Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination.
|
|
|
- Joshua Griffin
- 6 years ago
- Views:
Transcription
1 Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination. Seeds of Col-0 were harvested from plants grown at 16 C, stored for 2 months, imbibed for indicated time periods in water with 1 mm KCl (black line) or KNO 3 (red line). qrt-pcr was performed with three independent biological replicates. Expression levels were normalized by that of At1g Averages of relative expression are shown with SD (n=3).
2 Supplementary Figure 2 Construction of the near isogenic line, nlp8-2/cvi. Location of genetic markers is shown on the five Arabidopsis chromosomes (From I to V). The nlp8-2 mutant in Col background was crossed to Cvi four times to obtain the nlp8-2 mutant in Cvi background. The nlp8-2/cvi line was confirmed that all tested markers, except for NLP8, showed the Cvi/Cvi homozygote. The nlp8-2 locus is indicated by red, while other genetic markers are indicated by blue. The method to create genetic markers distinguishing between Col and Cvi genomic regions is described in Methods, and marker information is in Supplementary Data 2.
3 Supplementary Figure 3 The effect of stratification on germination of the nlp8 mutant. Seeds of Col-0, nlp8-1, nlp8-2, nlp8-2nlp9-1 mutants were harvested from plants grown at 16 C, stored for 2 months. Germination test was performed using biological triplicates, and radicle protrusion through endosperm was counted 7 days after sowing. Percentage of germination in water with KCl without stratification (white bar), with KNO 3 without stratification (lined bar), and with KCl with stratification for 4 days (blue bar) is shown with SD (n=3).
4 Supplementary Figure 4 Nitrate-regulated genes in 6-hour imbibed seeds in Col-0 or nlp8-2 mutant. Seeds were imbibed in water with 1mM KCl or KNO 3 for 6 hours and RNA were extracted for RNA-seq. The readouts from KNO 3 -treated seeds were normalized by those from KCl control and a mean of two biological repeats was used to generate a heatmap.
5 Supplementary Figure 5 Expression of ABA- and GA-related genes in 6-hour imbibed Col-0 and nlp8 mutant seeds. The numbers in the heatmap indicate the expression values from the RNA-seq data.
6 Supplementary Figure 6 qrt-pcr expression analysis of misexpressed genes in 6-hour imbibed nlp8 mutant seeds Seeds of Col-0 and nlp8-2 mutant were harvested from plants grown at 16 C, stored for 2 months, imbibed for 6 hours in water with 1 mm KCl (white bar) or KNO 3 (lined bar). qrt-pcr was performed with four biological replicates. Expression levels were normalized by that of At1g Averages of relative expression relative to those in Col-0 seeds treated with KCl are shown with SD (n=4). * and ** indicate P <0.05 and P <0.01 (Student s t-test), respectively.
7 Supplementary Figure 7 qrt-pcr expression analysis of nitrate responsive genes in 6-hour imbibed Col-0 and nlp8 mutant seeds. Seeds of Col-0 and nlp8-2 mutant were harvested from plants grown at 16 C, stored for 2 months, imbibed for 6 hours in water with 1 mm KCl (white bar) or KNO 3 (lined bar). qrt-pcr was performed with three independent biological replicates. Expression levels were normalized by that of At1g Averages of relative expression of nitrate up-regulated gene (HYH) and down-regulated genes (At5g49640, At5g24352, and At2g42740) are shown with SD (n=3). * and ** indicate P <0.05 and P <0.01 (Student s t-test), respectively.
8 Supplementary Figure 8 Promoter deletion analysis to identify the region responsible for NLP8-dependent gene expression The deletion series of CYP707A2 promoters were fused to the LUC reporter gene, and the promoter activities were examined in a protoplast system. The top graph indicates the promoter activities of deleted CYP707A2 promoters when transiently expressing NLP8 under KCl treatment (white bar) and nitrate treatment (lined bar), while the bottom graph indicates the promoter activities transiently expressing NLP8 (lined bar) and the control ACT2 (white bar) under nitrate treatment. The promoter length of each construct is as follows: A2, 1887-bp; d1, 1661-bp; d1.2, 1638-bp; d1.3, 1615-bp; d1.4, 1589-bp; d1.5, 1549-bp; d3, 741-bp. 35S:GUS construct was co-introduced with NLP8 or ACTIN2, and the LUC activities were normalized by GUS activities. Three independent experiments were performed, and averages of relative expression are shown with SD. ** indicates the P value <0.01 by Student s t-test.
