) Director, UB Genomics and Bioinformatics Core (GBC) o o o o o o o o o o o o Grow

More information

Exercise1 ArrayExpress Archive - High-throughput sequencing example

Exercise1 ArrayExpress Archive - High-throughput sequencing example ArrayExpress and Atlas practical: querying and exporting gene expression data at the EBI Gabriella Rustici gabry@ebi.ac.uk This practical will introduce you to the data content and query functionality

More information

Genomics and Transcriptomics of Spirodela polyrhiza

Genomics and Transcriptomics of Spirodela polyrhiza Genomics and Transcriptomics of Spirodela polyrhiza Doug Bryant Bioinformatics Core Facility & Todd Mockler Group, Donald Danforth Plant Science Center Desired Outcomes High-quality genomic reference sequence

More information

ChIP-Seq Data Analysis. J Fass UCD Genome Center Bioinformatics Core Wednesday 15 June 2015

ChIP-Seq Data Analysis. J Fass UCD Genome Center Bioinformatics Core Wednesday 15 June 2015 ChIP-Seq Data Analysis J Fass UCD Genome Center Bioinformatics Core Wednesday 15 June 2015 What s the Question? Where do Transcription Factors (TFs) bind genomic DNA 1? (Where do other things bind DNA

More information

De novo metatranscriptome assembly and coral gene expression profile of Montipora capitata with growth anomaly

De novo metatranscriptome assembly and coral gene expression profile of Montipora capitata with growth anomaly Additional File 1 De novo metatranscriptome assembly and coral gene expression profile of Montipora capitata with growth anomaly Monika Frazier, Martin Helmkampf, M. Renee Bellinger, Scott Geib, Misaki

More information

Analysis of Microarray Data

Analysis of Microarray Data Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review

More information

Science as a Service Accelerating Scientific Discovery using Cloud

Science as a Service Accelerating Scientific Discovery using Cloud Science as a Service Accelerating Scientific Discovery using Cloud Ravi Madduri madduri@anl.gov Internet2 Global Summit 2016, Chicago Outline Scientific Discovery Process The Case for Cloud Science as

More information

NOW GENERATION SEQUENCING. Monday, December 5, 11

NOW GENERATION SEQUENCING. Monday, December 5, 11 NOW GENERATION SEQUENCING 1 SEQUENCING TIMELINE 1953: Structure of DNA 1975: Sanger method for sequencing 1985: Human Genome Sequencing Project begins 1990s: Clinical sequencing begins 1998: NHGRI $1000

More information

Laboratory Management for Clinical and Research NGS Labs

Laboratory Management for Clinical and Research NGS Labs Laboratory Management for Clinical and Research NGS Labs Introduction Few can argue that Next Generation Sequencing is having a major impact on genomics research. The progress in this field exceeds even

More information

Welcome to the NGS webinar series

Welcome to the NGS webinar series Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic

More information

1000 Insect Transcriptomes Evolution - 1KITE

1000 Insect Transcriptomes Evolution - 1KITE 1KITE 1K Insect Transcriptome Evolution 1000 Insect Transcriptomes Evolution - 1KITE An Example of Handling "Big Data" Karen Meusemann, on behalf of the 1KITE Consortium CSIRO Ecosystem Sciences, Australian

More information

RNA Seq: Methods and Applica6ons. Prat Thiru

RNA Seq: Methods and Applica6ons. Prat Thiru RNA Seq: Methods and Applica6ons Prat Thiru 1 Outline Intro to RNA Seq Biological Ques6ons Comparison with Other Methods RNA Seq Protocol RNA Seq Applica6ons Annota6on Quan6fica6on Other Applica6ons Expression

More information

RNA-Seq Workshop AChemS Sunil K Sukumaran Monell Chemical Senses Center Philadelphia

RNA-Seq Workshop AChemS Sunil K Sukumaran Monell Chemical Senses Center Philadelphia RNA-Seq Workshop AChemS 2017 Sunil K Sukumaran Monell Chemical Senses Center Philadelphia Benefits & downsides of RNA-Seq Benefits: High resolution, sensitivity and large dynamic range Independent of prior

More information

Introduction to RNA sequencing

Introduction to RNA sequencing Introduction to RNA sequencing Bioinformatics perspective Olga Dethlefsen NBIS, National Bioinformatics Infrastructure Sweden November 2017 Olga (NBIS) RNA-seq November 2017 1 / 49 Outline Why sequence

