Biological Sciences 50 Practice Exam 2

Size: px
Start display at page:

Download "Biological Sciences 50 Practice Exam 2"

Transcription

1 NAME: Fall 2005 TF: Biological Sciences 50 Practice Exam 2 A. Be sure to write your name on the top of each of page of the examination. B. Write each answer only on the same page as the pertinent question. THE SPACE PROVIDED IS MEANT TO BE SUFFICIENT; BE BRIEF, BE CAREFUL, BE CONCISE! If absolutely necessary, use the back of that page to continue the answer. C. IF YOUR ANSWER CANNOT BE READ IT CANNOT BE GRADED!!! D. Remember, if you do not show all your work, you cannot get partial credit. E. The point value for each question is noted. Allocate your time wisely. F. Read carefully, think before you write, good luck, and do well! IF YOU WRITE IN PENCIL, YOU CANNOT ASK FOR A REGRADE! Question 1: Question 2: Question 3: Question 4: Question 5: Question 6: (9 pts) (11 pts) (18 pts) (16 pts) (22 pts) (24 pts) TOTAL: (100 pts)

2 Name Page 2 of 6 Question 1 (9 points). a) Does the molecular below come from RNA or DNA? Justify your answer. b) List two other structural differences between RNA and DNA Question 2 (11 points) The following table contains a list of statements that apply to replication, transcription, both, or neither. In each empty box, put a check mark if that statement applies to replication or transcription. In eukaryotes, the process occurs in the nucleus. A primer is required to initiate synthesis. The polymerase moves 5 to 3 along the template strand. The polymerase moves 3 to 5 along the template strand. The process requires DNA unwinding The product is DNA. The product is RNA. The template is used only once per cell cycle Synthesis of the new strand is initiated at a promoter. The product may be modified after synthesis Proof-reading and repair are incorporated into this process. Replication Transcription

3 Name Page 3 of 6 Question 3 (18 points). The line below represents a prokaryotic gene. The rectangle represents the coding region. Below the DNA diagram, draw the corresponding RNA (roughly to scale) and polypeptide. Where appropriate, indicate the location of the following: start codon polya tail 3 UTR hairpin loop 5 cap amino terminal stop codon carboxy terminal 5 UTR promoter methionine (met) intron DNA coding region

4 Name Page 4 of 6 Question 4 (16 points). You are studying an inversion heterozygote. The order of genes along one homolog is centromere A B D E F The order of genes along the other homolog is centromere A E D B F a) Assuming that the first homolog is the normal chromosome, draw an arrow(s) at that breakpoint(s) that gave rise to the abnormal chromosome b) The homologs undergo recombination between genes B and D. Draw a clear sketch depicting the chromosomes of this inversion heterozygote as they align at pachytene. In your sketch, only include the chromatids undergoing recombination. c) Draw a clear sketch of the recombinant products from such as cross-over event. d) Will the recombinant chromatids segregate normally during cell division? Explain.

5 Name Page 5 of 6 Question 5 (22 points). You are studying a gene in E. coli that specifies a protein enzyme. Part of the wild-type sequence is given below. You recover a series of mutants for this gene that show no enzyme activity. Isolating and sequencing the mutant products, you find the following protein sequences (assume each mutant is the result of a single nucleotide change): Wild-type: - Met - Cys Ala - Gln - Ile Tyr Mutant 1: Mutant 2: Mutant 3: - Met - Cys Ala - Gln - Thr Tyr - Met - Cys Ala - Met - Val Pro Arg Phe - Thr a) How may different mrna sequences could code for this portion of the wild-type protein? Show your work. b) For the FIRST amino acid affected by each mutation, give the original codon(s) and the mutant codon(s) as specifically as possible. Use all the data and show your work. Clearly indicate the type of mutation that has occurred.

6 Name Page 6 of 6 Question 6 (24 pts) The following is a list of mutational changes. For each of the specific changes described, indicate which of the terms listed below could apply, either as a description of the mutation or as a possible cause. More than one term from the list can apply to each and individual terms may be used once, more than once, or not at all. a) a G-C base pair is changed to an A-T base pair b) a G-C base pair is changed to a T-A base pair c) the sequence AAGCTTATCG is changed to AACTTATCG d) the sequence AACGTCACACATCG is changed to AACGTCACACACACATCG transition base substitution transversion inversion indel deamination intercalating agent frameshift replication slippage SOS system photodimer Optional (check one answer for each question) This exam was too short too long about right This exam was too easy too hard about right Write brief additional comments about the exam (or the course so far) below:

Biological Sciences 50 Practice Final Exam. Allocate your time wisely.