9 Supplementary Figure 9 The RWP-RK domain of NLP8 binds to the NRE of the CYP707A2 promoter. (a) A biotin-labeled probe containing 2 copies of d1-d1.5 (1.5ng) and RWP-RK domain of NLP8 (200 ng) were used for each EMSA reaction and separated in a 5% native PAGE gel. Competitors were 2 copies of d1-d1.5 fragment without biotin labeling. KNO3 was added to 10 mm as a final concentration. A red star indicates the shifted band, while the black stars indicate the signal from free probe. (b) The full image of the blot shown in Fig. 5f.
10 Supplementary Figure 10 The effect of 35S::NLP8 on the chl1-5 mutation during germination. Seeds of Col-0, chl1-5, nlp8-2, chl1-5nlp8-2 mutants and 35S::NLP8 chl1-5 line were harvested from plants grown at 16 C, stored for 2 months. Germination test was performed using biological triplicates, and radicle protrusion through endosperm was counted 7 days after sowing. Percentage of germination under indicated KNO 3 concentrations is shown with SD. The numbers of biological replicates analyzed were as follows: Col-0, n=6; chl1-5, n=6; 35S::NLP8chl1-5, n=6; nlp8-2, n=4; chl1-5nlp8-2, n=4.
11 Supplementary Figure 11 Nitrate-induced reporter expression. GUS staining of transgenic lines harboring both effector (NLP8N-LexA_DB-YFP) and reporter (LexAOP-35Smini::GUS). Seven-day-old seedlings grown on KCl plate were transferred to liquid medium containing 3 mm KCl or KNO 3 for 4 hours and subjected to GUS staining. A bar indicates 5 mm.
12 Supplementary Figure 12 Expression of NLP8 in 35S::NLP8-GFP lines. Seeds of 35S::NLP8-GFP were harvested from plants grown at 16 C, stored for 2 months, imbibed for 6 hours in water with 1 mm KCl. qrt-pcr was performed with three biological replicates. Expression levels were normalized by that of At1g Three lines showed similar results when analyzed. Data for line OX#6 is shown in the main figures. Averages of relative expression are shown with SD (n=3). * and ** indicate P <0.05 and P <0.01 (Student s t-test), respectively.
13 Supplementary Figure 13 Expression stability of 4 reference genes. qrt-pcr expression analysis was performed on 4 Arabidopsis reference genes published previously with cdna from Col-0 and nlp8-2 seeds imbibed in KCl or KNO 3 for 6 hours. Expression stability was analyzed by genorm algorithm. Less M values indicate more stable as reference genes.
Supplemental Data. Na Xu et al. (2016). Plant Cell /tpc
Supplemental Figure 1. The weak fluorescence phenotype is not caused by the mutation in At3g60240. (A) A mutation mapped to the gene At3g60240. Map-based cloning strategy was used to map the mutated site
SUPPLEMENTARY INFORMATION
AS-NMD modulates FLM-dependent thermosensory flowering response in Arabidopsis NATURE PLANTS www.nature.com/natureplants 1 Supplementary Figure 1. Genomic sequence of FLM along with the splice sites. Sequencing
Supplemental Data. Hu et al. Plant Cell (2017) /tpc
1 2 3 4 Supplemental Figure 1. DNA gel blot analysis of homozygous transgenic plants. (Supports Figure 1.) 5 6 7 8 Rice genomic DNA was digested with the restriction enzymes EcoRⅠ and BamHⅠ. Lanes in the
Supplementary Information. c d e
Supplementary Information a b c d e f Supplementary Figure 1. atabcg30, atabcg31, and atabcg40 mutant seeds germinate faster than the wild type on ½ MS medium supplemented with ABA (a and d-f) Germination
Supplementary Materials: 1. Supplementary Figures S1-S9. 2. Supplementary Tables S1-S2
Supplementary Materials: 1. Supplementary Figures S1-S9 2. Supplementary Tables S1-S2 S1 1. Supplementary Figures Fig. S1. Genotypes of tcp20 mutants. Fig. S2. Root phenotypes of tcp20 mutants. Fig. S3.