More information

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS

More information

Course Overview: Mutation Detection Using Massively Parallel Sequencing

Course Overview: Mutation Detection Using Massively Parallel Sequencing Course Overview: Mutation Detection Using Massively Parallel Sequencing From Data Generation to Variant Annotation Eliot Shearer The Iowa Initiative in Human Genetics Bioinformatics Short Course 2012 August

More information

Outline. Annotation of Drosophila Primer. Gene structure nomenclature. Muller element nomenclature. GEP Drosophila annotation projects 01/04/2018

Outline. Annotation of Drosophila Primer. Gene structure nomenclature. Muller element nomenclature. GEP Drosophila annotation projects 01/04/2018 Outline Overview of the GEP annotation projects Annotation of Drosophila Primer January 2018 GEP annotation workflow Practice applying the GEP annotation strategy Wilson Leung and Chris Shaffer AAACAACAATCATAAATAGAGGAAGTTTTCGGAATATACGATAAGTGAAATATCGTTCT

More information

Intermediate RNA-Seq Tips, Tricks and Non-Human Organisms

Intermediate RNA-Seq Tips, Tricks and Non-Human Organisms Intermediate RNA-Seq Tips, Tricks and Non-Human Organisms Kevin Silverstein PhD, John Garbe PhD and Ying Zhang PhD, Research Informatics Support System (RISS) MSI September 25, 2014 Slides available at

More information

Gene Expression Analysis Superior Solutions for any Project

Gene Expression Analysis Superior Solutions for any Project Gene Expression Analysis Superior Solutions for any Project Find Your Perfect Match ArrayXS Global Array-to-Go Focussed Comprehensive: detect the whole transcriptome reliably Certified: discover exceptional

More information

RNA-Sequencing analysis

RNA-Sequencing analysis RNA-Sequencing analysis Markus Kreuz 25. 04. 2012 Institut für Medizinische Informatik, Statistik und Epidemiologie Content: Biological background Overview transcriptomics RNA-Seq RNA-Seq technology Challenges

More information

Introducing a Highly Integrated Approach to Translational Research: Biomarker Data Management, Data Integration, and Collaboration

Introducing a Highly Integrated Approach to Translational Research: Biomarker Data Management, Data Integration, and Collaboration Introducing a Highly Integrated Approach to Translational Research: Biomarker Data Management, Data Integration, and Collaboration 1 2 Translational Informatics Overview Precision s suite of services is

More information

Introduction to EMBL-EBI.

Introduction to EMBL-EBI. Introduction to EMBL-EBI www.ebi.ac.uk What is EMBL-EBI? Part of EMBL Austria, Belgium, Croatia, Denmark, Finland, France, Germany, Greece, Iceland, Ireland, Israel, Italy, Luxembourg, the Netherlands,

More information

Next-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX

Next-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX Next-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX Technical Overview Introduction RNA Sequencing (RNA-Seq) is one of the most commonly used next-generation sequencing (NGS)

More information

Analysing genomes and transcriptomes using Illumina sequencing

Analysing genomes and transcriptomes using Illumina sequencing Analysing genomes and transcriptomes using Illumina uencing Dr. Heinz Himmelbauer Centre for Genomic Regulation (CRG) Ultrauencing Unit Barcelona The Sequencing Revolution High-Throughput Sequencing 2000

More information

Analysis of Differential Gene Expression in Cattle Using mrna-seq

Analysis of Differential Gene Expression in Cattle Using mrna-seq Analysis of Differential Gene Expression in Cattle Using mrna-seq mrna-seq A rough guide for green horns Animal and Grassland Research and Innovation Centre Animal and Bioscience Research Department Teagasc,

More information

Introduction to genome biology

Introduction to genome biology Introduction to genome biology Lisa Stubbs We ve found most genes; but what about the rest of the genome? Genome size* 12 Mb 95 Mb 170 Mb 1500 Mb 2700 Mb 3200 Mb #coding genes ~7000 ~20000 ~14000 ~26000

More information

Mapping strategies for sequence reads

Mapping strategies for sequence reads Mapping strategies for sequence reads Ernest Turro University of Cambridge 21 Oct 2013 Quantification A basic aim in genomics is working out the contents of a biological sample. 1. What distinct elements

More information

DNA. bioinformatics. epigenetics methylation structural variation. custom. assembly. gene. tumor-normal. mendelian. BS-seq. prediction.

DNA. bioinformatics. epigenetics methylation structural variation. custom. assembly. gene. tumor-normal. mendelian. BS-seq. prediction. Epigenomics T TM activation SNP target ncrna validation metagenomics genetics private RRBS-seq de novo trio RIP-seq exome mendelian comparative genomics DNA NGS ChIP-seq bioinformatics assembly tumor-normal

More information

Do engineered ips and ES cells have similar molecular signatures?