Biological Sciences 50 Practice Final Exam. Allocate your time wisely. NAME: Fall 2005 TF: Biological Sciences 50 Practice Final Exam A. Be sure to write your name on the top of each of page of the examination. B. Write each answer only on the same page as the pertinent question.

More information

BS 50 Genetics and Genomics Week of Oct 24

BS 50 Genetics and Genomics Week of Oct 24 BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.

More information

Problem Set Unit The base ratios in the DNA and RNA for an onion (Allium cepa) are given below.

Problem Set Unit The base ratios in the DNA and RNA for an onion (Allium cepa) are given below. Problem Set Unit 3 Name 1. Which molecule is found in both DNA and RNA? A. Ribose B. Uracil C. Phosphate D. Amino acid 2. Which molecules form the nucleotide marked in the diagram? A. phosphate, deoxyribose

More information

Lecture for Wednesday. Dr. Prince BIOL 1408

Lecture for Wednesday. Dr. Prince BIOL 1408 Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that

More information

Biological Sciences 50 Practice Exam 1

Biological Sciences 50 Practice Exam 1 NAME: Fall 2005 TF: Biological Sciences 50 Practice Exam 1 A. Write your name on each page. B. Write your answer on the same page as the question. THE SPACE PROVIDED IS MEANT TO BE SUFFICIENT; BE BRIEF,

More information

5. Which of the following enzymes catalyze the attachment of an amino acid to trna in the formation of aminoacyl trna?

5. Which of the following enzymes catalyze the attachment of an amino acid to trna in the formation of aminoacyl trna? Sample Examination Questions for Exam 3 Material Biology 3300 / Dr. Jerald Hendrix Warning! These questions are posted solely to provide examples of past test questions. There is no guarantee that any

More information

BIO303, Genetics Study Guide II for Spring 2007 Semester

BIO303, Genetics Study Guide II for Spring 2007 Semester BIO303, Genetics Study Guide II for Spring 2007 Semester 1 Questions from F05 1. Tryptophan (Trp) is encoded by the codon UGG. Suppose that a cell was treated with high levels of 5- Bromouracil such that

More information

7.014 Problem Set 4 Answers to this problem set are to be turned in. Problem sets will not be accepted late. Solutions will be posted on the web.

7.014 Problem Set 4 Answers to this problem set are to be turned in. Problem sets will not be accepted late. Solutions will be posted on the web. MIT Department of Biology 7.014 Introductory Biology, Spring 2005 Name: Section : 7.014 Problem Set 4 Answers to this problem set are to be turned in. Problem sets will not be accepted late. Solutions

More information

BIOL 225 Genetics-Final Exam November 17, 2006 Dr. Sandra Davis

BIOL 225 Genetics-Final Exam November 17, 2006 Dr. Sandra Davis BIOL 225 Genetics-Final Exam November 17, 2006 Dr. Sandra Davis INSTRUCTIONS: 1. Read the questions carefully and write your answers in the space provided. If you need more space, clearly indicate WHERE

More information

Chapter 17. From Gene to Protein. AP Biology

Chapter 17. From Gene to Protein. AP Biology Chapter 17. From Gene to Protein Metabolism teaches us about genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton) PKU (phenylketonuria)

More information

7.014 Solution Set 4

7.014 Solution Set 4 7.014 Solution Set 4 Question 1 Shown below is a fragment of the sequence of a hypothetical bacterial gene. This gene encodes production of HWDWN, protein essential for metabolizing sugar yummose. The

More information

3'A C G A C C A G T A A A 5'

3'A C G A C C A G T A A A 5' AP Biology Chapter 14 Reading Guide Gene Expression: From Gene to Protein Overview 1. What is gene expression? Concept 14.1 Genes specify proteins via transcription and translation Basic Principles of

More information

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation. Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions

More information

Haveouts Guided Notes Pen/pencil DFAD Privacy Folder Silent after the bell rings

Haveouts Guided Notes Pen/pencil DFAD Privacy Folder Silent after the bell rings Haveouts Guided Notes Pen/pencil DFAD Privacy Folder Silent after the bell rings #1 #3 Pop Quiz This Do First will be counted as a Quiz grade with no curve. Use your DFAD. #2 1. Identify structure #1.

