The Molecule of Heredity. Chapter 12 (pg. 342)

Transcription

1 The Molecule of Heredity Chapter 12 (pg. 342)

2 What is DNA? DNA contains instructions for assembling proteins. Proteins tell our cells how to function and act.

3 The Roles of DNA DNA has three jobs in heredity: 1. STORES instructions for cell functions and protein production. 2. COPY itself exactly. (so that it can be transferred correctly to offspring) -This process is called replication. -Enzymes control the process. 3. TRANSMIT genetic information and pass it along during cell division.

4 Chromosomes A chromosome is one of the threadlike "packages" of genes and other DNA in the nucleus of a cell (in eukaryotes). Prokaryotes don t have a nucleus so DNA is floating in the cytoplasm Different kinds of organisms have different numbers of chromosomes.

5 Gene functional & physical unit of heredity passed from parent to offspring. Genes are pieces of DNA Contain the information for making a specific protein. Genome All the DNA contained in an organism or a cell Includes: chromosomes DNA in mitochondria DNA in the chloroplasts of plant cells

6 DNA Structure Deoxyribonucleic acid. Monomer = Nucleotide These strands each have a nitrogenous base connected to them and those base pairs meet in the middle The strands twist around one another forming a double helix (described & discovered by Watson,Crick & Franklin)

7 DNA Structure: Nucleotides 5 carbon sugar deoxyribose Phosphate group Nitrogen base (4) Adenine Guanine Cytosine Thymine

8 DNA Structure Hydrogen bonds hold the two DNA strands together where the nitrogen bases meet The sides of the DNA ladder are composed of alternating sugar and phosphate and are called backbones

9 Types of Nitrogen Bases Purines have two rings in their structure Adenine Guanine Pyrimidines have one ring in their structure - Thymine - Cytosine

10 Nitrogen Base Pairing Bases pair in a specific pattern A purine always bonds to a pyrimidine Adenine bonds to thymine. Guanine bonds to cytosine.

11 True or False? Because of base pairing in DNA, the percentage of pyrimidines is about equal to the number of purines.

12 What Pairs with What? What does adenine (A) pair with? Thymine (T) What does cytosine (C) pair with? Guanine (G)

13

14 Cytosine and Thymine are what type of nitrogen bases? Purine or pyrimidine? Answer: Pyrimidine!!! Note: All three words have a Y in them.

15 Check Yourself Which of these is a purine? Which picture does not show/include a nitrogenous base? Which structure would attract a cytosine molecule?

16 RNA Chapter 13 (pg. 362)

17 RNA is just as cool as DNA!!!

18 Ribonucleic Acid What is RNA? Makes copies of DNA instructions to site of protein production DNA is the master blueprint, RNA are the portable copies.

19 1. mrna 3 Types of RNA Messenger RNA Carries instructions from the DNA to the ribosomes, where protein production occurs. mrna is made from a DNA strand, in a process called transcription. A U G U

20 3 Types of RNA (cont.) 2. rrna Ribosomal RNA Makes the Ribosome Along with proteins rrna

21 3 Types of RNA (cont.) 3. trna Transfer RNA Transfers amino acids to the ribosome where translation occurs, and matches amino acids to the mrna strand.

22 Types of Nitrogen Bases Purines have two rings in their structure Adenine Guanine Pyrimidines have one ring in their structure - Uracil No T in RNA! - Cytosine

23 DNA vs. RNA DNA - Sugar: deoxyribose - Double stranded - Nitrogen bases: A C G T - Master Blueprint RNA - Sugar: ribose - Single stranded - Nitrogen bases: A C G U - Blueprint Copies

24 Crashcourse: DNA and Replication

25 DNA Replication DNA is copied in a process called replication. 1. DNA unzips down its H-bonds using an enzyme called helicase 2. The two half strands then act as a template for the production of two new strands Replication Fork

26 If this is a template strand, what complementary strand would it make? -A C T G G- -T G A C C-

27 3. Another enzyme, (DNA Polymerase) uses base pairing rules match new base pairs onto each strand. Now, each new DNA molecule has one old strand of nucleotides and one new strand.

28

29 Protein Synthesis

30 Protein Synthesis Process of turning the instructions found in DNA into working proteins. Step 1: Transcription Step 2: Translation

31 Transcription DNA is coded, and needs to be delivered and read in order to make proteins. We can make a messenger RNA (mrna) in the process called transcription that will travel to the ribosomes carrying a copy of the DNA s information.

32 Transcription (cont.) First, the DNA helix separates like it did in replication. But this time each template strand will base pair with RNA s nitrogen bases: A C G U Cytosine with Guanine Adenine with Uracil (not Thymine anymore!) Bases are put together by RNA Polymerase

33 This new mrna strand will leave the nucleus and make it s way to the ribosome.

34 Transcribe this strand: -A C T G A- -U G A C U-

35 The story so far: -DNA has been transcribed into the form of mrna -The mrna has travelled from the nucleus to the Ribosome. Now what? What message is contained in the mrna? Why did the cell do all this?

