Direct RNA sequencing of human transcripts using the Oxford Nanopore sequencing platform. Rachael Workman The Nanopore RNA Consortium AGBT 2018
|
|
- Laureen Chase
- 6 years ago
- Views:
Transcription
1 Direct RNA sequencing of human transcripts using the Oxford Nanopore sequencing platform Rachael Workman The Nanopore RNA Consortium AGBT 2018
2 Direct RNA sequencing opens new frontiers for transcriptome exploration Analyse isoforms directly Poly-A length assessment RNA modifications PCR-free system 2
3 Nanopore RNA consortium Six participating Universities Johns Hopkins University University of Birmingham University of California Santa Cruz University of British Columbia Ontario Institute for Cancer Research University of Nottingham Isolated native poly-a RNA from GM12878 CEPH cell line, sequenced direct RNA and amplified cdna Spiked-in synthetic RNA molecules* *SIRVs: Lexogen SIRV Set 3, ERCCs + 69 SIRV Isoforms 3
4 How much data did we generate? 13 million Direct RNA sequences, 30 flow cells >24 million cdna sequences, 12 flow cells 4
5 Long read RNA can now be sequenced directly with ONT PolyA+ RNA captured Splint poly-t adapter ligation Reverse transcription (optional) Sequencing adapter ligation Motor Protein Tether 5
6 Long read RNA can now be sequenced directly with ONT PolyA+ RNA captured Splint poly-t adapter ligation Reverse transcription (optional) Sequencing adapter ligation Motor Protein Tether Raw Current Signal 6
7 GM12878 DIRECT RNA DATA DESCRIPTION
8 drna reads show good alignment to GENCODE reference 10.8M aligned RNA reads 87% read identity 83% aligned 85% mean query coverage Alignment to GENCODE V27 dataset performed using Minimap2: 8
9 Correlation in gene-level abundance between RNA vs. ONT cdna, Illumina ENCODE Illumina dataset, Wold Lab: 9
10 SIRV gene level quantification tracks expected input well 10
11 Quantification complicated at isoform level Isoform level quantification complicated by read error, multi-mapping, 5 degradation 0 SIRV101 SIRV102 SIRV103 SIRV105 SIRV106 SIRV107 SIRV109 11
12 UNIQUE BENEFITS OF DIRECT RNA SEQUENCING 1. LONG READS PROVIDE EXON CONNECTIVITY WITHOUT PCR BIAS
13 Long RNA reads provide exon connectivity Example RNA reads capture several isoforms of VEGFA gene Vascular endothelial growth factor A: stimulates blood vessel formation Custom track for UCSC browser, Courtesy of Heng Li: 13
14 2. POLYA TAIL LENGTHS CAN BE ESTIMATED Image courtesy of: Fdardel
15 Ionic current dwell time can be used to estimate poly-a tail lengths Current (pa) (Poly-A) Raw data 3 khz Predicting poly-a sequence length becomes tractable when consistent structural regions of drna reads can be identified and separated PolyA estimator (under development): 15
16 Poly-A tail lengths for GM12878 and SIRVs consistent with expected density Poly A tail length estimated (nt) Poly-A tail lengths in humans expected nt SIRV polya tails expected 20-30nt PolyA estimator (under development): 16
17 3. RNA MODIFICATIONS CAN BE DETECTED
18 Antibody pulldown Chemical labeling Direct sequencing Direct sequencing of RNA mods can supplement existing modification Transcriptome-wide modification mapping detection approaches Functional study Splicing Translation Structure Stability Transport Modified from: Xiong Gen Prot Bio
19 Detection of RNA modifications possible with IVT spike ins Current distributions (pa) m6a: 0 m6a: % ma 0% ma ACCGG CCGGG CGGGA GGGAA k-mer GGAAA GAAAA NEB HiScribe TM T7 High Yield RNA Synthesis kit 19
20 CONCLUSIONS AND FUTURE DIRECTIONS
21 Conclusions and Future Directions Nanopore direct RNA sequencing is a promising technology for the simultaneous assessment of isoform structure and features of interest Unique information in this dataset can be used to improve human reference transcriptome RNA modification training expansion to include simultaneous detection of multiple mods Dezi et al, Biochem Soc Trans
22 Acknowledgements British Columbia Toronto Birmingham Nottingham Birmingham Nick Loman Josh Quick Andrew Beggs Jaqueline Goes de Jesus Nottingham Matt Loose Nadine Holmes Matthew Carlile Santa Cruz Mark Akeson Hugh Olsen Benedict Paten Angela Brooks Miten Jain Santa Cruz Johns Hopkins British Columbia Terry Snutch John Tyson 22 Nanopore Community Meeting #NanoporeConf Johns Hopkins Winston Timp Rachael Workman Timothy Gilpatrick Norah Sadowski Toronto (OICR) Jared Simpson Phil Zuzarte Paul Tang ONT Daniel Garalde Daniel Jachimowicz Andy Heron Rosemary Dokos