More information

DNA Replication and Repair

DNA Replication and Repair DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands

More information

1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation

1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation 1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous

More information

Protein Synthesis. DNA to RNA to Protein

Protein Synthesis. DNA to RNA to Protein Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.

More information

From Genes to Protein

From Genes to Protein From Genes to Protein Transcription and Translation Metabolism Teaches Us About Genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from

More information

13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription.

13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription. 13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription. The Role of RNA 1. Complete the table to contrast the structures of DNA and RNA. DNA Sugar Number of Strands Bases

More information

Exam 2 Key - Spring 2008 A#: Please see us if you have any questions!

Exam 2 Key - Spring 2008 A#: Please see us if you have any questions! Page 1 of 5 Exam 2 Key - Spring 2008 A#: Please see us if you have any questions! 1. A mutation in which parts of two nonhomologous chromosomes change places is called a(n) A. translocation. B. transition.

More information

From Genes to Protein

From Genes to Protein From Genes to Protein Transcription and Translation Metabolism Teaches Us About Genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from

More information

8/21/2014. From Gene to Protein

8/21/2014. From Gene to Protein From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information

More information

Ch 10 Molecular Biology of the Gene

Ch 10 Molecular Biology of the Gene Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read

More information

7.014 Quiz II Handout

7.014 Quiz II Handout 7.014 Quiz II Handout Quiz II: Wednesday, March 17 12:05-12:55 54-100 **This will be a closed book exam** Quiz Review Session: Friday, March 12 7:00-9:00 pm room 54-100 Open Tutoring Session: Tuesday,

More information

BIOLOGY 205 Midterm II - 19 February Each of the following statements are correct regarding Eukaryotic genes and genomes EXCEPT?

BIOLOGY 205 Midterm II - 19 February Each of the following statements are correct regarding Eukaryotic genes and genomes EXCEPT? BIOLOGY 205 Midterm II - 19 February 1999 Name Multiple choice questions 4 points each (Best 12 out of 13). 1. Each of the following statements are correct regarding Eukaryotic genes and genomes EXCEPT?

More information

Biology A: Chapter 9 Annotating Notes Protein Synthesis

Biology A: Chapter 9 Annotating Notes Protein Synthesis Name: Pd: Biology A: Chapter 9 Annotating Notes Protein Synthesis -As you read your textbook, please fill out these notes. -Read each paragraph state the big/main idea on the left side. -On the right side

More information

BIOLOGY - CLUTCH CH.17 - GENE EXPRESSION.

BIOLOGY - CLUTCH CH.17 - GENE EXPRESSION. !! www.clutchprep.com CONCEPT: GENES Beadle and Tatum develop the one gene one enzyme hypothesis through their work with Neurospora (bread mold). This idea was later revised as the one gene one polypeptide

More information

produces an RNA copy of the coding region of a gene

produces an RNA copy of the coding region of a gene 1. Transcription Gene Expression The expression of a gene into a protein occurs by: 1) Transcription of a gene into RNA produces an RNA copy of the coding region of a gene the RNA transcript may be the

More information

Genes and How They Work. Chapter 15

Genes and How They Work. Chapter 15 Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central

More information

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16 Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes

More information

Please sign below if you wish to have your grades posted by the last five digits of your SSN

Please sign below if you wish to have your grades posted by the last five digits of your SSN BIO 226R EXAM III (Sample) PRINT YOUR NAME Please sign below if you wish to have your grades posted by the last five digits of your Signature BIO 226R Exam III has 8 pages, and 26 questions. There are

More information

Chapter 13. From DNA to Protein

Chapter 13. From DNA to Protein Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to

More information

Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL

Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Name: Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Part A: Multiple Choice (15 marks) Circle the letter of choice that best completes the statement or answers the question. One mark for each correct

