* ** ** * IB: p-p90rsk. p90rsk (Ser380) (arbitrary units) (Ser380) p90rsk. IB: p90rsk. Tubulin. IB: Tubulin. Ang II (200 nm) Ang II (200 nm)
|
|
|
- Johnathan Daniel
- 6 years ago
- Views:
Transcription
1 I: p-p9rsk I: p9rsk I: C I: p-p9rsk I: p9rsk 5 (ka) 5 5 (min) Ang II ( nm) p-p9rsk (Ser8) p9rsk p-p9rsk (Ser8) p9rsk (h) Mannitol 5 mm -Glucose 5 mm p9rsk (Ser8) (arbitrary units) p-p9rsk (Ser8) (arbitrary units) (min) Mannitol 5 mm Ang II ( nm) (h) -Glucose 5 mm Online figure I. p9rsk activation in cardiomyocytes (A-) Cardiomyocytes were stimulated with Ang II ( nm) (A and ) or high glucose or mannitol (C and ) for the indicated times. p-p9rsk, p9rsk and tubulin were detected by Western blotting of total cell lysates with each specific antibody. ( and ) Intensities of p-p9rsk protein bands were quantified using a Fujifilm image-analysis program (Image Gauge 4.) and were calculated relatively to the intensity of the tubulin band at each time point. Results were expressed as fold increase of p-p9rsk in AngII-treated cells compared to untreated cells. Shown is mean ± S.. (n = ). p <., p <.5 compared to untreated cells.
2 p9rsk kinase activity (in vitro kinase assay, arbitrary units) Ad-LacZ vehicle Ad-LacZ Ang II Ad-N-p9RSK vehicle Ad-N-p9RSK Ang II I: p9rsk p9rsk I: 5 vehicle Ang II vehicle Ang II Ad-LacZ Ad-N-p9RSK I: p-p9rsk p-p9rsk (Ser8) I: p9rsk p9rsk I: 5 Ang II 6 6 (min) vehicle FMK-MEA ( µm) Online figure II. Ad-N-p9RSK and FMK-MEA, a specific p9rsk inhibitor, blocked Ang IImediated p9rsk activation in cardiomyocytes (A) Cardiomyocytes were stimulated with Ang II ( nm), and p9rsk kinase activity was detected using an in vitro kinase assay as described in methods. The p9rsk kinase activity (upper) was normalized to its expression level, which was evaluated by Western blotting of p9rsk (lower). () Cardiomyocytes were pretreated with vehicle or FMK-MEA for hrs and stimulated with Ang II ( nm) for the indicated times. p-p9rsk, p9rsk and tubulin were detected by Western blotting of total cell lysates with each specific antibody. The blots are representative of data obtained from three separate experiments.
3 Relative ICER/ mrna (arbitrary units) N.S Ang II ( nm) (min) Ad-LacZ Ad-N-p9RSK I : ICER I : p9rsk I : ICER p9rsk ICER expression (abitrary units) Ad-WTp9RSK Ad- LacZ Ad-WTp9RSK Ad- LacZ Online figure III. Ad-N-p9RSK did not inhibit Ang II-mediated ICER mrna expression in cardiomyocytes (A), but Ad-WT-p9RSK enhanced ICER protein levels (). (A) Cardiomyocytes were transduced with Ad-LacZ or Ad-N-p9RSK for 4 hrs. Cells were then stimulated with Ang II ( nm) for min, and ICER mrna level was detected by qrt-pcr as described in methods. () Cardiomyocytes were transduced with Ad-LacZ or Ad-WT-p9RSK for 4hrs. ICER, p9rsk and tubulin were detected by Western blotting using the total cell lysates with each specific antibody (left). Intensities of ICER protein bands were quantified using a Fujifilm image-analysis program (Image Gauge 4.) and were calculated relatively to the intensity of the tubulin band at each time point. Results were expressed as fold increase of ICER in Ad-WT-p9RSK-transduced cells compared to the Ad-LacZ-transduced cells. Shown is mean ± S.. (n = ). p <.5.
4 I: ICER ICER I: 5 N-p9RSK-Tg WT-p9RSK -Tg ouble- Tg Sham MI sham Sham ERK5-CKO I: ICER ICER I: 5 Online figure IV. N-p9RSK-Tg, WT-p9RSK-Tg, ouble-tg, and ERK5-CKO mice showed no difference of ICER expression in sham operated mice. Expression of ICER and tubulin in heart samples collected from sham and MI in, sham in N-p9RSK-Tg, WT-p9RSK-Tg and ouble-tg mice (A), and heart samples from sham in and ERK5-CKO ().