Construction of plant complementation vector and generation of transgenic plants
MATERIAL S AND METHODS Plant materials and growth conditions Arabidopsis ecotype Columbia (Col0) was used for this study. SALK_072009, SALK_076309, and SALK_027645 were obtained from the Arabidopsis Biological
Supplementary Information
Supplementary Information Supplementary Fig. 1. Seed dormancy and germination responses of RVE1 and PIF1. (a) Diagram of RVE1 and the T-DNA insertion of the rve1-2 mutant (SAIL_326_A01). Black boxes represent
Supplemental Data. Jing et al. (2013). Plant Cell /tpc
Supplemental Figure 1. Characterization of epp1 Mutants. (A) Cotyledon angles of 5-d-old Col wild-type (gray bars) and epp1-1 (black bars) seedlings under red (R), far-red (FR) and blue (BL) light conditions,
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc..4. A B Supplemental Figure. Immunoblot analysis verifies the expression of the AD-PP2C and BD-RGLG proteins in the Y2H assay. Total proteins were extracted
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified by primers used for mrna expression analysis. Gray
Supplemental Data. Wang et al. Plant Cell. (2013) /tpc
SNL1 SNL Supplemental Figure 1. The Expression Patterns of SNL1 and SNL in Different Tissues of Arabidopsis from Genevestigator Web Site (https://www.genevestigator.com/gv/index.jsp). 1 A 1. 1..8.6.4..
Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh
Developmental Cell, Volume 22 Supplemental Information Control of Seed Germination by Light-Induced Histone Arginine Demethylation Activity Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon
AD BD TOC1. Supplementary Figure 1: Yeast two-hybrid assays showing the interaction between
AD X BD TOC1 AD BD X PIFΔAD PIF TOC1 TOC1 PIFΔAD PIF N TOC1 TOC1 C1 PIFΔAD PIF C1 TOC1 TOC1 C PIFΔAD PIF C TOC1 Supplementary Figure 1: Yeast two-hybrid assays showing the interaction between PIF and TOC1
Supplementary Figure 1. BES1 specifically inhibits ABA responses in early seedling
Supplementary Figure 1. BES1 specifically inhibits ABA responses in early seedling development. a. Exogenous BR application overcomes the hypersensitivity of bzr1-1d seedlings to ABA. Seed germination
Supplemental Data. Sethi et al. (2014). Plant Cell /tpc
Supplemental Data Supplemental Figure 1. MYC2 Binds to the E-box but not the E1-box of the MPK6 Promoter. (A) E1-box and E-box (wild type) containing MPK6 promoter fragment. The region shown in red denotes
Nature Genetics: doi: /ng Supplementary Figure 1. ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets.
Supplementary Figure 1 ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets. Gene structures are shown underneath each panel. Supplementary Figure 2 pref6::ref6-gfp complements
Supplemental Data. Cui et al. (2012). Plant Cell /tpc a b c d. Stem UBC32 ACTIN
A Root Stem Leaf Flower Silique Senescence leaf B a b c d UBC32 ACTIN C * Supplemental Figure 1. Expression Pattern and Protein Sequence of UBC32 Homologues in Yeast, Human, and Arabidopsis. (A) Expression
A Repressor Complex Governs the Integration of
Developmental Cell 15 Supplemental Data A Repressor Complex Governs the Integration of Flowering Signals in Arabidopsis Dan Li, Chang Liu, Lisha Shen, Yang Wu, Hongyan Chen, Masumi Robertson, Chris A.
ABI3 Controls Embryo De-greening Through Mendel's I locus
Supporting Online Material for ABI3 Controls Embryo De-greening Through Mendel's I locus Frédéric Delmas a,b,c, Subramanian Sankaranarayanan d, Srijani Deb d, Ellen Widdup d, Céline Bournonville b,c,norbert
Supplementary Material
Fig S1. Interactions of OsDof24 with the OsC4PPDK promoter in rice protoplasts (a) Loss-of-function analysis of the OsC4PPDK promoter Effects of OsDof24 overexpression and the mapping of OsDof24-binding
To investigate the heredity of the WFP gene, we selected plants that were homozygous
Supplementary information Supplementary Note ST-12 WFP allele is semi-dominant To investigate the heredity of the WFP gene, we selected plants that were homozygous for chromosome 1 of Nipponbare and heterozygous
- 1 - Supplemental Data
- 1-1 Supplemental Data 2 3 4 5 6 7 8 9 Supplemental Figure S1. Differential expression of AtPIP Genes in DC3000-inoculated plants. Gene expression in leaves was analyzed by real-time RT-PCR and expression
Supplemental Data. Benstein et al. (2013). Plant Cell /tpc
Supplemental Figure 1. Purification of the heterologously expressed PGDH1, PGDH2 and PGDH3 enzymes by Ni-NTA affinity chromatography. Protein extracts (2 µl) of different fractions (lane 1 = total extract,
Supplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity.