More information

You are genetically unique

You are genetically unique BNF 5106 - Lecture 1 Genetics, Genes, Genetic codes, and Mutations You are genetically unique Since each parent has 23 pairs of chromosomes, the probability that each parent gives twice the same chromosomes

More information

RNA and PROTEIN SYNTHESIS. Chapter 13

RNA and PROTEIN SYNTHESIS. Chapter 13 RNA and PROTEIN SYNTHESIS Chapter 13 DNA Double stranded Thymine Sugar is RNA Single stranded Uracil Sugar is Ribose Deoxyribose Types of RNA 1. Messenger RNA (mrna) Carries copies of instructions from

More information

Bundle 5 Test Review

Bundle 5 Test Review Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic

More information

7.013 Problem Set 3 FRIDAY October 8th, 2004

7.013 Problem Set 3 FRIDAY October 8th, 2004 MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert. Weinberg, Dr. laudette ardel Name: T: 7.013 Problem Set 3 FRIDY October 8th, 2004 Problem

More information

Key Area 1.3: Gene Expression

Key Area 1.3: Gene Expression Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?

More information

Name Date Class. The Central Dogma of Biology

Name Date Class. The Central Dogma of Biology Concept Mapping The Central Dogma of Biology Complete the events chain showing the events that occur as DNA codes for RNA, which guides the synthesis of proteins, the central dogma of biology. These terms

More information

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded

More information

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by

More information

3. The following sequence is destined to be translated into a protein: However, a mutation occurs that results in the molecule being altered to:

3. The following sequence is destined to be translated into a protein: However, a mutation occurs that results in the molecule being altered to: 1. Please identify the molecule below: 5 -ACTCGATTACGATACGA-3ʼ a) DNA b) mrna c) trna d) rrna e) It cannot be determined 2. If a complimentary strand of RNA were made to the molecule in question 1, what

More information

CH 17 :From Gene to Protein

CH 17 :From Gene to Protein CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there

More information

Module Code: BIO00007C

Module Code: BIO00007C Examination Candidate Number: Desk Number: BSc and MSc Degree Examinations 2018-9 Department : BIOLOGY Title of Exam: Genetics Time Allowed: 1 Hour 30 Minutes Marking Scheme: Total marks available for

More information

IB BIO I Replication/Transcription/Translation Van Roekel/Madden. Name Date Period. D. It separates DNA strands. (Total 1 mark)

IB BIO I Replication/Transcription/Translation Van Roekel/Madden. Name Date Period. D. It separates DNA strands. (Total 1 mark) Name Date Period 1. What is the function of helicase? A. It forms bonds between DNA nucleotides. B. It adds new nucleotides to the DNA helix. C. It forms the DNA helix. D. It separates DNA strands. 2.

More information

LABS 9 AND 10 DNA STRUCTURE AND REPLICATION; RNA AND PROTEIN SYNTHESIS

LABS 9 AND 10 DNA STRUCTURE AND REPLICATION; RNA AND PROTEIN SYNTHESIS LABS 9 AND 10 DNA STRUCTURE AND REPLICATION; RNA AND PROTEIN SYNTHESIS OBJECTIVE 1. OBJECTIVE 2. OBJECTIVE 3. OBJECTIVE 4. Describe the structure of DNA. Explain how DNA replicates. Understand the structure

More information

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Ch 17 Practice Questions MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) Garrod hypothesized that "inborn errors of metabolism" such as alkaptonuria

More information

Chapter 14: Gene Expression: From Gene to Protein

Chapter 14: Gene Expression: From Gene to Protein Chapter 14: Gene Expression: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect

More information

B. Incorrect! Centromeric DNA is largely heterochromatin, which is inactive DNA.

B. Incorrect! Centromeric DNA is largely heterochromatin, which is inactive DNA. MCAT Biology - Problem Drill 06: Molecular Biology of Eukaryotes Question No. 1 of 10 1. Which type of DNA would have the highest level of expression? Question #01 (A) Heterochromatin. (B) Centromeric

More information

Chapter 14 Active Reading Guide From Gene to Protein

Chapter 14 Active Reading Guide From Gene to Protein Name: AP Biology Mr. Croft Chapter 14 Active Reading Guide From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single

More information

Flow of Genetic Information_ Genetic Code, Mutation & Translation (Learning Objectives)