Do engineered ips and ES cells have similar molecular signatures? Do engineered ips and ES cells have similar molecular signatures? Comparing expression and epigenetics in stem cells George Bell, Ph.D. Bioinformatics and Research Computing 2012 Spring Lecture Series

More information

CDC s Advanced Molecular Detection (AMD) Sequence Data Analysis and Management

CDC s Advanced Molecular Detection (AMD) Sequence Data Analysis and Management CDC s Advanced Molecular Detection (AMD) Sequence Data Analysis and Management Scott Sammons Technology Officer Office of Advanced Molecular Detection National Center for Emerging and Zoonotic Infectious

More information

Measuring transcriptomes with RNA-Seq. BMI/CS 776 Spring 2016 Anthony Gitter

Measuring transcriptomes with RNA-Seq. BMI/CS 776  Spring 2016 Anthony Gitter Measuring transcriptomes with RNA-Seq BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2016 Anthony Gitter gitter@biostat.wisc.edu Overview RNA-Seq technology The RNA-Seq quantification problem Generative

More information

Single Cell Genomics

Single Cell Genomics Single Cell Genomics Application Cost Platform/Protoc ol Note Single cell 3 mrna-seq cell lysis/rt/library prep $2460/Sample 10X Genomics Chromium 500-10,000 cells/sample Single cell 5 V(D)J mrna-seq cell

More information

Differential gene expression analysis using RNA-seq

Differential gene expression analysis using RNA-seq https://abc.med.cornell.edu/ Differential gene expression analysis using RNA-seq Applied Bioinformatics Core, August 2017 Friederike Dündar with Luce Skrabanek & Ceyda Durmaz Day 1: Introduction into high-throughput

More information

Shuji Shigenobu. April 3, 2013 Illumina Webinar Series

Shuji Shigenobu. April 3, 2013 Illumina Webinar Series Shuji Shigenobu April 3, 2013 Illumina Webinar Series RNA-seq RNA-seq is a revolutionary tool for transcriptomics using deepsequencing technologies. genome HiSeq2000@NIBB (Wang 2009 with modifications)

More information

Post-assembly Data Analysis

Post-assembly Data Analysis Assembled transcriptome Post-assembly Data Analysis Quantification: the expression level of each gene in each sample DE genes: genes differentially expressed between samples Clustering/network analysis

More information

RADSeq Data Analysis. Through STACKS on Galaxy. Yvan Le Bras Anthony Bretaudeau Cyril Monjeaud Gildas Le Corguillé

RADSeq Data Analysis. Through STACKS on Galaxy. Yvan Le Bras Anthony Bretaudeau Cyril Monjeaud Gildas Le Corguillé RADSeq Data Analysis Through STACKS on Galaxy Yvan Le Bras Anthony Bretaudeau Cyril Monjeaud Gildas Le Corguillé RAD sequencing: next-generation tools for an old problem INTRODUCTION source: Karim Gharbi

More information

Machine Learning Methods for RNA-seq-based Transcriptome Reconstruction

Machine Learning Methods for RNA-seq-based Transcriptome Reconstruction Machine Learning Methods for RNA-seq-based Transcriptome Reconstruction Gunnar Rätsch Friedrich Miescher Laboratory Max Planck Society, Tübingen, Germany NGS Bioinformatics Meeting, Paris (March 24, 2010)

More information

ProteoGenomics in Galaxy: Identifying novel constellations of proteoforms using transcriptomic and proteomic data.

ProteoGenomics in Galaxy: Identifying novel constellations of proteoforms using transcriptomic and proteomic data. ProteoGenomics in Galaxy: Identifying novel constellations of proteoforms using transcriptomic and proteomic data. Galaxy Community Conference (GCC 2016) Bloomington, IN 28 th June 2016 PRATIK JAGTAP Center

More information

Bioinformatics Advice on Experimental Design

Bioinformatics Advice on Experimental Design Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics

More information

Bioinformatics Analysis of Nano-based Omics Data

Bioinformatics Analysis of Nano-based Omics Data Bioinformatics Analysis of Nano-based Omics Data Penny Nymark, Pekka Kohonen, Vesa Hongisto and Roland Grafström Hands-on Workshop on Nano Safety Assessment, 29 th September, 2016, National Technical University