Supplemental Figure 1 HDA18 has an HDAC domain and therefore has concentration dependent and TSA inhibited histone deacetylase activity. (A) Amino acid alignment of HDA5, HDA15 and HDA18. The blue line
Supplementary information, Figure S1
Supplementary information, Figure S1 (A) Schematic diagram of the sgrna and hspcas9 expression cassettes in a single binary vector designed for Agrobacterium-mediated stable transformation of Arabidopsis
Supplementary Information
Supplementary Information MED18 interaction with distinct transcription factors regulates plant immunity, flowering time and responses to hormones Supplementary Figure 1. Diagram showing T-DNA insertion
Supplementary Methods
Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed
Supplemental Data. Zhou et al. (2016). Plant Cell /tpc
Supplemental Figure 1. Confirmation of mutant mapping results. (A) Complementation assay with stably transformed genomic fragments (ComN-N) (2 kb upstream of TSS and 1.5 kb downstream of TES) and CaMV
Supplementary Fig 1. The responses of ERF109 to different hormones and stresses. (a to k) The induced expression of ERF109 in 7-day-old Arabidopsis
Supplementary Fig 1. The responses of ERF109 to different hormones and stresses. (a to k) The induced expression of ERF109 in 7-day-old Arabidopsis seedlings expressing ERF109pro-GUS. The GUS staining
Supplemental Figure legends Figure S1. (A) (B) (C) (D) Figure S2. Figure S3. (A-E) Figure S4. Figure S5. (A, C, E, G, I) (B, D, F, H, Figure S6.
Supplemental Figure legends Figure S1. Map-based cloning and complementation testing for ZOP1. (A) ZOP1 was mapped to a ~273-kb interval on Chromosome 1. In the interval, a single-nucleotide G to A substitution
SUPPLEMENTARY INFORMATION
Gene replacements and insertions in rice by intron targeting using CRISPR Cas9 Table of Contents Supplementary Figure 1. sgrna-induced targeted mutations in the OsEPSPS gene in rice protoplasts. Supplementary
Supplemental Data. Farmer et al. (2010) Plant Cell /tpc
Supplemental Figure 1. Amino acid sequence comparison of RAD23 proteins. Identical and similar residues are shown in the black and gray boxes, respectively. Dots denote gaps. The sequence of plant Ub is
Nature Genetics: doi: /ng.3556 INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE. Supplementary Figure 1
INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE Supplementary Figure 1 REF6 expression in transgenic lines. (a,b) Expression of REF6 in REF6-HA ref6 and REF6ΔZnF-HA ref6 plants detected by RT qpcr (a) and immunoblot
Supplementary Figure 1 Collision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK2, PPK3 and PPK4 respectively.
Supplementary Figure 1 lision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK, PPK3 and PPK respectively. % of nuclei with signal / field a 5 c ppif3:gus pppk1:gus 0 35 30 5 0 15 10
A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Journal of Plant Research A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana Linna Leng 1 Qianqian Liang
Supplemental Data. Dai et al. (2013). Plant Cell /tpc Absolute FyPP3. Absolute
A FyPP1 Absolute B FyPP3 Absolute Dry seeds Imbibed 24 hours Dry seeds Imbibed 24 hours C ABI5 Absolute Dry seeds Imbibed 24 hours Supplemental Figure 1. Expression of FyPP1, FyPP3 and ABI5 during seed
Nature Genetics: doi: /ng Supplementary Figure 1. High-confidence PRC2 targets and candidate PREs.
Supplementary Figure 1 High-confidence PRC2 targets and candidate PREs. (a) Flowchart for identification of candidate Arabidopsis PREs. We identified 1504 genomic regions marked by at least 3 of the following:
SUPPLEMENTARY INFORMATION
doi:10.1038/nature09861 & &' -(' ()*+ ')(+,,(','-*+,&,,+ ',+' ' 23,45/0*6787*9:./09 ;78?4?@*+A786?B- &' )*+*(,-* -(' ()*+ ')(+,,(','-*+,&,,+ ',+'./)*+*(,-*..)*+*(,-*./)*+*(,-*.0)*+*(,-*..)*+*(,-*
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: Supplementary Figure 1. dcas9-mq1 fusion protein induces de novo
IDN1 and IDN2: two proteins required for de novo DNA methylation in Arabidopsis thaliana.