Flow of Genetic Information_ Genetic Code, Mutation & Translation (Learning Objectives) Flow of Genetic Information_ Genetic Code, Mutation & Translation (Learning Objectives) Demonstrate understanding of the genetic code, codon, start and stop codons, redundancy of the genetic code, and

More information

iclicker Question #28B - after lecture Shown below is a diagram of a typical eukaryotic gene which encodes a protein: start codon stop codon 2 3

iclicker Question #28B - after lecture Shown below is a diagram of a typical eukaryotic gene which encodes a protein: start codon stop codon 2 3 Bio 111 Handout for Molecular Biology 4 This handout contains: Today s iclicker Questions Information on Exam 3 Solutions Fall 2008 Exam 3 iclicker Question #28A - before lecture Which of the following

More information

Chapter 8. Microbial Genetics. Lectures prepared by Christine L. Case. Copyright 2010 Pearson Education, Inc.

Chapter 8. Microbial Genetics. Lectures prepared by Christine L. Case. Copyright 2010 Pearson Education, Inc. Chapter 8 Microbial Genetics Lectures prepared by Christine L. Case Structure and Function of Genetic Material Learning Objectives 8-1 Define genetics, genome, chromosome, gene, genetic code, genotype,

More information

GENETICS. Chapter 1: Cell cycle. Thème 1 : La Terre dans l Univers A. Expression, stabilité et variation du patrimoine génétique.

GENETICS. Chapter 1: Cell cycle. Thème 1 : La Terre dans l Univers A. Expression, stabilité et variation du patrimoine génétique. Introduction: GENETICS 3M = first look at genetics (study of inheritance, discovery of chromosomes, genes, dominant and recessive alleles and the DNA molecule within chromosomes) 2D = not much in fact,

More information

CHapter 14. From DNA to Protein

CHapter 14. From DNA to Protein CHapter 14 From DNA to Protein How? DNA to RNA to Protein to Trait Types of RNA 1. Messenger RNA: carries protein code or transcript 2. Ribosomal RNA: part of ribosomes 3. Transfer RNA: delivers amino

More information

Basic concepts of molecular biology

Basic concepts of molecular biology Basic concepts of molecular biology Gabriella Trucco Email: gabriella.trucco@unimi.it Life The main actors in the chemistry of life are molecules called proteins nucleic acids Proteins: many different

More information

From Gene to Protein. How Genes Work

From Gene to Protein. How Genes Work From Gene to Protein How Genes Work 2007-2008 The Central Dogma Flow of genetic information in a cell How do we move information from DNA to proteins? DNA RNA protein replication phenotype You! Step 1:

More information

PBG 430/530 Exam

PBG 430/530 Exam 1 PBG 430/530 Exam 2 2013 1. In a deoxyribonucleotide, 5 and 3 refer to the a. start site for transcription. b. start site for translation. c. carbons where (respectively) the phosphate and hydroxyl groups

More information

DNA Function: Information Transmission

DNA Function: Information Transmission DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living

More information

Protein Synthesis ~Biology AP~

Protein Synthesis ~Biology AP~ Protein Synthesis ~Biology AP~ A Meridian Study Guide by David Guan, Jennifer Zheng [Edited by Lei Gong] Introduction: - DNA and RNA are essential for life because they code for enzymes, which regulate

More information

Flow of Genetic Information_Translation (Learning Objectives)

Flow of Genetic Information_Translation (Learning Objectives) Flow of Genetic Information_Translation (Learning Objectives) Demonstrate understanding of the genetic code, codon, start and stop codons, redundancy of the genetic code, and reading frame by figuring

More information

Gene function at the level of traits Gene function at the molecular level

Gene function at the level of traits Gene function at the molecular level Gene expression Gene function at the level of traits Gene function at the molecular level Two levels tied together since the molecular level affects the structure and function of cells which determines

More information

Chapter 17: From Gene to Protein

Chapter 17: From Gene to Protein Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master

More information

Chapter 9. Topics - Genetics - Flow of Genetics - Regulation - Mutation - Recombination

Chapter 9. Topics - Genetics - Flow of Genetics - Regulation - Mutation - Recombination Chapter 9 Topics - Genetics - Flow of Genetics - Regulation - Mutation - Recombination 1 Flow of Genetics NA replication (DNA => DNA; RNA => RNA) Replication Reverse transcription (RNA => DNA) Gene Expression

More information

Chapter 8 From DNA to Proteins. Chapter 8 From DNA to Proteins

Chapter 8 From DNA to Proteins. Chapter 8 From DNA to Proteins KEY CONCEPT Section 1 DNA was identified as the genetic material through a series of experiments. Griffith finds a transforming principle. Griffith experimented with the bacteria that cause pneumonia.

