From Gene to Protein. How Genes Work
|
|
|
- Thomasina Robbins
- 6 years ago
- Views:
Transcription
1 From Gene to Protein How Genes Work
2 Wht do genes code for? How does DNA code for cells & bodies? how re cells nd bodies mde from the instructions in DNA DNA proteins cells bodies
3 The Centrl Dogm Flow of genetic informtion in cell How do we move informtion from DNA to proteins? DNA RNA protein trit repliction DNA gets ll the glory, but proteins do ll the work!
4 Metbolism tught us bout genes Inheritnce of metbolic diseses suggested tht genes coded for enzymes ech disese (phenotype) is cused by non-functionl gene product lck of n enzyme Ty schs PKU (phenylketonuri) lbinism Am I just the sum of my proteins? metbolic pthwy disese disese disese disese A B C D E enzyme 1 enzyme 2 enzyme 3 enzyme 4
5 Bedle & Ttum one gene : one enzyme hypothesis George Bedle Edwrd Ttum "for their discovery tht genes ct by regulting definite chemicl events"
6 Bedle & Ttum Wild-type Neurospor X rys or ultrviolet light crete muttions Miniml medium spores sexul spores Growth on complete medium positive control Select one of the spores Test on miniml medium to confirm presence of muttion negtive control Grow on complete medium Miniml medi supplemented only with experimentls Pyridoxine Choline mino cid p-amino Inositol supplements benzoic cid Nucleic cid Folic cid Arginine Riboflvin Nicin Thimine Miniml control
7 From gene to protein DNA trnscription nucleus cytoplsm mrna trnsltion ribosome protein trit
8 Trnscription from DNA nucleic cid lnguge to RNA nucleic cid lnguge
9 RNA ribose sugr N-bses urcil insted of thymine U : A C : G single strnded lots of RNAs mrna, trna, rrna, sirna DNA trnscription RNA
10 Trnscription Mking mrna trnscribed DNA strnd = templte strnd untrnscribed DNA strnd = coding strnd sme sequence s RNA synthesis of complementry RNA strnd trnscription bubble enzyme RNA polymerse coding strnd 5 DNA C G 3 A G A T T C T A rewinding G C T A G G C C C G A A T T U A C C G G G C T U A A 3 T T A C G A C T A G T A T unwinding 3 5 build RNA 5 3 mrna 5 RNA polymerse templte strnd
11 RNA polymerses 3 RNA polymerse enzymes RNA polymerse 1 only trnscribes rrna genes mkes ribosomes RNA polymerse 2 trnscribes genes into mrna RNA polymerse 3 only trnscribes trna genes ech hs specific promoter sequence it recognizes
12 Which gene is red? Promoter region binding site before beginning of gene TATA box binding site binding site for RNA polymerse & trnscription fctors Enhncer region binding site fr upstrem of gene turns trnscription on HIGH
13 Trnscription Fctors Initition complex trnscription fctors bind to promoter region suite of proteins which bind to DNA hormones? turn on or off trnscription trigger the binding of RNA polymerse to DNA
14 Mtching bses of DNA & RNA Mtch RNA bses to DNA bses on one of the DNA strnds U G U C C G A A U A G A C U 5' A 3' RNA A C C G polymerse G C A G U A U C T G G T A C A G C T A G T C A T C G T A C C G T
15 Eukryotic genes hve junk! Eukryotic genes re not continuous exons = the rel gene expressed / coding DNA introns = the junk inbetween sequence introns come out! eukryotic DNA intron = noncoding (inbetween) sequence exon = coding (expressed) sequence
16 mrna splicing Post-trnscriptionl processing eukryotic mrna needs work fter trnscription primry trnscript = pre-mrna mrna splicing edit out introns mke mture mrna trnscript eukryotic DNA intron = noncoding (inbetween) sequence ~10,000 bse primry mrna trnscript mture mrna trnscript exon = coding (expressed) sequence pre-mrna spliced mrna ~1,000 bse
17 Discovery of exons/introns Richrd Roberts CSHL Philip Shrp MIT denovirus common cold bet-thlssemi
18 Splicing must be ccurte No room for mistkes! single bse dded or lost throws off the reding frme AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG CGG UCC GAU AAG GGC CAU Met Arg Ser Asp Lys Gly His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG CGG GUC CGA UAA GGG CCA U Met Arg Vl Arg STOP
19 RNA splicing enzymes snrnps smll nucler RNA proteins Spliceosome severl snrnps recognize splice site sequence cut & pste gene No, not smurfs! snurps exon snrna intron snrnps exon 5' 3' 5' 5' Who! I think we just broke biologicl rule! spliceosome 3' lrit 3' exon mture mrna 5' exon 3' excised intron
20 Alterntive splicing Alterntive mrnas produced from sme gene when is n intron not n intron different segments treted s exons Strting to get hrd to define gene!