IDN1 and IDN2: two proteins required for de novo DNA methylation in Arabidopsis thaliana. Israel Ausin, Todd C. Mockler, Joanne Chory, and Steven E. Jacobsen Col Ler nrpd1a rdr2 dcl3-1 ago4-1 idn1-1 idn2-1
Supplementary information, Data S1 MATERIALS AND METHODS. Growth of Arabidopsis and rice plants
Supplementary information, Data S1 MATERIALS AND METHODS Growth of Arabidopsis and rice plants Arabidopsis thaliana ecotype Columbia (Col-0) was used in all experiments. Seeds were sown on MS plates and
Zhang et al., RepID facilitates replication Initiation. Supplemental Information:
Supplemental Information: a b 1 Supplementary Figure 1 (a) DNA sequence of all the oligonucleotides used in this study. Only one strand is shown. The unshaded nucleotide sequences show changes from the
sides of the aleurone (Al) but it is excluded from the basal endosperm transfer layer
Supplemental Data. Gómez et al. (2009). The maize transcription factor MRP-1 (Myb-Related-Protein-1) is a key regulator of the differentiation of transfer cells. Supplemental Figure 1. Expression analyses
Supplemental Figure 1. Rosette Leaf Morphology of Single, Double and Triple Mutants of eid3, phya-201 and phyb-5. Photographs of Ler wild type,
Supplemental Figure 1. Rosette Leaf Morphology of Single, Double and Triple Mutants of eid3, phya-201 and phyb-5. Photographs of Ler wild type, phya-201, phyb-5, phya-201 phyb-5, eid3, phya-201 eid3, phyb-5
Supplemental Data. Zhang et al. Plant Cell (2014) /tpc
Supplemental Data. Zhang et al. Plant Cell (214) 1.115/tpc.114.134163 55 - T C N SDIRIP1-GFP 35-25 - Psb 18 - Histone H3 Supplemental Figure 1. Detection of SDIRIP1-GFP in the nuclear fraction by Western
Fig. S1. Clustering analysis of expression array and ChIP-PCR assay in the ARF3 locus. (A) Typical examples of the transgenic plants used for
Fig. S1. Clustering analysis of expression array and ChIP-PCR assay in the ARF3 locus. (A) Typical examples of the transgenic plants used for ChIP-chip and ChIP-PCR assays. The presence of pas1:t7:as1
Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.
Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying
Supplemental Figure 1. Floral commitment in Arabidopsis WT and mutants.
Percentage of induction Supplemental Data. Torti et al. (2012). Plant Cell 10.1105/tpc.111.092791 A +0 +0 LD LDs +1 LDs +3 +3 LDs +5 +5 LDs LD 50 μm AP1 B C 140 120 100 80 60 40 20 0-20 -40 wt Col soc1-2
Supplementary Figure 1
Supplementary Figure 1 Supplementary Fig. 1 shrna mediated knockdown of ZRSR2 in K562 and 293T cells. (a) ZRSR2 transcript levels in stably transduced K562 cells were determined using qrt-pcr. GAPDH was
Experimental Tools and Resources Available in Arabidopsis. Manish Raizada, University of Guelph, Canada
Experimental Tools and Resources Available in Arabidopsis Manish Raizada, University of Guelph, Canada Community website: The Arabidopsis Information Resource (TAIR) at http://www.arabidopsis.org Can order
Supplemental Data. Furlan et al. Plant Cell (2017) /tpc
Supplemental Data. Furlan et al. Plant Cell (0) 0.0/tpc..00. Supplemental Data. Furlan et al. Plant Cell (0) 0.0/tpc..00. Supplemental Data. Furlan et al. Plant Cell (0) 0.0/tpc..00. Supplemental Figure.
Supplemental Data Supplemental Figure 1.
Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)
Supplementary Figures 1-12
Supplementary Figures 1-12 Supplementary Figure 1. The specificity of anti-abi1 antibody. Total Proteins extracted from the wild type seedlings or abi1-3 null mutant seedlings were used for immunoblotting
Supplemental Data. Hachez et al. Plant Cell (2014) /tpc Suppl. Figure 1A
Suppl. Figure 1A Suppl. Figure 1B Supplemental Figure 1: Results of the commercial screening of interactants using split ubiquitin technique. (A) Isolated preys (192) using the bait construct pbt3-n- as
Schematic representation of the endogenous PALB2 locus and gene-disruption constructs
Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying
Supplemental materials
Supplemental materials Materials and methods for supplemental figures Yeast two-hybrid assays TAP46-PP2Ac interactions I. The TAP46 was used as the bait and the full-length cdnas of the five C subunits
B. Transgenic plants with strong phenotype (%)
A. TCTAGTTGTTGTTGTTATGGTCTAGTTGTTGTTGTTATGGTCTAATTT AAATATGGTCTAAAGAAGAAGAATATGGTCTAAAGAAGAAGAATATGG 2XP35S STTM165 5 GGGGGATGAAGctaCCTGGTCCGA3 3 CCCCCUACUUC---GGACCAGGCU5 mir165 HindIII mir165 96 nt GTTGTTGTTGTTATGGTCTAGTTGTTGTTGTTATGGTCTAATTT
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature10928 Materials and Methods 1. Plant material and growth conditions. All plant lines used were in Col-0 background unless otherwise specified. pif4-101 mutant
Intron distance to transcription start (nt)*
Schwab et al. SOM: Enhanced microrna accumulation through stemloop-adjacent introns 1 Supplemental Table 1. Characteristics of introns used in this study Intron name Length intron (nt) Length cloned fragment
Chemical hijacking of auxin signaling with an engineered auxin-tir1
1 SUPPLEMENTARY INFORMATION Chemical hijacking of auxin signaling with an engineered auxin-tir1 pair Naoyuki Uchida 1,2*, Koji Takahashi 2*, Rie Iwasaki 1, Ryotaro Yamada 2, Masahiko Yoshimura 2, Takaho
S156AT168AY175A (AAA) were purified as GST-fusion proteins and incubated with GSTfused
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 Supplemental Materials Supplemental Figure S1 (a) Phenotype of the wild type and grik1-2 grik2-1 plants after 8 days in darkness.
Supplementary Information
Supplementary Information COP1 E3 ligase protects HYL1 to retain microrna biogenesis Seok Keun Cho 1, Samir Ben Chaabane 1, Pratik Shah 1, Christian Peter Poulsen 1, and Seong Wook Yang 1 * 1 Laboratory
GTTCGGGTTCC TTTTGAGCAG
Supplementary Figures Splice variants of the SIP1 transcripts play a role in nodule organogenesis in Lotus japonicus. Wang C, Zhu H, Jin L, Chen T, Wang L, Kang H, Hong Z, Zhang Z. 5 UTR CDS 3 UTR TCTCAACCATCCTTTGTCTGCTTCCGCCGCATGGGTGAGGTCATTTTGTCTAGATGACGTGCAATTTACAATGA
Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected
Supplementary Figure 1. (a) The qrt-pcr for lnc-2, lnc-6 and lnc-7 RNA level in DU145, 22Rv1, wild type HCT116 and HCT116 Dicer ex5 cells transfected with the sirna against lnc-2, lnc-6, lnc-7, and the
Activation of a Floral Homeotic Gene in Arabidopsis
Activation of a Floral Homeotic Gene in Arabidopsis By Maximiliam A. Busch, Kirsten Bomblies, and Detlef Weigel Presentation by Lis Garrett and Andrea Stevenson http://ucsdnews.ucsd.edu/archive/graphics/images/image5.jpg
WiscDsLox485 ATG < > //----- E1 E2 E3 E4 E bp. Col-0 arr7 ARR7 ACTIN7. s of mrna/ng total RNA (x10 3 ) ARR7.
A WiscDsLox8 ATG < > -9 +0 > ---------//----- E E E E E UTR +9 UTR +0 > 00bp B S D ol-0 arr7 ol-0 arr7 ARR7 ATIN7 D s of mrna/ng total RNA opie 0. ol-0 (x0 ) arr7 ARR7 Supplemental Fig.. Genotyping and
Supplementary Materials
Supplementary Materials Table S1. Oligonucleotide sequences and PCR conditions used to amplify the indicated genes. TA = annealing temperature; gdna = genomic DNA; cdna = complementary DNA; c = concentration.