5 C!STZ i.p. (mg/kg/ W) (%) Survival rate Coronary ligation N-p9RSK (days) (n = 5) (n = 7) p <.5 Random S (mg/dl) 4 M + MI ody weight (g) Np9RSK-Tg Np9RSK-Tg M + MI LV/TL (mg/mm) Np9RSK-Tg M + MI Lung/TL (mg/mm) 5 5 M + MI + + E LVEd (mg/min) M + MI M + MI + + LVESd (mg/min) FS (%) M + MI + + EF (%) 5 5 M + MI + + Np9RSK-Tg Np9RSK-Tg Np9RSK-Tg Np9RSK-Tg Np9RSK-Tg F G TUNEL API TUNEL-positive cells (%).6.4. M + MI TUNEL/ API/αactinin Np9RSK-Tg Sham M + MI N-p9RSK-Tg Online figure V. Inhibition of p9rsk activation prevented the exacerbation of LV dysfunction after MI in diabetic mice. (A) Kaplan-Meier survival analysis in diabetic (n=7) and N-p9RSK-Tg (n=5) after MI. Overall survival was significantly higher in N-p9RSK-Tg compared to mice. p <.5 compared to group. () Random blood sugar (S) and body weight at one week after STZ injection for coronary ligation (M + MI) or vehicle-treated sham operation groups in or N-p9RSK-Tg mice. (mean ± S.., n =9-) (C) LV weight/tl (mean ± S.., n =9-) and () lung weight/tl in M + MI or vehicle-treated sham operation groups in or N-p9RSK-Tg mice one week after surgery. (p <., mean ± S.., n=9-). (E) Echocardiographic data obtained from M + MI, or vehicle treated sham operation groups in or N-p9RSK-Tg mice one week after surgery. LVEd, left ventricular end-diastolic dimension; LVESd, left ventricular end-systolic dimension; TL, Tibial length. (p<.5, p <., mean ± S.., n=9-).(f) Cardiomyocytes apoptosis in the remote area was increased in M + MI group, which was inhibited in N-p9RSK-Tg mice. TUNELpositive cardiomyocytes were counted in the remote area as described in Fig.6. Representative pictures of TUNEL (top), API (middle), and merged of α-actinin with TUNEL and API staining (bottom) of the remote area from mice subjected to sham or M+MI, and N-p9RSK-Tg mice subjected to M + MI operation. 4X objective lens. Scale bars: 4 µm (G) A bar graph showing TUNEL-positive cells (%) in and N-p9RSK-Tg. ( p <.5, mean ± S.., n =).
6 N-p9RSK-Tg Sham M + MI CHIP Ub E ligase assay Quantification area Relative levels of ubiquitinated GST-ICER expressions Online figure VI. Quantification of CHIP ubiquitin E ligase activity. The activities of CHIP Ub E ligase were assessed by quantifying ubiquitinated GST-ICER fusion proteins. riefly, protein was extracted by modififed RIPA buffer, and then immunoprecipitated with anti-chip antibody. CHIP proteins were immunopresipitated by protein A and G agarose mixture. After that, GST-ICER protein as added to each sample. CHIP Ub E ligase activity was detected using Ubiquitin-Protein Conjugation kit. Science Lab Image gauge software (version 4; Fuji Photo Film, Tokyo, Japan) was used for the analysis. Ubiquitinated GST-ICER expressions were calculated in equal area described in white broken squires. Relative levels were indicated as based on means of sham mice. 6
7 IP: ERK5 C IP ERK5 I: CHIP 7 CHIP I: CHIP 7 CHIP I: ERK5 ERK5 I: ERK5 ERK5 I: Myc 7 I: HA 5 I: Flag I: VP6 5 5 I: Myc-CHIP Myc-CHIP HA- CA-MEK5α Flag-p9RSK VP6-ERK5 Fr (57-87) I: Myc I: HA I: Flag 7 5 Myc-CHIP CA-MEK5α Np9RSK WTp9RSK CHIP HA- CA-MEK5α Flag-N-p9RSK or WT-p9RSK CA-MEK5α ERK5-CHIP binding (arbitraty units).5.5 WTp9RSK Fr VP6-ERK5 (57-87) ERK5-CHIP binding (arbitraty units) Myc-CHIP CA-MEK5α Myc-CHIP CA-MEK5α Np9RSK WTp9RSK WTp9RSK VP6-ERK5 Fr (57-87) Online figure VII. p9rsk kinase activation inhibits ERK5-CHIP association. (A) oth wild type p9rsk (WT-p9RSK) and ERK5-Fr (aa57-87) disrupted ERK5-CHIP association. After plasmids were transfected as indicated, cell lysates will be immunoprecipitated with anti-erk5 and then immunoblotted with anti-chip. Protein expression was determined by immunoblotting with each specific antibody. () Relative ERK5-CHIP binding was quantified as described in Fig. (mean±s.., n=, (p<., p<.5 compared to both Myc-CHIP and CA-MEK5α transfected cells (the third black bar from left). Results are expressed as fold decrease in ERK5-CHIP binding in WT-p9RSK (grey bars) and ERK5-Fr (aa58-87) (white bars) transfected cells compared to the control cells (the third black bar from left). (C) WT-p9RSK but not N-p9RSK fully disrupted ERK5-CHIP interaction. ERK5-CHIP binding and each protein expression were detected as described in (A). () Relative ERK5-CHIP binding was quantified as described in Fig.. Results are expressed as fold decrease in ERK5-CHIP binding in cells over-expressing WT-p9RSK. p<., mean±s.., n=.