21 More post-trnscriptionl processing Need to protect mrna on its trip from nucleus to cytoplsm enzymes in cytoplsm ttck mrna protect the ends of the molecule dd 5 GTP cp dd poly-a til longer til, mrna lsts longer: produces more protein 3' mrna A 5' G P P P
22 From gene to protein DNA trnscription nucleus cytoplsm mrna trnsltion ribosome protein trit
23 Trnsltion from nucleic cid lnguge to mino cid lnguge
24 How does mrna code for proteins? 4 DNA mrna 4 protein 20 ATCG AUCG TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC? Met Arg Vl Asn Al Cys Al How cn you code for 20 mino cids with only 4 nucleotide bses (A,U,G,C)?
25 mrna codes for proteins in triplets DNA mrna TACGCACATTTACGTACGCGG codon AUGCGUGUAAAUGCAUGCGCC? protein Met Arg Vl Asn Al Cys Al
26 Crcking the code Crick Nirenberg & Khorn determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT Nirenberg (47) & Khorn (17) determined mrna mino cid mtch dded fbricted mrna to test tube of ribosomes, trna & mino cids creted rtificil UUUUU mrna found tht UUU coded for phenyllnine
27 Mrshll Nirenberg Hr Khorn
28 The code Code for ALL life! strongest support for common origin for ll life Code is redundnt Why is the wobble good? severl codons for ech mino cid 3rd bse wobble Strt codon AUG methionine Stop codons UGA, UAA, UAG
29 How re the codons mtched to mino cids? DNA mrna trna mino cid TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC UAC Met 5 GCA Arg CAU Vl codon nti-codon 5 3
30 From gene to protein DNA trnscription nucleus cytoplsm mrna trnsltion ribosome protein trit
31 Trnsfer RNA structure Clover lef structure nticodon on clover lef end mino cid ttched on 3 end
32 Loding trna Aminocyl trna synthetse enzyme which bonds mino cid to trna bond requires energy ATP AMP bond is unstble so it cn relese mino cid t ribosome esily ctivting enzyme Trp C=O Trp C=O Trp OH H 2 O OH O O trna Trp nticodon tryptophn ttched to trna Trp A C C U G G mrna trna Trp binds to UGG condon of mrna
33 Ribosomes Fcilitte coupling of trna nticodon to mrna codon orgnelle or enzyme? Structure ribosoml RNA (rrna) & proteins 2 subunits lrge smll E P A
34 Ribosomes A site (minocyl-trna site) holds trna crrying next mino cid to be dded to chin P site (peptidyl-trna site) holds trna crrying growing polypeptide chin E site (exit site) empty trna leves ribosome from exit site 5' E U A C A U G P Met A 3'
35 Building polypeptide Initition brings together mrna, ribosome subunits, inititor trna Elongtion dding mino cids bsed on codon sequence Termintion end codon Met Leu Met Met Met Leu Leu Leu Vl Ser Al Trp relese fctor trna UAC GAC 5' UAC 5' UACGAC AA C AAU 5' AUG C UGAAU 5' mrna A UG C UG U AUG UG 3' 3' 3' E P A UAC GAC C AA U AUG UG 3' A CC U GG UA A 3'
36 Protein trgeting Signl peptide ddress lbel strt of secretory pthwy Destintions: secretion nucleus mitochondri chloroplsts cell membrne cytoplsm etc
37 DNA RNA polymerse Cn you tell the story? pre-mrna exon intron 5' GTP cp mino cids trna lrge ribosoml subunit mture mrna poly-a til polypeptide minocyl trna synthetse 3' 5' smll ribosoml subunit E P A trna ribosome
38 The Trnscriptionl unit (gene?) enhncer b 20-30b trnsltion strt exons trnsltion stop 3' RNA polymerse TATA TAC trnscriptionl unit (gene) ACT 5' DNA DNA UTR introns UTR promoter trnscription strt trnscription stop 5' 3' pre-mrna 5' 3' GTP mture mrna AAAAAAAA
39 Bcteril chromosome Protein Synthesis in Prokryotes Trnscription mrna Psssst no nucleus! Cell membrne Cell wll
40 Prokryote vs. Eukryote genes Prokryotes DNA in cytoplsm circulr chromosome nked DNA no introns Eukryotes DNA in nucleus liner chromosomes DNA wound on histone proteins introns vs. exons eukryotic DNA intron = noncoding (inbetween) sequence exon = coding (expressed) sequence introns come out!