pgbkt7 Anti- Myc AH109 strain (KDa) 50
pgbkt7 (KDa) 50 37 Anti- Myc AH109 strain Supplementary Figure 1. Protein expression of CRN and TDR in yeast. To analyse the protein expression of CRNKD and TDRKD, total proteins extracted from yeast culture
Using mutants to clone genes
Using mutants to clone genes Objectives: 1. What is positional cloning? 2. What is insertional tagging? 3. How can one confirm that the gene cloned is the same one that is mutated to give the phenotype
DOI: 10.1038/ncb3259 A Ismail et al. Supplementary Figure 1 B 60000 45000 SSC 30000 15000 Live cells 0 0 15000 30000 45000 60000 FSC- PARR 60000 45000 PARR Width 30000 FSC- 15000 Single cells 0 0 15000
Supplementary information
Supplementary information Supplementary figures Figure S1 Level of mycdet1 protein in DET1 OE-1, OE-2 and OE-3 transgenic lines. Total protein extract from wild type Col0, det1-1 mutant and DET1 OE lines
A Nucleus-Encoded Chloroplast Protein YL1 Is Involved in Chloroplast. Development and Efficient Biogenesis of Chloroplast ATP Synthase in Rice
A Nucleus-Encoded Chloroplast Protein YL1 Is Involved in Chloroplast Development and Efficient Biogenesis of Chloroplast ATP Synthase in Rice Fei Chen 1,*, Guojun Dong 2,*, Limin Wu 1, Fang Wang 3, Xingzheng
Supplemental Data. Li et al. (2015). Plant Cell /tpc
Supplemental Data Supplemental Figure 1: Characterization of asr3 T-DNA knockout lines and complementation transgenic lines. (A) The scheme of At2G33550 (ASR3) with gray boxes indicating exons and dash
Candidate region (0.74 Mb) ATC TCT GGG ACT CAT GAG CAG GAG GCT AGC ATC TCT GGG ACT CAT TAG CAG GAG GCT AGC
A idm-3 idm-3 B Physical distance (Mb) 4.6 4.86.6 8.4 C Chr.3 Recom. Rate (%) ATG 3.9.9.9 9.74 Candidate region (.74 Mb) n=4 TAA D idm-3 G3T(E4) G4A(W988) WT idm-3 ATC TCT GGG ACT CAT GAG CAG GAG GCT AGC
TRANSGENIC ANIMALS. -transient transfection of cells -stable transfection of cells. - Two methods to produce transgenic animals:
TRANSGENIC ANIMALS -transient transfection of cells -stable transfection of cells - Two methods to produce transgenic animals: 1- DNA microinjection - random insertion 2- embryonic stem cell-mediated gene
Alternative Cleavage and Polyadenylation of RNA
Developmental Cell 18 Supplemental Information The Spen Family Protein FPA Controls Alternative Cleavage and Polyadenylation of RNA Csaba Hornyik, Lionel C. Terzi, and Gordon G. Simpson Figure S1, related
Supplemental Figure 1 A
Supplemental Figure A prebleach postbleach 2 min 6 min 3 min mh2a.-gfp mh2a.2-gfp mh2a2-gfp GFP-H2A..9 Relative Intensity.8.7.6.5 mh2a. GFP n=8.4 mh2a.2 GFP n=4.3 mh2a2 GFP n=2.2 GFP H2A n=24. GFP n=7.
AD-FIL AD-YAB2 -2 BD-JAZ3 AD-YAB3 AD-YAB5 AD-FIL -4 3AT BD-JAZ3 AD-YAB3
3 4 9 10 11 12 AD-FIL AD-YAB5 2 B AD-YAB3 1 BD-JAZ 5 6 7 8 AD-FIL A AD-YAB2 Supplemental Data. Boter et al. (2015). Plant Cell 10.1105/tpc.15.00220 BD AD-YAB2-2 -2 BD-JAZ3 AD-YAB3 BD AD-YAB5-4 AD-FIL -4
SUPPLEMENTARY INFORMATION
Ca 2+ /calmodulin Regulates Salicylic Acid-mediated Plant Immunity Liqun Du, Gul S. Ali, Kayla A. Simons, Jingguo Hou, Tianbao Yang, A.S.N. Reddy and B. W. Poovaiah * *To whom correspondence should be
Nature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Schematic and results of screening the combinatorial antibody library for Sox2 replacement activity. A single batch of MEFs were plated and transduced with doxycycline inducible
Supplementary Figure 1. CRISPR/Cas9-induced targeted mutations in TaGASR7, TaDEP1, TaNAC2, TaPIN1, TaLOX2 and TaGW2 genes in wheat protoplasts.