8 I: p-p9rsk p-p9rsk (Ser8) I: p9rsk p9rsk I: p-erk5 p-erk5 (T8/Y) I: ERK5 ERK5 I: p-erk / I: 7 5 p-erk / vehicle HO µm Ang II nm Online figure VIII. Ang II increased only p9rsk but not ERK5 kinase activity in cardiomyocyte. Cardiomyocytes were stimulated with Ang II ( nm) or HO ( µm) for 5 min. p- p9rsk, p9rsk, p-erk5, ERK5, p-erk/, and tubulin were detected by Western blotting using the total cell lysates with each specific antibody. Representative immunoblots from duplicate experiments are shown.
9 A ouble-tg (FV) WT (FV) MI M+MI WT (c57l) CKO (c57l) MI MI MI 5 Infarction size (%) 4 ou M +M bl ei Tg (F V )M W I T (c 57 L C )M KO I (c 57 L )M I (F V ) W T W T (F V )M I Online figure IX. Evaluation of infarction size at one week after MI surgery. (A) Representative pictures of LV tissue sections by Masson s trichrome staining. Infarct areas were described in black triangle between broken lines. 4X objective lens. Scale bars: µm. () Comparision of MI sizes. The sizes were not significantly changed in each groups. ata are shown as means ± S.. (n=). 9
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
GFP CCD2 GFP IP:GFP
D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant
supplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
Coleman et al., Supplementary Figure 1
Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential
ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
(A) Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site.
SUPPLEMENTRY INFORMTION SUPPLEMENTL FIGURES Figure S1. () Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site. () Western blot of ligated and unligated sciatic
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
Wnt16 smact merge VK/AB
A WT Wnt6 smact merge VK/A KO ctrl IgG WT KO Wnt6 smact DAPI SUPPLEMENTAL FIGURE I: Wnt6 expression in MGP-deficient aortae. Immunostaining for Wnt6 and smooth muscle actin (smact) in aortae from 7 day
Nature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting.
Supplementary Figure 1 Zranb1 gene targeting. (a) Schematic picture of Zranb1 gene targeting using an FRT-LoxP vector, showing the first 6 exons of Zranb1 gene (exons 7-9 are not shown). Targeted mice
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using
SANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
HCT116 SW48 Nutlin: p53
Figure S HCT6 SW8 Nutlin: - + - + p GAPDH Figure S. Nutlin- treatment induces p protein. HCT6 and SW8 cells were left untreated or treated for 8 hr with Nutlin- ( µm) to up-regulate p. Whole cell lysates
Supplementary Figure 1. RAD51 and RAD51 paralogs are enriched spontaneously onto
Supplementary Figure legends Supplementary Figure 1. and paralogs are enriched spontaneously onto the S-phase chromatin during DN replication. () Chromatin fractionation was carried out as described in
Supplementary Figure Legend
Supplementary Figure Legend Supplementary Figure S1. Effects of MMP-1 silencing on HEp3-hi/diss cell proliferation in 2D and 3D culture conditions. (A) Downregulation of MMP-1 expression in HEp3-hi/diss
Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice
Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice Belal A. Mohamed, Amal Z. Barakat, Torsten Held, Manar Elkenani, Christian Mühlfeld, Jörg Männer, and Ibrahim M. Adham
Supplemental Data Supplementary Figure Legends and Scheme Figure S1.