36 RNA : Translation

37 Translation: when the cell uses information from mrna to produce proteins. Happens in the ribosome trna translates the code on the mrna to an amino acid trna is a middle man Amino acid on one side, and an anticodon that matches up with a codon from mrna trna ANTICODON mrna

38 How is mrna read? The mrna strand is read in: Codons: sets of 3 bases Starts reading at the start codon: AUG Stops reading at the stop codon: UAA, UAG, UGA How many codons are in this strand of mrna? AUGCCAGCAUACUUACAUUGA = 7! AUG CCA GCA UAC UUA CAU UGA

39 Step 1 Messenger RNA is transcribed in the nucleus and then enters the cytoplasm. Nucleus mrna A U G U U C A A A CYTOPLASM Where is it going??? Why doesn t the mrna stay in the nucleus????

40 Step 2 Happens at the ribosomes Translation begins at the start codon (AUG) trna comes in, and basepairs to the mrna. Each trna contains 3 bases (anticodon) that tell it where to attach on the mrna. Amino Acid Ribosome trna Anticodon mrna Strand U A A C U G A A U U G C A A A Start Codon Codon

41 Step 3 The ribosome bonds the amino acids together. After trna drops off its amino acid, the mrna releases the trna. New trna brings the next amino acid in. Amino acids trna A U G A A U U G C U U U A A A mrna Codon

42 Step 4 The process continues, building the polypeptide chain, until the trna meets a stop codon. Once it reaches a stop codon, the polypeptide chain is released. Polypeptide chain ribosome trna What s our end product here? mrna What did we make?

43 Let s see Translation in action!!!!

44 So now we have a polypeptide chain or a PROTEIN! Scientists need to be able to tell proteins apart sometimes.can you think of a reason why? In order to tell proteins apart we need to know the names of all the amino acids that make them up!

45 Naming Amino Acids To find out which amino acid is being translated, take the mrna codon that is being translated and find it in the chart. mrna Strand: AUGUCUACCCGA AUG: (Start) Methionine UCU: Serine ACC: Threonine CGA: Arginine UAG: STOP

46 Naming Amino Acids You try!!!!! mrna Strand: AUGGAGACCUCGCCCUAG

47 Naming Amino Acids You try!!!!! AUGGAGACCUCGCCCUAG AUG: (Start) Methionine GAG: Glutamic Acid ACC: Threonine UCG: Serine CCC: Proline UAG: STOP

48 Protein Synthesis Summary Process Function Location DNA Replication Copying DNA, making two complementary strands. Nucleus (stays in nucleus) RNA Transcription Using DNA to make a copy of mrna. Nucleus (sends to ribosomes) Translation Using the mrna we made to decode DNA s message and make proteins. Ribosomes

49 Quick Review!

50 Identify structure F Check Yourself

51 Check Yourself From which labeled structure is structure D made? Identify that labeled structure.

52 What is structure E? Check Yourself

53 What is structure D? Check Yourself

54 Check Yourself Which letter represents the process of translation?

55 Check Yourself Which letter represents the process of transcription?

56 Steps of Protein Synthesis Put the below in order: D, C, B, E, A A. The completed polypeptide is released from the ribosome. B. The ribosome joins the amino acids together and releases the trna molecules. C. Transfer RNA brings an amino acid to the ribosome and binds to its codon. D. Messenger RNA is transcribed from DNA and moves to the ribosome.

57 Check Yourself Where does the above process take place?

58 Check Yourself Label the structures involved with protein synthesis

59 Mutations

60 Mutations

61 Occasionally, cells make mistakes when copying their DNA. If the base pairs don t stay in the correct order, a mutation can occur Mutation: when DNA is damaged or changed in such a way that alters the genetic message carried by that gene.

62 There are two different types of mutations: Gene Mutations: mutations that change a single gene Chromosomal Mutations: mutations that change whole chromosomes.

63 Gene Mutations Gene mutations that involve a change in one nucleotide are called point mutations. Occur at a single point Usually happen during replication. 3 different kinds of point mutations: 1. Substitution 2. Insertion 3. Deletion

64 1. Substitution One nitrogen base is changed to a different nitrogen base. Usually only affects one amino acid, or sometimes have no effect at all. Ex: CCC CCA CCC ACC Proline Proline Proline threonine

65 Frameshift Mutations. Insertions and deletions can make dramatic changes in the DNA sequence. Another name for them is: frameshift mutations. Shifting changes the codons, therefore changing the amino acids (proteins).