41 Trnsltion in Prokryotes Trnscription & trnsltion re simultneous in bcteri DNA is in cytoplsm no mrna editing ribosomes red mrna s it is being trnscribed
42 Trnsltion: prokryotes vs. eukryotes Differences between prokryotes & eukryotes time & physicl seprtion between processes tkes eukryote ~1 hour from DNA to protein no RNA processing
43 Any Questions?? Wht color would smurf turn if he held his breth?
44 Substitute Slides for Student Print version
45 Cn you tell the story?
46 The Trnscriptionl unit enhncer b 20-30b exons 3' RNA polymerse TATA TAC trnscriptionl unit ACT 5' DNA introns 5' 3' 5' 3'
From Gene to Protein
From Gene to Protein Protein Synthesis: overview One gene-one enzyme hypothesis (Bedle nd Ttum) One gene-one polypeptide (protein) hypothesis Trnscription: synthesis of RNA under the direction of DNA (mrna)
What do genes code for?
From ene to Protein How enes Work 2007-2008 Wht do genes code for? How does code for cells & bodies? how re cells nd bodies mde from the instructions in proteins cells bodies he entrl Dogm Flow of genetic
What do genes code for? The Central Dogma. From gene to protein DNA. protein. trait RNA. Transcription 1/9/2015. From Gene to Protein.
Wht do genes code for? From ene to rotein How does code for cells & bodies? how re cells nd bodies mde from the instructions in How enes Work s cells bodies he entrl Dogm Flow of genetic informtion in
From Gene to Protein
From Gene to Protein Protein Synthesis: overview One gene-one enzyme hypothesis (Bedle nd Ttum) One gene-one polypeptide (protein) hypothesis Trnscription: synthesis of RNA under the direction of DNA (mrna)
From Gene to Protein: How Genes Work. AP Biology
From ene to Protein: How enes Work How does single fulty gene result in the drmtic ppernce of n lbino deer nd rcoon? ene expression, the process by which DN directs protein synthesis, includes two stges:
From Gene to Protein. How Genes Work (Ch. 17)
From Gene to Protein How Genes Work (Ch. 17) What do genes code for? How does DNA code for cells & bodies? how are cells and bodies made from the instructions in DNA DNA proteins cells bodies The Central
From Gene to Protein. How Genes Work
From Gene to Protein How Genes Work 2007-2008 The Central Dogma Flow of genetic information in a cell How do we move information from DNA to proteins? DNA RNA protein replication phenotype You! Step 1:
From DNA to Protein. Chapter 14
From DNA to Protein Chapter 14 What do genes code for? How does DNA code for cells & bodies? How are cells and bodies made from the instructions in DNA? DNA proteins cells bodies The Central Dogma Flow
Chapter 17. From Gene to Protein. AP Biology
Chapter 17. From Gene to Protein Metabolism teaches us about genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton) PKU (phenylketonuria)
Ch. 10 From DNA to Protein. AP Biology
Ch. 10 From DNA to Protein Protein Synthesis Metabolism and Gene Expression n Inheritance of metabolic diseases suggests that genes coded for enzymes n Diseases (phenotypes) caused by non-functional gene
CH 17 :From Gene to Protein
CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there
AP Biology
Chapter 17. From Gene to Protein Metabolism teaches us about genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton) PKU (phenylketonuria)
From Genes to Protein
From Genes to Protein Transcription and Translation Metabolism Teaches Us About Genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from
From Genes to Protein
From Genes to Protein Transcription and Translation Metabolism Teaches Us About Genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from
1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation
1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous
Protein Synthesis Making Proteins
Protein Synthesis Making Proteins 2009-2010 Bodies Cells DNA Bodies are made up of cells All cells run on a set of instructions spelled out in DNA DNA Cells Bodies How does DNA code for cells & bodies?