Supplemental Data Supplementary Figure Legends and Scheme Figure S1. UTK1 inhibits the second EGF-induced wave of lamellipodia formation in TT cells. A and B, EGF-induced lamellipodia formation in TT cells,
Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on
Supplemental Material Detailed Methods Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on 5µg/mL human fibronectin coated plates in DMEM supplemented with 10% FBS and penicillin/streptomycin
Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate
Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated
RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit
RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit Catalog #: TFEH-p65 User Manual Mar 13, 2017 3607 Parkway Lane, Suite 200 Norcross, GA 30092 Tel: 1-888-494-8555 (Toll Free) or 770-729-2992,
Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
The microtubule-associated tau protein has intrinsic acetyltransferase activity. Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and
SUPPLEMENTARY INFORMATION: The microtubule-associated tau protein has intrinsic acetyltransferase activity Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and Virginia M.Y. Lee Cohen
Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
Technical Note. Housekeeping Protein Validation Protocol
Technical Note Housekeeping Protein Validation Protocol Published March 2017. The most recent version of this Technical Note is posted at licor.com/bio/support. Visit us on protocols.io! Explore an interactive
Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD
Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Developed for: Aerius, Odyssey Classic, Odyssey CLx and Odyssey Sa Imaging Systems
Center Drive, University of Michigan Health System, Ann Arbor, MI
Leukotriene B 4 -induced reduction of SOCS1 is required for murine macrophage MyD88 expression and NFκB activation Carlos H. Serezani 1,3, Casey Lewis 1, Sonia Jancar 2 and Marc Peters-Golden 1,3 1 Division
ENCODE RBP Antibody Characterization Guidelines
ENCODE RBP Antibody Characterization Guidelines Approved on November 18, 2016 Background An integral part of the ENCODE Project is to characterize the antibodies used in the experiments. This document
Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) ELISA Kit
RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) ELISA Kit Catalog #: PEL-Stat3-Y705 User Manual Last revised August 10, 2016 Caution: Extraordinarily useful information enclosed ISO 13485 Certified
Please read manual carefully before starting experiment
RayBio Cell-Based Phosphorylation ELISA Kit - Preliminary For the semi-quantitative detection of both phosphorylated and pan human, mouse or rat proteins in adherent whole cell lines. User Manual (Revised
Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-
#1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals
Supporting Online Material for
www.sciencemag.org/cgi/content/full/323/5910/124/dc1 Supporting Online Material for Regulation of Neuronal Survival Factor MEF2D by Chaperone-Mediated Autophagy Qian Yang, Hua She, Marla Gearing, Emanuela
Supplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2
Molecular Cell, Volume 65 Supplemental Information The TRAIL-Induced Cancer Secretome Promotes a Tumor-Supportive Immune Microenvironment via CCR2 Torsten Hartwig, Antonella Montinaro, Silvia von Karstedt,
RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) and Total STAT3 ELISA Kit
RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) and Total STAT3 ELISA Kit Catalog #: PEL-Stat3-Y705-T User Manual Last revised October 10, 2017 Caution: Extraordinarily useful information enclosed ISO
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 PCR-genotyping of the three mouse models used in this study and controls for behavioral experiments after semi-chronic Pten inhibition. a-c. DNA from App/Psen1 (a), Pten tg (b) and
Tumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor
Tumor Growth Suppression Through the Activation of p21, a Cyclin-Dependent Kinase Inhibitor Nicholas Love 11/28/01 A. What is p21? Introduction - p21 is a gene found on chromosome 6 at 6p21.2 - this gene
Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila
Cell Supplemental Information Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila Bo Liu, Yonggang Zheng, Feng Yin, Jianzhong Yu, Neal Silverman, and Duojia Pan Supplemental Experimental
RayBio Phospho- Akt (Ser473) ELISA Kit
RayBio Phospho- Akt (Ser473) ELISA Kit For Measuring Phosphorylated Akt (Ser473) in Human, Mouse and Rat Cell Lysates User Manual (Revised Mar 1, 2012) RayBio Akt (Ser473) ELISA Kit Protocol (Cat#: PEL-Akt-S473-001)
Technical tips Session 5
Technical tips Session 5 Chromatine Immunoprecipitation (ChIP): This is a powerful in vivo method to quantitate interaction of proteins associated with specific regions of the genome. It involves the immunoprecipitation
Real-time PCR. TaqMan Protein Assays. Unlock the power of real-time PCR for protein analysis
Real-time PCR TaqMan Protein Assays Unlock the power of real-time PCR for protein analysis I can use my real-time PCR instrument to quantitate protein? Do protein levels correlate with related mrna levels
Supplementary Figure 1 Activated B cells are subdivided into three groups
Supplementary Figure 1 Activated B cells are subdivided into three groups according to mitochondrial status (a) Flow cytometric analysis of mitochondrial status monitored by MitoTracker staining or differentiation
Confocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets.
Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets. Scale bar represent 100 nm. The sizes of EVs from MDA-MB-231-D3H1 (D3H1),
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid
Supplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1.
Supplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1. Percent of original fluorescence was plotted as a function of time following photobleaching
RayBio Rat IL-6 ELISA Kit (For Lysates)
RayBio Rat IL-6 ELISA Kit (For Lysates) Catalog #: ELR-IL6-CL User Manual Last revised April 15, 2016 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane, Suite 100
ab Ubiquitylation Assay Kit
ab139467 Ubiquitylation Assay Kit Instructions for Use For the activation of ubiquitin for use in ubiquitylation experiments This product is for research use only and is not intended for diagnostic use.
Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 CSRP2 PFKP ADFP ADM C10orf10 GPI LOX PLEKHA2 WIPF1
Supplemental Table 1 Gene Symbol FDR corrected p-value PLOD1 4.52E-18 PDK1 6.77E-18 CSRP2 4.42E-17 PFKP 1.23E-14 MSH2 3.79E-13 NARF_A 5.56E-13 ADFP 5.56E-13 FAM13A1 1.56E-12 FAM29A_A 1.22E-11 CA9 1.54E-11
* This work was supported, in whole or in part, by National Institutes of Health Grants HL56850 and AG S EXPERIMENTAL PROCEDURES
THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 285, NO. 10, pp. 6937 6951, March 5, 2010 2010 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. p66 shc Inhibits Insulin-like
2D gel Western blotting using antibodies against ubiquitin, SUMO and acetyl PTM
2D gel Western blotting using antibodies against ubiquitin, SUMO and acetyl PTM Nancy Kendrick, Jon Johansen & Matt Hoelter, Kendrick Labs Inc www.kendricklabs.com Talk Outline Significance Method description
RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
QS S Assist STK_FP Kit
QS S Assist STK_FP Kit Description STK FP kit is designed for use in pharmacological assays for STK based on fluorescence polarization. The kit includes assay buffer, human protein kinase, ATP/fluorescence-
TECHNICAL BULLETIN. MEK Activity Assay Kit. Product Code CS0490 Storage Temperature 20 C
MEK Activity Assay Kit Product Code CS0490 Storage Temperature 20 C TECHNICAL BULLETIN Product Description The MAP kinase kinases (MAPKK, mitogen-activated protein kinase kinase, also termed MEK) are a
RayBio Phospho- Stat 3 (Tyr705) ELISA Kit
RayBio Phospho- Stat 3 (Tyr705) ELISA Kit For Measuring Phosphorylated Stat3 (Tyr705) in Human, Mouse and Rat Cell Lysates User Manual (Revised Mar 1, 2012) RayBio Stat3 (Tyr705) ELISA Kit Protocol (Cat#:
RayBio Human bfgf ELISA Kit
RayBio Human bfgf ELISA Kit User Manual (for Cell Lysate and Tissue Lysate) (Revised Mar 1, 2012) RayBio Human bfgf ELISA Kit Protocol (Cat#: ELH-bFGF-001C) RayBiotech, Inc. We Provide You With Excellent
Protein Purification Products. Complete Solutions for All of Your Protein Purification Applications
Protein Purification Products Complete Solutions for All of Your Protein Purification Applications FLAG-Tagged Protein Products EXPRESS with the pcmv-dykddddk Vector Set Fuse your protein of interest to
Supplement Figure 1. Characterization of the moab. (A) A series of moabs that are anti-hαiib-specific were tested for their ability to bind to
Supplement Figure 1. Characterization of the 312.8 moab. (A) A series of moabs that are anti-hαiib-specific were tested for their ability to bind to platelets. The black line represents the 312.8 moab
Automated Protocol for ANTI-FLAG High Sensitivity, M2 coated 96-well plate Using the Sciclone ALH 3000 Workstation (Caliper Life Sciences)
Automated Protocol for ANTI-FLAG High Sensitivity, M2 coated 96-well plate Using the Sciclone ALH 3000 Workstation (Caliper Life Sciences) ANTI-FLAG High Sensitivity, M2 coated 96-well plate P 2983 Automation
by Neurobasal medium (supplemented with B27, 0.5mM glutamine, and 100 U/mL
Supplementary Materials and methods Neuronal cultures and transfection The hippocampus was dissected from E8 rat embryos, dissociated, and neurons plated onto glass coverslips coated with poly-ornithine
Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation
1 2 3 4 5 SUPPLEMENTAL DATA Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation Magalí Nazar, Juan Pablo Nicola, María Laura
MSD Immuno-Dot-Blot Assays. A division of Meso Scale Diagnostics, LLC.