RNA spike-in controls & analysis methods for trustworthy genome-scale measurements
RNA spike-in controls & analysis methods for trustworthy genome-scale measurements Sarah A. Munro, Ph.D. Genome-Scale Measurements Group ABRF Meeting March 29, 2015 Overview External RNA Controls Consortium
More informationSMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA
SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA The most sensitive cdna synthesis technology, combined with next-generation
More informationAUDREY FARBOS JEREMIE POSCHMANN PAUL O NEILL KONRAD PASZKIEWICZ KAREN MOORE
We provide: AUDREY FARBOS JEREMIE POSCHMANN PAUL O NEILL KONRAD PASZKIEWICZ KAREN MOORE State of the art genomics and bioinformatics analysis Training in experimental techniques, analysis and modelling
More informationIntroduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013
Introduction to RNA-Seq David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Abundance RNA is... Diverse Dynamic Central DNA rrna Epigenetics trna RNA mrna Time Protein Abundance
More informationRNA-Sequencing analysis
RNA-Sequencing analysis Markus Kreuz 25. 04. 2012 Institut für Medizinische Informatik, Statistik und Epidemiologie Content: Biological background Overview transcriptomics RNA-Seq RNA-Seq technology Challenges
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationNext Gen Sequencing. Expansion of sequencing technology. Contents
Next Gen Sequencing Contents 1 Expansion of sequencing technology 2 The Next Generation of Sequencing: High-Throughput Technologies 3 High Throughput Sequencing Applied to Genome Sequencing (TEDed CC BY-NC-ND
More informationThemes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
More informationReading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction
Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationPrimePCR Assay Validation Report
Gene Information Gene Name SRY (sex determining region Y)-box 6 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SOX6 Human This gene encodes a member of the
More informationFunctional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017
Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Agenda What is Functional Genomics? RNA Transcription/Gene Expression Measuring Gene
More informationRNA-Seq with the Tuxedo Suite
RNA-Seq with the Tuxedo Suite Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 2015 Workshop The Basic Tuxedo Suite References Trapnell C, et al. 2009 TopHat: discovering splice junctions with
More information2/5/16. Honeypot Ants. DNA sequencing, Transcriptomics and Genomics. Gene sequence changes? And/or gene expression changes?
2/5/16 DNA sequencing, Transcriptomics and Genomics Honeypot Ants "nequacatl" BY2208, Mani Lecture 3 Gene sequence changes? And/or gene expression changes? gene expression differences DNA sequencing, Transcriptomics
More informationDNA makes RNA makes Proteins. The Central Dogma
DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION
More informationPrimePCR Assay Validation Report
Gene Information Gene Name laminin, beta 3 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID LAMB3 Human The product encoded by this gene is a laminin that
More informationIntroduction to Bioinformatics and Gene Expression Technologies
Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a
More informationINTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationComplete Sample to Analysis Solutions for DNA Methylation Discovery using Next Generation Sequencing
Complete Sample to Analysis Solutions for DNA Methylation Discovery using Next Generation Sequencing SureSelect Human/Mouse Methyl-Seq Kyeong Jeong PhD February 5, 2013 CAG EMEAI DGG/GSD/GFO Agilent Restricted
More informationWhole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist
Whole Transcriptome Analysis of Illumina RNA- Seq Data Ryan Peters Field Application Specialist Partek GS in your NGS Pipeline Your Start-to-Finish Solution for Analysis of Next Generation Sequencing Data
More informationPrimePCR Assay Validation Report
Gene Information Gene Name collagen, type IV, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID COL4A1 Human This gene encodes the major type IV alpha
More informationuser s guide Question 3
Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.