Protein Synthesis Making Proteins
Protein Synthesis Making Proteins 2009-2010 Bodies Cells DNA Bodies are made up of cells All cells run on a set of instructions spelled out in DNA DNA Cells Bodies How does DNA code for cells & bodies?
Degenerate Code. Translation. trna. The Code is Degenerate trna / Proofreading Ribosomes Translation Mechanism
Translation The Code is Degenerate trna / Proofreading Ribosomes Translation Mechanism Degenerate Code There are 64 possible codon triplets There are 20 naturally-encoding amino acids Several codons specify
Chapter 14 From Gene to Protein
Chapter 14 From Gene to Protein Metabolim Teache U About Gene Metabolic defect tudying metabolic dieae uggeted that gene pecified protein alkaptonuria (black urine from alkapton a.k.a. homogentiic acid
DNA is the MASTER PLAN. RNA is the BLUEPRINT of the Master Plan
Sec. 12-3 RNA and Protein Synthesis Roles of DNA and RNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 1 RNA uses the information from DNA to make proteins Differs from DNA: 1. Ribose
Division Ave. High School AP Biology
Division ve. High School Making s From ene to Protein How enes Work Organelles nucleus ribosomes endoplasmic reticulum (ER) olgi apparatus vesicles small nuclear pore ribosomal mrn large ribosomal cytoplasm
Biomolecules: lecture 6
Biomolecules: lecture 6 - to learn the basics on how DNA serves to make RNA = transcription - to learn how the genetic code instructs protein synthesis - to learn the basics on how proteins are synthesized
Chapter 17 From Gene to Protein
Chapter 17 From Gene to Protein Question? How does DNA control a cell? By controlling Protein Synthesis. Proteins are the link between genotype and phenotype. For tests: Name(s) of experimenters Outline
Protein Synthesis Honors Biology
Protein Synthesis What do we know? Metabolism is controlled by enzymes enzymes are proteins DNA contains the genetic information to build proteins. DNA is only in the nucleus. Ribosomes are not. How then
Chapter 17 From Gene to Protein
Chapter 17 From Gene to Protein Describe the structure of DNA. What is its elemental makeup? Name the subunit that makes up DNA. What components make up the DNA molecule? How are the two strands related
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
DNA Replication and Repair
DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands
6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA
6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA DNA mrna Protein DNA is found in the nucleus, but making a protein occurs at the ribosome
Human Gene,cs 06: Gene Expression. Diversity of cell types. How do cells become different? 9/19/11. neuron
Human Gene,cs 06: Gene Expression 20110920 Diversity of cell types neuron How do cells become different? A. Each type of cell has different DNA in its nucleus B. Each cell has different genes C. Each type
Protein Synthesis: Transcription and Translation
Review Protein Synthesis: Transcription and Translation Central Dogma of Molecular Biology Protein synthesis requires two steps: transcription and translation. DNA contains codes Three bases in DNA code
Gene function at the level of traits Gene function at the molecular level
Gene expression Gene function at the level of traits Gene function at the molecular level Two levels tied together since the molecular level affects the structure and function of cells which determines
Key Area 1.3: Gene Expression
Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?