MSD Immuno-Dot-Blot Assays Example: High Throughput Western Blots Replacements Traditional Western Blots High content Molecular weight and immunoreactivity Labor and protein intensive Inherently low throughput
The MAP Kinase Family
The MAP Kinase Family Extracellular stimuli Classical MAP kinases Atypical MAP kinases MAPKKK MLK1/2/3/7; LZK RAF-1/A/B TAK1; TPL2 c-mos MEKK1-4; DLK ASK1/2; MLTK TAO1/2 ASK1 TAK1 MEKK1-4 MEKK2/3 TPL2???
Supplementary Material. Levels of S100B protein drive the reparative process in acute muscle injury and muscular dystrophy
Supplementary Material Levels of protein drive the reparative process in acute muscle injury and muscular dystrophy Francesca Riuzzi 1,4 *, Sara Beccafico 1,4 *, Roberta Sagheddu 1,4, Sara Chiappalupi
Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation
Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation Shu Liu 1, Zhongwen Xie 2, Qingwei Zhao 2, Huan Pang
RayBio Human HGF ELISA Kit
RayBio Human HGF ELISA Kit User Manual (for Cell Lysate and Tissue Lysate) (Revised Mar 1, 2012) RayBio Human HGF ELISA Kit Protocol (Cat#: ELH-HGF-001C) RayBiotech, Inc. We Provide You With Excellent
Supporting Information
Supporting Information van Rooij et al. 10.1073/pnas.0805038105 SI Materials and Methods Surgical Procedures. All animal protocols were approved by the Institutional Animal Care and Use Committee of the
- NaCr. + NaCr. α H3K4me2 α H3K4me3 α H3K9me3 α H3K27me3 α H3K36me3 H3 H2A-2B H4 H3 H2A-2B H4 H3 H2A-2B H4. α Kcr. (rabbit) α Kac.
+ NaCr NaCr + NaCr NaCr Peptides 10ng 50ng 250ng K α Pan (mouse) Pan (mouse) 10ng 50ng 250ng α Pan (rabbit) C 10ng 50ng 250ng α Pan (mouse) 0 1.25 2.5 5 10 20 40 (mm) NaCr 24h α Pan (rabbit) α K4me2 α
Fig. S1. Nature Medicine: doi: /nm HoxA9 expression levels BM MOZ-TIF2 AML BM. Sca-1-H. c-kit-h CSF1R-H CD16/32-H. Mac1-H.
A 1 4 1 4 1 4 CSF1RH 1 3 1 2 1 1 CSF1RH 1 3 1 2 1 1 CSF1RH 1 3 1 2 1 1 1 1 1 1 1 2 1 3 1 4 GFPH 1 1 1 1 1 2 1 3 1 4 Sca1H 1 1 1 1 1 2 1 3 1 4 ckith 1 4 1 4 1 4 CSF1RH 1 3 1 2 1 1 CSF1RH 1 3 1 2 1 1 CSF1RH
Supplementary Figure 1. Isolation of GFPHigh cells.
Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding
Immunofluorescence images of different core histones and different histone exchange assay.