Supplementary Figure 1. CRISPR/Cas9-induced targeted mutations in TaGASR7, TaDEP1, TaNAC2, TaPIN1, TaLOX2 and TaGW2 genes in wheat protoplasts. Lanes 1 and 2: digested CRISPR/Cas9-transformed protoplasts;
C24. ros1-1. ros1-1 rdm18-1. ros1-1 rdm18-2. ros1-1 nrpe1
Figure S1 Methylation level 1 0.8 0.6 0.4 0.2 0 p35s methylation levels 24 ros1-1 ros1-1 rdm18-1 ros1-1 rdm18-2 ros1-1 nrpe1 mg mhg mhh Figure S1. RM18/PKL promotes silencing at the p35s-npt II transgene
SUPPLEMENTARY INFORMATION
Local auxin metabolism regulates environment-induced hypocotyl elongation Zuyu Zheng 1,2, Yongxia Guo 3, Ondřej Novák 4,5, William Chen 2, Karin Ljung 4, Joseph P. Noel 1,3, *, and Joanne Chory 1,2, *
Supplemental Materials
Supplemental Materials Flores-Pérez et al., Supplemental Materials, page 1 of 5 Supplemental Figure S1. Pull-down and BiFC controls, and quantitative analyses associated with the BiFC studies. (A) Controls
2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology
CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes
Genome-wide genetic screening with chemically-mutagenized haploid embryonic stem cells
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Supplementary Information Genome-wide genetic screening with chemically-mutagenized haploid embryonic stem cells Josep V. Forment 1,2, Mareike Herzog
Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).
1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well
Supplemental Data. Seo et al. (2014). Plant Cell /tpc
Supplemental Figure 1. Protein alignment of ABD1 from other model organisms. The alignment was performed with H. sapiens DCAF8, M. musculus DCAF8 and O. sativa Os10g0544500. The WD40 domains are underlined.
Supplemental Data. Liu et al. (2013). Plant Cell /tpc
Supplemental Figure 1. The GFP Tag Does Not Disturb the Physiological Functions of WDL3. (A) RT-PCR analysis of WDL3 expression in wild-type, WDL3-GFP, and WDL3 (without the GFP tag) transgenic seedlings.
% Viability. isw2 ino isw2 ino isw2 ino isw2 ino mM HU 4-NQO CPT
a Drug concentration b 1.3% MMS nhp1 nhp1 8 nhp1 mag1.5% MMS.3% MMS nhp1 nhp1 ino8 9 ino8 9 % Viability 4.5% MMS ino8 9 ino8 9 2.5.1.15 % MMS c d nhp1 nhp1 nhp1 nhp1 nhp1 nhp1 Control (YPD) γ IR (1 gy)
Supplemental Data. Tang et al. Plant Cell. (2012) /tpc
Supplemental Figure 1. Relative Pchlide Fluorescence of Various Mutants and Wild Type. Seedlings were grown in darkness for 5 d. Experiments were repeated 3 times with same results. Supplemental Figure
(phosphatase tensin) domain is shown in dark gray, the FH1 domain in black, and the
Supplemental Figure 1. Predicted Domain Organization of the AFH14 Protein. (A) Schematic representation of the predicted domain organization of AFH14. The PTEN (phosphatase tensin) domain is shown in dark
Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and
Supplementary Figure Legend: Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and ATRIP protein peptides identified from our mass spectrum analysis were shown. Supplementary
CH 8: Recombinant DNA Technology
CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes
Supplemental Data. Meng et al. (2011). Plant Cell /tpc B73 CML311 CML436. Gaspé Flint
Gaspé Flint B73 CML311 CML436 A B C D 10 th leaf 10 th leaf 10 th leaf Supplemental Figure 1. Whole plant images of the four varieties used in this study (A) Extreme early flowering temperate line Gaspé
Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53
Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -
Supplemental Data. Lee et al. Plant Cell. (2010) /tpc Supplemental Figure 1. Protein and Gene Structures of DWA1 and DWA2.
Supplemental Figure 1. Protein and Gene Structures of DWA1 and DWA2. (A) Protein structures of DWA1 and DWA2. WD40 region was determined based on the NCBI conserved domain databases (B, C) Schematic representation
CGAGACCTTGTCACATTGGCGTCAACTC hoga Down GATGCCTCCTGTCAAGATTGCAATGAAC
Supplemental Table 1. PCR and qrt-pcr primers used in this study Primer designation Oligonucleotide sequence (5-3 ) PCR primers 5 SphI hoga GCATGCGAAGACTGATTCAGATAATTAGTTC 5 SalI hoga GTCGACCTGATGATCTCCACTGTCTGAAC
Supplemental Figure 1.
Supplemental Data. Charron et al. Dynamic landscapes of four histone modifications during de-etiolation in Arabidopsis. Plant Cell (2009). 10.1105/tpc.109.066845 Supplemental Figure 1. Immunodetection
Using mutants to clone genes
Using mutants to clone genes Objectives 1. What is positional cloning? 2. What is insertional tagging? 3. How can one confirm that the gene cloned is the same one that is mutated to give the phenotype