Chapter 17. From Gene to Protein
Chapter 17 From Gene to Protein One Gene One Enzyme Hypothesis Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria Beadle
FROM GENE TO PROTEIN. One Gene One Enzyme Hypothesis 3/12/2013. Basic Principles of Transcription & Translation
One Gene One Enzyme Hypothesis FROM GENE TO PROTEIN C H A P T E R 1 7 Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria
RNA and PROTEIN SYNTHESIS. Chapter 13
RNA and PROTEIN SYNTHESIS Chapter 13 DNA Double stranded Thymine Sugar is RNA Single stranded Uracil Sugar is Ribose Deoxyribose Types of RNA 1. Messenger RNA (mrna) Carries copies of instructions from
Chapter 14. How many genes? Control of Eukaryotic Genome. Repetitive DNA. What about the rest of the DNA? Fragile X Syndrome
Chapter 14 Control of Eukaryotic Genome How many genes? Genes only ~3% of human genome protein-coding sequences 1% of human genome non-protein coding genes 2% of human genome trna ribosomal RNAs sirnas
DNA, RNA, and PROTEIN SYNTHESIS
DNA, RNA, and PROTEIN SYNTHESIS 1 DNA DNA contains genes, sequences of nucleotide bases The genes code for polypeptides (proteins) Proteins are used to build cells and do much of the work inside cells
Daily Agenda. Warm Up: Review. Translation Notes Protein Synthesis Practice. Redos
Daily Agenda Warm Up: Review Translation Notes Protein Synthesis Practice Redos 1. What is DNA Replication? 2. Where does DNA Replication take place? 3. Replicate this strand of DNA into complimentary
Lecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
PROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
Biomolecules: lecture 6
Biomolecules: lecture 6 - to learn the basics on how DNA serves to make RNA = transcription - to learn how the genetic code instructs protein synthesis - to learn the basics on how proteins are synthesized
Gene Expression: Transcription, Translation, RNAs and the Genetic Code
Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a
Protein Synthesis. Application Based Questions
Protein Synthesis Application Based Questions MRNA Triplet Codons Note: Logic behind the single letter abbreviations can be found at: http://www.biology.arizona.edu/biochemistry/problem_sets/aa/dayhoff.html
1. Overview of Gene Expression
Chapter 17: From Gene to 1. Overview of Gene Expression 2. Transcription 3. The Genetic Code 4. Translation 5. Mutations 1. Overview of Gene Expression Chapter Reading pp. 334-337 How are Genes related
The Genetic Code: Translation. Pre-class reading Chapter 17: Pages
The Genetic Code: Translation Pre-class reading Chapter 17: Pages 336-348 Nomenclature needed: Translation RN (m, t, r) Signal peptide sequence Mutations Ribosomes + Polyribosomes Codon (triplet code)
PROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.
Ch 17 Practice Questions MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) Garrod hypothesized that "inborn errors of metabolism" such as alkaptonuria
Lecture 19A. DNA computing
Lecture 19A. DNA computing What exactly is DNA (deoxyribonucleic acid)? DNA is the material that contains codes for the many physical characteristics of every living creature. Your cells use different
I. Gene Expression Figure 1: Central Dogma of Molecular Biology
I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases
The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Genetic Code. Genes and How They Work
Genes and How They Work Chapter 15 Early ideas to explain how genes work came from studying human diseases. Archibald Garrod studied alkaptonuria, 1902 Garrod recognized that the disease is inherited via
Chapter 17 From Gene to Protein
Chapter 17 From Gene to Protein The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific traits
Chapter Twelve Protein Synthesis: Translation of the Genetic Message
Mary K. Campbell Shawn O. Farrell international.cengage.com/ Chapter Twelve Protein Synthesis: Translation of the Genetic Message Paul D. Adams University of Arkansas 1 Translating the Genetic Message
Genes and How They Work. Chapter 15
Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central
Bioinformatics CSM17 Week 6: DNA, RNA and Proteins
Bioinformatics CSM17 Week 6: DNA, RNA and Proteins Transcription (reading the DNA template) Translation (RNA -> protein) Protein Structure Transcription - reading the data enzyme - transcriptase gene opens
Level 2 Biology, 2017
91159 911590 2SUPERVISOR S Level 2 Biology, 2017 91159 Demonstrate understanding of gene expression 2.00 p.m. Wednesday 22 November 2017 Credits: Four Achievement Achievement with Merit Achievement with
The Flow of Genetic Information
Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins
Fig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
Chapter 10: Gene Expression and Regulation
Chapter 10: Gene Expression and Regulation Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are the workhorses but contain no information THUS Information in DNA must
Chapter 14: Gene Expression: From Gene to Protein
Chapter 14: Gene Expression: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect
Honors packet Instructions
Honors packet Instructions The following are guidelines in order for you to receive FULL credit for this bio packet: 1. Read and take notes on the packet in full 2. Answer the multiple choice questions
Chapter 10. The Structure and Function of DNA. Lectures by Edward J. Zalisko
Chapter 10 The Structure and Function of DNA PowerPoint Lectures for Campbell Essential Biology, Fifth Edition, and Campbell Essential Biology with Physiology, Fourth Edition Eric J. Simon, Jean L. Dickey,
Protein Synthesis. DNA to RNA to Protein
Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.