More informationControl of Eukaryotic Genes. AP Biology
Control of Eukaryotic Genes The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions? Evolution
More informationDNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI)
DNA-Sequencing Technologies & Devices Matthias Platzer Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI) Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day,
More informationChIP-seq/Functional Genomics/Epigenomics. CBSU/3CPG/CVG Next-Gen Sequencing Workshop. Josh Waterfall. March 31, 2010
ChIP-seq/Functional Genomics/Epigenomics CBSU/3CPG/CVG Next-Gen Sequencing Workshop Josh Waterfall March 31, 2010 Outline Introduction to ChIP-seq Control data sets Peak/enriched region identification
More informationWednesday, November 22, 17. Exons and Introns
Exons and Introns Introns and Exons Exons: coded regions of DNA that get transcribed and translated into proteins make up 5% of the genome Introns and Exons Introns: non-coded regions of DNA Must be removed
More informationDNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI)
DNA-Sequencing Technologies & Devices Matthias Platzer Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI) Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day,
More informationGene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays
Gene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays Application Note Authors Bahram Arezi, Nilanjan Guha and Anne Bergstrom Lucas Agilent Technologies Inc. Santa
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin)
More informationAnalysis of Differential Gene Expression in Cattle Using mrna-seq
Analysis of Differential Gene Expression in Cattle Using mrna-seq mrna-seq A rough guide for green horns Animal and Grassland Research and Innovation Centre Animal and Bioscience Research Department Teagasc,
More information3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
More informationPrimePCR Assay Validation Report
Gene Information Gene Name transforming growth factor, beta 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID TGFB1 Human This gene encodes a member of the
More informationmeasuring gene expression December 5, 2017
measuring gene expression December 5, 2017 transcription a usually short-lived RNA copy of the DNA is created through transcription RNA is exported to the cytoplasm to encode proteins some types of RNA
More informationresequencing storage SNP ncrna metagenomics private trio de novo exome ncrna RNA DNA bioinformatics RNA-seq comparative genomics
RNA Sequencing T TM variation genetics validation SNP ncrna metagenomics private trio de novo exome mendelian ChIP-seq RNA DNA bioinformatics custom target high-throughput resequencing storage ncrna comparative
More informationRNA-Seq Workshop AChemS Sunil K Sukumaran Monell Chemical Senses Center Philadelphia
RNA-Seq Workshop AChemS 2017 Sunil K Sukumaran Monell Chemical Senses Center Philadelphia Benefits & downsides of RNA-Seq Benefits: High resolution, sensitivity and large dynamic range Independent of prior
More informationMapping strategies for sequence reads
Mapping strategies for sequence reads Ernest Turro University of Cambridge 21 Oct 2013 Quantification A basic aim in genomics is working out the contents of a biological sample. 1. What distinct elements
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationSynthetic Biology. Sustainable Energy. Therapeutics Industrial Enzymes. Agriculture. Accelerating Discoveries, Expanding Possibilities. Design.
Synthetic Biology Accelerating Discoveries, Expanding Possibilities Sustainable Energy Therapeutics Industrial Enzymes Agriculture Design Build Generate Solutions to Advance Synthetic Biology Research
More informationAssay Standards Working Group Nov 2012 Assay Standards Working Group Recommendations, November 2012
Assay Standards Working Group Recommendations, November 2012 Contents Assay Standards Working Group Recommendations, August 2012... 1 Contents... 1 Introduction... 2 1: Reference Epigenome Criteria...