More information

When Flow Met SharePoint: A Story of Integration and Automation

When Flow Met SharePoint: A Story of Integration and Automation When Flow Met SharePoint: A Story of Integration and Automation WithumSmith+Brown, PC BE IN A POSITION OF STRENGTH 1 ABOUT ME - @melihubb Microsoft MVP Office 365 and SharePoint consultant who specializes

More information

Fundamentals of Clinical Genomics

Fundamentals of Clinical Genomics Fundamentals of Clinical Genomics Wellcome Genome Campus Hinxton, Cambridge, UK 17-19 January 2018 Lectures and Workshops to be held in the Rosalind Franklin Pavilion Lunch and Dinner to be held in the

More information

Next Generation Bioinformatics on the Cloud

Next Generation Bioinformatics on the Cloud Next Generation Bioinformatics on the Cloud http://www.easygenomics.com Sifei He Director of BGI Cloud hesifei@genomics.cn Xing Xu, Ph.D Senior Product Manager EasyGenomics BGI xuxing@genomics.cn Contact

More information

Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro

Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro Philip Morris International R&D, Philip Morris Products S.A., Neuchatel, Switzerland Introduction Nicotiana sylvestris

More information

Gene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays

Gene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays Gene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays Application Note Authors Bahram Arezi, Nilanjan Guha and Anne Bergstrom Lucas Agilent Technologies Inc. Santa

More information

Data Analysis with CASAVA v1.8 and the MiSeq Reporter

Data Analysis with CASAVA v1.8 and the MiSeq Reporter Data Analysis with CASAVA v1.8 and the MiSeq Reporter Eric Smith, PhD Bioinformatics Scientist September 15 th, 2011 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense

More information

Incorporating Molecular ID Technology. Accel-NGS 2S MID Indexing Kits

Incorporating Molecular ID Technology. Accel-NGS 2S MID Indexing Kits Incorporating Molecular ID Technology Accel-NGS 2S MID Indexing Kits Molecular Identifiers (MIDs) MIDs are indices used to label unique library molecules MIDs can assess duplicate molecules in sequencing

More information

RNA Sequencing Analyses & Mapping Uncertainty

RNA Sequencing Analyses & Mapping Uncertainty RNA Sequencing Analyses & Mapping Uncertainty Adam McDermaid 1/26 RNA-seq Pipelines Collection of tools for analyzing raw RNA-seq data Tier 1 Quality Check Data Trimming Tier 2 Read Alignment Assembly

More information

Illumina Bio-Rad Single Cell Sequencing For Research Use Only. Not for use in diagnostic procedures.

Illumina Bio-Rad Single Cell Sequencing For Research Use Only. Not for use in diagnostic procedures. Illumina Bio-Rad Single Cell Sequencing 2016 Illumina, Inc. All rights reserved. Illumina, 24sure, BaseSpace, BeadArray, BlueFish, BlueFuse, BlueGnome, cbot, CSPro, CytoChip, DesignStudio, Epicentre, ForenSeq,

More information

A step-by-step guide to ChIP-seq data analysis

A step-by-step guide to ChIP-seq data analysis A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D. EMBL-European Bioinformatics Institute Wellcome Trust Sanger Institute Target audience Wet-lab biologists with no experience

More information

System Biology and Immune Response

System Biology and Immune Response System Biology and Immune Response Fondation Mérieux Conference Centre Les Pensières Veyrier-du-Lac - France June 21-23, 2010 Steering Committee: Nicolas BURDIN Bruno GUY Michael KATZE Jacques LOUIS Ray

More information

Demo of mrna NGS Concluding Report

Demo of mrna NGS Concluding Report Demo of mrna NGS Concluding Report Project: Demo Report Customer: Dr. Demo Company/Institute: Exiqon AS Date: 09-Mar-2015 Performed by Exiqon A/S Company Reg.No.(CVR) 18 98 44 31 Skelstedet 16 DK-2950,

More information

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript NIH Public Access Author Manuscript Published in final edited form as: Nat Protoc. ; 7(3): 562 578. doi:10.1038/nprot.2012.016. Differential gene and transcript expression analysis of RNA-seq experiments

More information

Advanced Bioinformatics Biostatistics & Medical Informatics 776 Computer Sciences 776 Spring 2018

Advanced Bioinformatics Biostatistics & Medical Informatics 776 Computer Sciences 776 Spring 2018 Advanced Bioinformatics Biostatistics & Medical Informatics 776 Computer Sciences 776 Spring 2018 Anthony Gitter gitter@biostat.wisc.edu www.biostat.wisc.edu/bmi776/ These slides, excluding third-party