Chapter 17. From Gene to Protein
Chapter 17 From Gene to Protein Overview: The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific
The combination of a phosphate, sugar and a base forms a compound called a nucleotide.
History Rosalin Franklin: Female scientist (x-ray crystallographer) who took the picture of DNA James Watson and Francis Crick: Solved the structure of DNA from information obtained by other scientist.
7.016 Problem Set 3. 1 st Pedigree
7.016 Problem Set 3 Question 1 The following human pedigree shows the inheritance pattern of a specific disease within a family. Assume that the individuals marrying into the family for all generations
From Gene to Protein. Chapter 17
From Gene to Protein Chapter 17 What you need to know: The key terms: gene expression, transcription, and translation. The major events of transcription. How eukaryotic cells modify RNA after transcription.
Station 1: DNA Structure Use the figure above to answer each of the following questions. 1.This is the subunit that DNA is composed of. 2.
1. Station 1: DNA Structure Use the figure above to answer each of the following questions. 1.This is the subunit that DNA is composed of. 2.This subunit is composed of what 3 parts? 3.What molecules make
The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16
Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes
Chapter 17: From Gene to Protein
Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master
RNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013
RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein
A Zero-Knowledge Based Introduction to Biology
A Zero-Knowledge Based Introduction to Biology Konstantinos (Gus) Katsiapis 25 Sep 2009 Thanks to Cory McLean and George Asimenos Cells: Building Blocks of Life cell, membrane, cytoplasm, nucleus, mitochondrion
A. Incorrect! This feature does help with it suitability as genetic material.
College Biology - Problem Drill 08: Gene Structures and Functions No. 1 of 10 1. Which of the statements below is NOT true in explaining why DNA is a suitable genetic material? #01 (A) Its double helix
Fermentation. Lesson Overview. Lesson Overview 13.1 RNA
13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to
Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.
Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)
Analyzed Fungi Neurospora crassa mutants. Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated:
From Gene to Protein Beadle and Tatum Analyzed Fungi Neurospora crassa mutants Mutants were UNABLE to grow without Arginine (an amino acid) Other biochemical experiments indicated: Precursor Ornithine
From DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
BIOLOGY. Chapter 15 Genes & Proteins
BIOLOGY Chapter 15 Genes & Proteins CMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 17 Protein Synthesis 2014 Pearson Education, Inc. Fig. 17-1 Figure 17.1a n albino racoon Condition
Chapter 7: Genetics Lesson 7.1: From DNA to Proteins
Chapter 7: Genetics Lesson 7.1: From DNA to Proteins The spiral structure in the picture is a large organic molecule. Can you guess what it is? Here s a hint: molecules like this one determine who you
Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded
Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by
The Central Dogma. DNA makes RNA makes Proteins
The Central Dogma DNA makes RNA makes Proteins TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION OF
(a) Which enzyme(s) make 5' - 3' phosphodiester bonds? (c) Which enzyme(s) make single-strand breaks in DNA backbones?