66 2. Insertions When one nitrogen base is inserted into the DNA sequence. The effect can be dramatic, changing the amino acid sequence from that point on. CGACCCATT CGACTCCATT CGA CCC ATT CGA CTC CAT T

67 3. Deletions When one nitrogen base is deleted out of the sequence Effect can be dramatic, affecting all the amino acids after the deletion. CCGTACAGG CCG TAC AGG CCGTACAGG CCG ACA GG

68 Chromosomal Mutations Involve changes in whole chromosome. Four types: Deletion -Missing a base Duplication -Two bases where one should be Inversion -Reversing base positions Translocation -Set of bases where they don t belong

69 Why do mutations happen? Mutations happen for multiple reasons: Error in genetic replication Stressful environments Mutagens: chemical or physical agents in the environment (ex: tobacco smoke)

70 Harmful effects of mutations Cancers Diseases Sickle cell disease - Mutations affect the shape of red blood cells.

71 Benefits of mutations In some cases, mutations benefit certain organisms Insects that (over time) are able to resist chemical pesticides Farmers also use genetically modified plants that are genetically mutated to be bigger and fuller crop.

72 Check Yourself Name the type of mutation: 1. TAC GGC AGC TGA TAC GCG CAG CTG 2. A B C D E F A B C D D E F 3. AAC TGA CGC GAC AAC TGA CGC TAC Insertion Duplication Substitution Are these point or chromosomal mutations? Point

73 Check Yourself Name the type of mutation: Deletion Duplication Inversion Translocation

74 Bacteria Evolving Antibiotic Resistance

75

76 All organisms need to grow We know that cells come from preexisting cells This means that cells will begin to grow until they start to divide! Living things grow by producing MORE cells! What obstacles do cells face when they start to grow????

77 As a cell becomes larger, it places more demand on its DNA. Living cells store all their important information in the DNA. As a cell gets bigger, the DNA does not. Large cells have trouble making copies of it s DNA

78 As a cell becomes larger in volume, it s surface area can t keep up. Ex: As you blow up a balloon, you re increasing the volume (overall size), but the cell membrane (the rubber balloon) can t keep up and gets stretched thinner and thinner.

79 Since the cell is enlarged, food and water get used up much quicker. Waste is produced much faster. The cell has a harder time moving enough materials across its cell membrane

80 Before it gets too big, a cell will DIVIDE! This forms two daughter cells. They re called daughter cells because each cell gets a complete copy of the DNA.

81 2 Types of Cells 1)BODY(somatic) CELLS 2) SEX CELLS (gametes)

82 Diploid: 2 Types of Cells Two copies of each chromosome. Body Cells Haploid: One copy of each chromosome Sex cells

83 There are two types of reproduction: Asexual: producing a genetically identical offspring from a single parent. Sexual: produces offspring that share genetic information of two parents.

84

85 Asexual Reproduction Favorable for faster reproduction when conditions are right. Genetically identical offspring helps when conditions are favorable Single celled organisms Mitosis Sexual Reproduction Takes more time to find a mate. Favorable for seasonal environments. Provides genetic diversity Multicellular organisms Meiosis

86 Mitosis Body cell copying Asexual Reproduction Cells make exact copies of themselves Contain full sets of chromosomes (Diploid) Meiosis Sexual reproduction Gamete production Sperm and Egg Contain half the regular number of chromosomes (Haploid)

87 During the cell cycle, the parent cell (having 2 chromosomes in the diagram) will produce two daughter cells (each containing 2 chromosomes in the diagram)

88 Body Cells Body cells are all cells other than sex cells Also called somatic cells Made by mitosis Body cells are diploid cells: they have 2 copies of every chromosome. (Think di = 2) Their chromosomes each have a matching chromosome (homologous pairs)

89 What is the diploid number of chromosomes in humans? 46! 23 pairs!

90

91 Sex Cells Also called gametes Eggs and sperm Made by meiosis Have haploid number of cells (N) Humans =23

92 What is meiosis? Asexual reproduction(relies on mitosis): all of the parents DNA gets copied and goes to the offspring. Sexual reproduction(relies on meiosis) Meiosis is cell division to form gametes (sex cells) Sperm: male gamete Egg: female gamete

93 Meiosis 1: Prophase 1 Homologous Chromosomes pair up in Prophase I. Crossing-Over: Sister chromatids cross over one another and exchange genes. HAPPENS ONLY IN PROPHASE I of Meiosis Does not make identical daughter cells due to shuffled genes in crossing-over

94 Crossing over example Which letter would result from a single crossover of the above homologous pair?

95 Fertilization A human sperm cell (gamete) has a haploid (N) number of chromosomes = 23. Once a haploid egg (N) is fertilized by a sperm it is called a zygote. The diploid (2N) number of chromosomes in a human zygote = 46.

96 Egg = haploid (N) Sperm = haploid (N) Humans =46 ZYGOTE = diploid (2N) Fertilized egg