More informationRoche Molecular Biochemicals Technical Note No. LC 10/2000
Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce
More informationProtein Synthesis Notes
Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription
More informationGene Regulation Solutions. Microarrays and Next-Generation Sequencing
Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene
More informationHigh Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Monday September 15, 2014
High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Monday September 15, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion
More informationGenome annotation. Erwin Datema (2011) Sandra Smit (2012, 2013)
Genome annotation Erwin Datema (2011) Sandra Smit (2012, 2013) Genome annotation AGACAAAGATCCGCTAAATTAAATCTGGACTTCACATATTGAAGTGATATCACACGTTTCTCTAAT AATCTCCTCACAATATTATGTTTGGGATGAACTTGTCGTGATTTGCCATTGTAGCAATCACTTGAA
More informationFatchiyah
Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing
More informationWelcome to the NGS webinar series
Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Richard Corbett Canada s Michael Smith Genome Sciences Centre Vancouver, British Columbia June 28, 2017 Our mandate is to advance knowledge about cancer and other diseases
More informationIntroduction to the UCSC genome browser
Introduction to the UCSC genome browser Dominik Beck NHMRC Peter Doherty and CINSW ECR Fellow, Senior Lecturer Lowy Cancer Research Centre, UNSW and Centre for Health Technology, UTS SYDNEY NSW AUSTRALIA
More informationMolecular Genetics II - Genetic Engineering Course (Supplementary notes)
1 von 12 21.02.2015 15:13 Molecular Genetics II - Genetic Engineering Course (Supplementary notes) Figures showing examples of cdna synthesis (currently 11 figures) cdna is a DNA copy synthesized from
More informationTaqMan Advanced mirna Assays
PRODUCT BULLETIN TaqMan Advanced mirna Assays TaqMan Advanced mirna Assays Key features Universal reverse transcription (RT) one RT step for all Applied Biosystems TaqMan Advanced mirna Assays Sensitive
More informationControl of Eukaryotic Genes
Control of Eukaryotic Genes 2007-2008 The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions?
More informationControl of Eukaryotic Gene Expression (Learning Objectives)
Control of Eukaryotic Gene Expression (Learning Objectives) 1. Compare and contrast chromatin and chromosome: composition, proteins involved and level of packing. Explain the structure and function of
More informationQIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd
QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s
More informationRNAseq Differential Gene Expression Analysis Report
RNAseq Differential Gene Expression Analysis Report Customer Name: Institute/Company: Project: NGS Data: Bioinformatics Service: IlluminaHiSeq2500 2x126bp PE Differential gene expression analysis Sample
More informationCASE-STUDY- VALIDATION of PCR based methodology. Beata Surmacz-Cordle Senior Analytical Development Scientist
CASE-STUDY- VALIDATION of PCR based methodology Beata Surmacz-Cordle Senior Analytical Development Scientist UK RMP Pluripotent Stem Cell Platform Validation Workshop 2 nd June 2016 RT-qPCR assay for detection
More informationConsiderations for Illumina library preparation. Henriette O Geen June 20, 2014 UCD Genome Center
Considerations for Illumina library preparation Henriette O Geen June 20, 2014 UCD Genome Center Diversity of applications De novo genome Sequencing ranscriptome Expression Splice Isoform bundance Genotyping
More informationResearch school methods seminar Genomics and Transcriptomics
Research school methods seminar Genomics and Transcriptomics Stephan Klee 19.11.2014 2 3 4 5 Genetics, Genomics what are we talking about? Genetics and Genomics Study of genes Role of genes in inheritence
More informationOptimized, chemically-modified crrna:tracrrna complexes for CRISPR gene editing
Optimized, chemically-modified crrna:tracrrna complexes for CRISPR gene editing Mark Behlke MD, PhD Chief Scientific Officer February 24, 2016 1 Implementing CRISPR/Cas9 gene editing 2 To focus on RNA
More informationCHEM 4420 Exam I Spring 2013 Page 1 of 6
CHEM 4420 Exam I Spring 2013 Page 1 of 6 Name Use complete sentences when requested. There are 100 possible points on this exam. The multiple choice questions are worth 2 points each. All other questions
More informationAssessing De-Novo Transcriptome Assemblies