More information

From DNA to Protein: Genotype to Phenotype

From DNA to Protein: Genotype to Phenotype 12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each

More information

Microbial Genetics. Chapter 8

Microbial Genetics. Chapter 8 Microbial Genetics Chapter 8 Structure and Function of Genetic Material Genome A cell s genetic information Chromosome Structures containing DNA that physically carry hereditary information Gene Segments

More information

MOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1

MOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1 AP BIOLOGY MOLECULAR GENETICS ACTIVITY #2 NAME DATE HOUR PROTEIN SYNTHESIS Molecular Genetics Activity #2 page 1 GENETIC CODE PROTEIN SYNTHESIS OVERVIEW Molecular Genetics Activity #2 page 2 PROTEIN SYNTHESIS

More information

(a) Which enzyme(s) make 5' - 3' phosphodiester bonds? (c) Which enzyme(s) make single-strand breaks in DNA backbones?

(a) Which enzyme(s) make 5' - 3' phosphodiester bonds? (c) Which enzyme(s) make single-strand breaks in DNA backbones? EXAMPLE QUESTIONS AND ANSWERS 1. Topoisomerase does which one of the following? (a) Makes new DNA strands. (b) Unties knots in DNA molecules. (c) Joins the ends of double-stranded DNA molecules. (d) Is

More information

AP Biology

AP Biology Chapter 17. From Gene to Protein Metabolism teaches us about genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton) PKU (phenylketonuria)

More information

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,

More information

Genes and Proteins. Objectives

Genes and Proteins. Objectives Genes and Proteins Lecture 15 Objectives At the end of this series of lectures, you should be able to: Define terms. Explain the central dogma of molecular biology. Describe the locations, reactants, and

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.

Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6. Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)

More information

Chapter 17: From Gene to Protein

Chapter 17: From Gene to Protein Name Period Chapter 17: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to

More information

Student name ID # Second Mid Term Exam, Biology 2020, Spring 2002 Scores Total

Student name ID # Second Mid Term Exam, Biology 2020, Spring 2002 Scores Total Second Mid Term Exam, Biology 2020, Spring 2002 Scores 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. Total 1 1. Matching (7 pts). Each answer is used exactly once Helicase

More information

Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein?

Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein? Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein? Messenger RNA Carries Information for Protein Synthesis from the DNA to Ribosomes Ribosomes Consist

More information

Genes are coded DNA instructions that control the production of proteins within a cell. The first step in decoding genetic messages is to copy a part

Genes are coded DNA instructions that control the production of proteins within a cell. The first step in decoding genetic messages is to copy a part Genes are coded DNA instructions that control the production of proteins within a cell. The first step in decoding genetic messages is to copy a part of the nucleotide sequence of the DNA into RNA. RNA

More information

Chapter 17. From Gene to Protein

Chapter 17. From Gene to Protein Chapter 17 From Gene to Protein Overview: The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific

More information

Transcription is the first stage of gene expression

Transcription is the first stage of gene expression Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the

More information

The Structure of RNA. The Central Dogma

The Structure of RNA. The Central Dogma 12-3 12-3 RNA and Protein Synthesis The Structure of RNA The Central Dogma Phenotype A gene is a SEQUENCE of DNA that codes for a protein (or functional RNA). Phenotype is the individual s observable trait

More information

KEY CONCEPT DNA was identified as the genetic material through a series of experiments. Found live S with R bacteria and injected

KEY CONCEPT DNA was identified as the genetic material through a series of experiments. Found live S with R bacteria and injected Section 1: Identifying DNA as the Genetic Material KEY CONCEPT DNA was identified as the genetic material through a series of experiments. VOCABULARY bacteriophage MAIN IDEA: Griffith finds a transforming

More information

Welcome to Genome 371!