EXAMPLE QUESTIONS AND ANSWERS 1. Topoisomerase does which one of the following? (a) Makes new DNA strands. (b) Unties knots in DNA molecules. (c) Joins the ends of double-stranded DNA molecules. (d) Is
Chapter 17: From Gene to Protein
Name Period Chapter 17: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to
Molecular Genetics. Before You Read. Read to Learn
12 Molecular Genetics section 3 DNA,, and Protein DNA codes for, which guides protein synthesis. What You ll Learn the different types of involved in transcription and translation the role of polymerase
The Structure of RNA. The Central Dogma
12-3 12-3 RNA and Protein Synthesis The Structure of RNA The Central Dogma Phenotype A gene is a SEQUENCE of DNA that codes for a protein (or functional RNA). Phenotype is the individual s observable trait
Replication, Transcription, and Translation
Replication, Transcription, and Translation Information Flow from DNA to Protein The Central Dogma of Molecular Biology Replication is the copying of DNA in the course of cell division. Transcription is
BIO 311C Spring Lecture 36 Wednesday 28 Apr.
BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through
Chemistry 121 Winter 17
Chemistry 121 Winter 17 Introduction to Organic Chemistry and Biochemistry Instructor Dr. Upali Siriwardane (Ph.D. Ohio State) E-mail: upali@latech.edu Office: 311 Carson Taylor Hall ; Phone: 318-257-4941;
Gene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
A Little More Advanced Biotechnology Tools. Engineered plasmids. Selection for plasmid uptake. Better Plasmids. Antibiotic becomes a selecting agent
A Little More Advnced Biotechnology Tools Better Plsmids Engineered plsmids Building custom plsmids restriction enzyme sites ntibiotic resistnce genes s selectble mrker EcoRI BmHI HindIII restriction sites
DNA REPLICATION. DNA structure. Semiconservative replication. DNA structure. Origin of replication. Replication bubbles and forks.
DNA REPLICATION 5 4 Phosphate 3 DNA structure Nitrogenous base 1 Deoxyribose 2 Nucleotide DNA strand = DNA polynucleotide 2004 Biology Olympiad Preparation Program 2 2004 Biology Olympiad Preparation Program
ANCIENT BACTERIA? 250 million years later, scientists revive life forms
ANCIENT BACTERIA? 250 million years later, scientists revive life forms Thursday, October 19, 2000 U.S. researchers say they have revived bacteria that have been dormant for more then 250 million years,
MOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1
AP BIOLOGY MOLECULAR GENETICS ACTIVITY #2 NAME DATE HOUR PROTEIN SYNTHESIS Molecular Genetics Activity #2 page 1 GENETIC CODE PROTEIN SYNTHESIS OVERVIEW Molecular Genetics Activity #2 page 2 PROTEIN SYNTHESIS
Deoxyribonucleic Acid DNA. Structure of DNA. Structure of DNA. Nucleotide. Nucleotides 5/13/2013
Deoxyribonucleic Acid DNA The Secret of Life DNA is the molecule responsible for controlling the activities of the cell It is the hereditary molecule DNA directs the production of protein In 1953, Watson
7.2 Protein Synthesis. From DNA to Protein Animation
7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They
UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS
UNIT (12) MOLECULES OF LIFE: NUCLEIC ACIDS Nucleic acids are extremely large molecules that were first isolated from the nuclei of cells. Two kinds of nucleic acids are found in cells: RNA (ribonucleic
From Gene to Protein
Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp
Unit 1. DNA and the Genome
Unit 1 DNA and the Genome Gene Expression Key Area 3 Vocabulary 1: Transcription Translation Phenotype RNA (mrna, trna, rrna) Codon Anticodon Ribosome RNA polymerase RNA splicing Introns Extrons Gene Expression
CONVERGENT EVOLUTION. Def n acquisition of some biological trait but different lineages
CONVERGENT EVOLUTION Def n acquisition of some biological trait but different lineages Living Rock cactus Baseball plant THE QUESTION From common ancestor or independent acquisition? By Lineage By Convergence