Assessing De-Novo Transcriptome Assemblies Shawn T. O Neil Center for Genome Research and Biocomputing Oregon State University Scott J. Emrich University of Notre Dame 100K Contigs, Perfect 1M Contigs,
More informationCM581A2: NEXT GENERATION SEQUENCING PLATFORMS AND LIBRARY GENERATION
CM581A2: NEXT GENERATION SEQUENCING PLATFORMS AND LIBRARY GENERATION Fall 2015 Instructors: Coordinator: Carol Wilusz, Associate Professor MIP, CMB Instructor: Dan Sloan, Assistant Professor, Biology,
More informationAlternative Cleavage and Polyadenylation of RNA
Developmental Cell 18 Supplemental Information The Spen Family Protein FPA Controls Alternative Cleavage and Polyadenylation of RNA Csaba Hornyik, Lionel C. Terzi, and Gordon G. Simpson Figure S1, related
More informationComputational Biology I LSM5191 (2003/4)
Computational Biology I LSM5191 (2003/4) Aylwin Ng, D.Phil Lecture Notes: Transcriptome: Molecular Biology of Gene Expression I Flow of information: DNA to polypeptide DNA Start Exon1 Intron Exon2 Termination
More informationAntisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression
Vol. 1:7-15 Antisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression Ji, Tom, Lu, Aneka, Wu, Kaylee Department of Microbiology and Immunology, University of British Columbia
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More informationUser Guide. SIRV-Set 2. SIRV-Set 3. Spike-In RNA Variant Controls. Spike-In RNA Variant Controls with Isoforms (Iso Mix E0)
Spike-In RNA Variant Controls SIRV-Set 2 Spike-In RNA Variant Controls with Isoforms (Iso Mix E0) SIRV-Set 3 Spike-In RNA Variant Controls with Isoforms and ERCCs (Iso Mix E0 / ERCC) User Guide Catalog
More informationUnit IX Problem 3 Genetics: Basic Concepts in Molecular Biology
Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated to synthesize
More informationBio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
More informationExpression Array System
Integrated Science for Gene Expression Applied Biosystems Expression Array System Expression Array System SEE MORE GENES The most complete, most sensitive system for whole genome expression analysis. The
More informationDNA Microarray Technology
CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationChapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer
Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling
More informationFull-length single-cell RNA-seq applied to a viral human. cancer: Applications to HPV expression and splicing analysis. Supplementary Information
Full-length single-cell RNA-seq applied to a viral human cancer: Applications to HPV expression and splicing analysis in HeLa S3 cells Liang Wu 1, Xiaolong Zhang 1,2, Zhikun Zhao 1,3,4, Ling Wang 5, Bo
More informationUltrasequencing: Methods and Applications of the New Generation Sequencing Platforms
Ultrasequencing: Methods and Applications of the New Generation Sequencing Platforms Laura Moya Andérico Master in Advanced Genetics Genomics Class December 16 th, 2015 Brief Overview First-generation
More informationResearching Cancer with the minion: Methylation and Structural Variation
Agilent Webinar November 2017 Researching Cancer with the minion: Methylation and Structural Variation Winston Timp Department of Biomedical Engineering Johns Hopkins University Nanopore: Single Molecule
More informationRegulation of Gene Expression
Chapter 18 Regulation of Gene Expression Edited by Shawn Lester PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley
More informationFinding Genes, Building Search Strategies and Visiting a Gene Page
Finding Genes, Building Search Strategies and Visiting a Gene Page 1. Finding a gene using text search. For this exercise use http://www.plasmodb.org a. Find all possible kinases in Plasmodium. Hint: use
More informationFinding Genes, Building Search Strategies and Visiting a Gene Page
Finding Genes, Building Search Strategies and Visiting a Gene Page 1. Finding a gene using text search. For this exercise use http://www.plasmodb.org a. Find all possible kinases in Plasmodium. Hint: use
More informationLecture 11. Initiation of RNA Pol II transcription. Transcription Initiation Complex
Lecture 11 *Eukaryotic Transcription Gene Organization RNA Processing 5 cap 3 polyadenylation splicing Translation Initiation of RNA Pol II transcription Consensus sequence of promoter TATA Transcription
More informationBenchmarking of RNA-seq data processing pipelines using whole transcriptome qpcr expression data