More information

From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow

From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow Technical Overview Import VCF Introduction Next-generation sequencing (NGS) studies have created unanticipated challenges with

More information

B&DA Committee Bioinformatics and Data Analysis. PAG January 2016

B&DA Committee Bioinformatics and Data Analysis. PAG January 2016 B&DA Committee Bioinformatics and Data Analysis PAG January 2016 B&DA progress so far Aim: to define standard bfx pipelines for FAANG data Group has skyped many times We have a Wiki: hosted by EBI Sub-groups

More information

Base Composition of Sequencing Reads of Chromium Single Cell 3 v2 Libraries

Base Composition of Sequencing Reads of Chromium Single Cell 3 v2 Libraries TECHNICAL NOTE Base Composition of Sequencing Reads of Chromium Single Cell 3 v2 Libraries INTRODUCTION The Chromium Single Cell 3 v2 Protocol (CG00052) produces Single Cell 3 libraries, ready for Illumina

More information

Haploid Assembly of Diploid Genomes

Haploid Assembly of Diploid Genomes Haploid Assembly of Diploid Genomes Challenges, Trials, Tribulations 13 October 2011 İnanç Birol Assembly By Short Sequencing IEEE InfoVis 2009 2 3 in Literature ~40 citations on tool comparisons ~20 citations

More information

ACCELERATING GENOMIC ANALYSIS ON THE CLOUD. Enabling the PanCancer Analysis of Whole Genomes (PCAWG) consortia to analyze thousands of genomes

ACCELERATING GENOMIC ANALYSIS ON THE CLOUD. Enabling the PanCancer Analysis of Whole Genomes (PCAWG) consortia to analyze thousands of genomes ACCELERATING GENOMIC ANALYSIS ON THE CLOUD Enabling the PanCancer Analysis of Whole Genomes (PCAWG) consortia to analyze thousands of genomes Enabling the PanCancer Analysis of Whole Genomes (PCAWG) consortia

More information

Networking materials data

Networking materials data Networking materials data Ian Foster foster@anl.gov ianfoster.org Materials Genome Initiative Materials Innovation Infrastructure A data sharing system to facilitate: Use of a broader set of data to render

More information

A comprehensive assessment of RNA-seq accuracy, reproducibility and information content by the Sequencing Quality Control Consortium

A comprehensive assessment of RNA-seq accuracy, reproducibility and information content by the Sequencing Quality Control Consortium A comprehensive assessment of RNA-seq accuracy, reproducibility and information content by the Sequencing Quality Control Consortium SEQC/MAQC-III Consortium* 214 Nature America, Inc. All rights reserved.

More information

Measuring transcriptomes with RNA-Seq

Measuring transcriptomes with RNA-Seq Measuring transcriptomes with RNA-Seq BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2017 Anthony Gitter gitter@biostat.wisc.edu These slides, excluding third-party material, are licensed under CC BY-NC

More information

Corset: enabling differential gene expression analysis for de novo assembled transcriptomes

Corset: enabling differential gene expression analysis for de novo assembled transcriptomes Davidson and Oshlack Genome Biology 2014, 15:410 METHOD Open Access : enabling differential gene expression analysis for de novo assembled transcriptomes Nadia M Davidson 1 and Alicia Oshlack 1,2* Abstract

More information

less sensitive than RNA-seq but more robust analysis pipelines expensive but quantitiatve standard but typically not high throughput

less sensitive than RNA-seq but more robust analysis pipelines expensive but quantitiatve standard but typically not high throughput Chapter 11: Gene Expression The availability of an annotated genome sequence enables massively parallel analysis of gene expression. The expression of all genes in an organism can be measured in one experiment.

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Richard Corbett Canada s Michael Smith Genome Sciences Centre Vancouver, British Columbia June 28, 2017 Our mandate is to advance knowledge about cancer and other diseases

More information

BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers

BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html UCSC

More information

Introduction. Highlights. Prepare Library Sequence Analyze Data

Introduction. Highlights. Prepare Library Sequence Analyze Data BaseSpace Sequence Hub Genomics cloud computing expands opportunities for biological discovery, making analysis and storage of next-generation sequencing data accessible to any scientist. Highlights Centralized

More information

March 20-23, 2010 Sacramento, CA

March 20-23, 2010 Sacramento, CA Comparison of Commercially Available Target Enrichment Methods for Next Generation Sequencing with the Illumina Platform March 20-23, 2010 Sacramento, CA Anoja Perera, Scottie Adams, David Bintzler, Kip

More information