Welcome to Genome 371! Genome 371, 4 Jan 2010, Lecture 1 Welcome to Genome 371! If you are not registered - please don t take a seat! (class is full) - see Anne Paul (outside) to get on the wait list If you are registered and

More information

2. From the first paragraph in this section, find three ways in which RNA differs from DNA.

2. From the first paragraph in this section, find three ways in which RNA differs from DNA. Name Chapter 17: From Gene to Protein Begin reading at page 328 Basic Principles of Transcription and Translation. Work on this chapter a single concept at a time, and expect to spend at least 6 hours

More information

BIO 311C Spring Lecture 36 Wednesday 28 Apr.

BIO 311C Spring Lecture 36 Wednesday 28 Apr. BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through

More information

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as

More information

Bio 366: Biological Chemistry II Test #3, 100 points

Bio 366: Biological Chemistry II Test #3, 100 points Bio 366: Biological Chemistry II Test #3, 100 points READ THIS: Take a numbered test and sit in the seat with that number on it. Remove the numbered sticker from the desk, and stick it on the back of the

More information

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino

More information

The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Genetic Code. Genes and How They Work

The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Genetic Code. Genes and How They Work Genes and How They Work Chapter 15 Early ideas to explain how genes work came from studying human diseases. Archibald Garrod studied alkaptonuria, 1902 Garrod recognized that the disease is inherited via

More information

Find this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site.

Find this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site. Find this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site. Still having trouble understanding the material? Check

More information

Station 1: DNA Structure Use the figure above to answer each of the following questions. 1.This is the subunit that DNA is composed of. 2.

Station 1: DNA Structure Use the figure above to answer each of the following questions. 1.This is the subunit that DNA is composed of. 2. 1. Station 1: DNA Structure Use the figure above to answer each of the following questions. 1.This is the subunit that DNA is composed of. 2.This subunit is composed of what 3 parts? 3.What molecules make

More information

Protein Synthesis & Gene Expression

Protein Synthesis & Gene Expression DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that

More information

Fermentation. Lesson Overview. Lesson Overview 13.1 RNA

Fermentation. Lesson Overview. Lesson Overview 13.1 RNA 13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to

More information

Winter Quarter Midterm Exam

Winter Quarter Midterm Exam 1. For a science fair project, two students decided to repeat the Hershey and Chase experiment, with modifications. They decided to label the nitrogen of the DNA, rather than the phosphate. They reasoned

More information

Year Morgan and fellow researchers found that chromosomes contained DNA, RNA, and protein.

Year Morgan and fellow researchers found that chromosomes contained DNA, RNA, and protein. DNA Year 1920 Morgan and fellow researchers found that chromosomes contained DNA, RNA, and protein. Which one actually carries the genetic information? The stuff that gets passed on from generation

More information

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes? Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology

More information

Biol 321 Spring 2013 Quiz 4 25 pts NAME

Biol 321 Spring 2013 Quiz 4 25 pts NAME Biol 321 Spring 2013 Quiz 4 25 pts NAME 1. (3 pts.) a. What is the name of this compound? BE EXPLICIT deoxyribose 5 b. Number the carbons on this structure: 4 1 3 2 2. (4 pts.) Circle True or False. If

More information

A. Incorrect! This feature does help with it suitability as genetic material.

A. Incorrect! This feature does help with it suitability as genetic material. College Biology - Problem Drill 08: Gene Structures and Functions No. 1 of 10 1. Which of the statements below is NOT true in explaining why DNA is a suitable genetic material? #01 (A) Its double helix

More information

Algorithms in Bioinformatics ONE Transcription Translation

Algorithms in Bioinformatics ONE Transcription Translation Algorithms in Bioinformatics ONE Transcription Translation Sami Khuri Department of Computer Science San José State University sami.khuri@sjsu.edu Biology Review DNA RNA Proteins Central Dogma Transcription

More information

Transcription and Post Transcript Modification

Transcription and Post Transcript Modification Transcription and Post Transcript Modification You Should Be Able To 1. Describe transcription. 2. Compare and contrast eukaryotic + prokaryotic transcription. 3. Explain mrna processing in eukaryotes.

More information