Benchmarking of RNA-seq data processing pipelines using whole transcriptome qpcr expression data Jan Hellemans 7th international qpcr & NGS Event - Freising March 24 th, 2015 Therapeutics lncrna oncology
More informationReverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami
Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami hanialhadrami@kau.edu.sa www.hanialhadrami.kau.edu.sa Overview Several techniques are available to detect and analyse RNA. Examples of these techniques
More informationThird Generation Sequencing
Third Generation Sequencing By Mohammad Hasan Samiee Aref Medical Genetics Laboratory of Dr. Zeinali History of DNA sequencing 1953 : Discovery of DNA structure by Watson and Crick 1973 : First sequence
More informationStudent Learning Outcomes (SLOS)
Student Learning Outcomes (SLOS) KNOWLEDGE AND LEARNING SKILLS USE OF KNOWLEDGE AND LEARNING SKILLS - how to use Annhyb to save and manage sequences - how to use BLAST to compare sequences - how to get
More informationGene Expression: Transcription
Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make
More informationChapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.
Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions
More informationRegulation of Gene Expression
CAMPBELL BIOLOGY IN FOCUS URRY CAIN WASSERMAN MINORSKY REECE 15 Regulation of Gene Expression Lecture Presentations by Kathleen Fitzpatrick and Nicole Tunbridge, Simon Fraser University SECOND EDITION
More informationHigh Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Tuesday December 16, 2014
High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Tuesday December 16, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion
More informationIntroduction to Microarray Analysis
Introduction to Microarray Analysis Methods Course: Gene Expression Data Analysis -Day One Rainer Spang Microarrays Highly parallel measurement devices for gene expression levels 1. How does the microarray
More informationSOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit
SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit Agenda SOLiD Total RNAseq Kit Overview Kit Configurations Barcoding Kit Introduction New Small RNA and WT Workflow Small RNA Workflow Step-by-step Workflow
More informationHands-On Four Investigating Inherited Diseases
Hands-On Four Investigating Inherited Diseases The purpose of these exercises is to introduce bioinformatics databases and tools. We investigate an important human gene and see how mutations give rise
More information8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
More informationSequence Annotation & Designing Gene-specific qpcr Primers (computational)
James Madison University From the SelectedWorks of Ray Enke Ph.D. Fall October 31, 2016 Sequence Annotation & Designing Gene-specific qpcr Primers (computational) Raymond A Enke This work is licensed under
More informationless sensitive than RNA-seq but more robust analysis pipelines expensive but quantitiatve standard but typically not high throughput
Chapter 11: Gene Expression The availability of an annotated genome sequence enables massively parallel analysis of gene expression. The expression of all genes in an organism can be measured in one experiment.
More informationChapter 13 - Regulation of Gene Expression
Chapter 13 - Regulation of Gene Expression 1. Describe the typical components of an operon in an E. coli (prokaryotic) cell. (p. 238-239) a. regulator gene - b. promoter - c. operator - d. structural gene
More informationPage Bioanalyzer Assays and Applications
Page 18 2100 Bioanalyzer Assays and Applications RNA Applications RNA QA/QC Microarrays Gene Expression RNA QA/QC qpcr RNA QA/QC mpcr smallrna QA/QC Page 19 RNA QC Workflow Analysis of Total RNA Integrity
More informationSoybean Microarrays. An Introduction. By Steve Clough. November Common Microarray platforms
Soybean Microarrays Microarray construction An Introduction By Steve Clough November 2005 Common Microarray platforms cdna: spotted collection of PCR products from different cdna clones, each representing
More informationTranscription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
More informationAbout Strand NGS. Strand Genomics, Inc All rights reserved.
About Strand NGS Strand NGS-formerly known as Avadis NGS, is an integrated platform that provides analysis, management and visualization tools for next-generation sequencing data. It supports extensive
More information