Molecular Cell, Volume 51 Supplemental Information Enhanced Chromatin Dynamics by FACT Promotes Transcriptional Restart after UV-Induced DNA Damage Christoffel Dinant, Giannis Ampatziadis-Michailidis,
mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230
mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual Catalog # MBS826230 For the detection and quantification of mirnas mmu-mir-200a-3p normalized by U6 snrna using Real-time RT-PCR
MEK1/2 (MAPK Kinase) Activity Assay Kit
MEK1/2 (MAPK Kinase) Activity Assay Kit For 96 tests Cat. No. SGT440 FOR RESEARCH USE ONLY Not for use in diagnostic procedures USA & Canada Phone: +1(800) 437-7500 Fax: +1 (951) 676-9209 Europe +44 (0)
Optimization of 2D Gel Transblotting for Host Cell Protein Analysis
Optimization of 2D Gel Transblotting for Host Cell Protein Analysis Jon Johansen, Matt Hoelter & Nancy Kendrick* Kendrick Labs Inc, Madison, WI www.kendricklabs.com Talk Outline Biologic drugs, recombinant
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2774 Figure S1 TRF2 dosage modulates the tumorigenicity of mouse and human tumor cells. (a) Left: immunoblotting with antibodies directed against the Myc tag of the transduced TRF2 forms
TransAM Kits are DNA-binding ELISAs that facilitate the study of transcription factor activation in mammalian tissue and cell culture extracts.
Transcription Factor ELISAs TransAM sensitive quantitative transcription factor ELISAs TransAM Kits are DNA-binding ELISAs that facilitate the study of transcription factor activation in mammalian tissue
special offers from your protein biology resource
special offers from your protein biology resource Pop open your cells, extract your proteins, purify, quantify and express them. Seeking knowledge about proteins with Thermo Scientific Protein Research
To construct a mammary gland specific, E6-AP-expressing transgenic vector, MMTV-
Supplemental Methods: Plasmid Construction To construct a mammary gland specific, E6-AP-expressing transgenic vector, MMTV- E6-AP, we used MMTVkBpA expression vector obtained from Dr. Sophia Tsai, Baylor
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Description of the observed lymphatic metastases in two different SIX1-induced MCF7 metastasis models (Nude and NOD/SCID). Supplementary Figure 2. MCF7-SIX1
EGFR (Phospho-Ser695)
Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 EGFR (Phospho-Ser695) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02090 Please read the provided manual entirely
Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX
Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA
Supplemental Information. Loss of MicroRNA-7 Regulation Leads. to a-synuclein Accumulation and. Dopaminergic Neuronal Loss In Vivo
YMTHE, Volume 25 Supplemental Information Loss of MicroRNA-7 Regulation Leads to a-synuclein Accumulation and Dopaminergic Neuronal Loss In Vivo Kirsty J. McMillan, Tracey K. Murray, Nora Bengoa-Vergniory,
mir-24-mediated down-regulation of H2AX suppresses DNA repair
Supplemental Online Material mir-24-mediated down-regulation of H2AX suppresses DNA repair in terminally differentiated blood cells Ashish Lal 1,4, Yunfeng Pan 2,4, Francisco Navarro 1,4, Derek M. Dykxhoorn
Chapter 10 Analytical Biotechnology and the Human Genome
Chapter 10 Analytical Biotechnology and the Human Genome Chapter Outline Enzyme tests and biosensors DNA-based tests DNA analysis technologies Human genome and genome-based analytical methods 1 Enzyme-based
Xfect Protein Transfection Reagent
Xfect Protein Transfection Reagent Mammalian Expression Systems Rapid, high-efficiency, low-toxicity protein transfection Transfect a large amount of active protein Virtually no cytotoxicity, unlike lipofection
Protocol for induction of expression and cell lysate production
Protocol for induction of expression and cell lysate production AV-04 Doxycyclin induction and cell lysate 1.0 Introduction / Description This method is intended for the treatment of the previously transfected
2. Sample dilution: Tissue lysate and cell lysate sample should be diluted at least 5-fold with 1x Sample Diluent Buffer.
Mouse IL-6 (Lysate) ELISA Kit Catalog No: CKM054 Size: 1 x 96 tests I. Introduction The Cell Sciences Mouse IL-6 ELISA (Enzyme-Linked Immunosorbent Assay) kit is an in vitro enzyme-linked immunosorbent
Supplemental Data. Steiner et al. Plant Cell. (2012) /tpc
Supplemental Figure 1. SPY does not interact with free GST. Invitro pull-down assay using E. coli-expressed MBP-SPY and GST, GST-TCP14 and GST-TCP15. MBP-SPY was used as bait and incubated with equal amount
Maximize Your Western Blotting Results. Superior products for every step of the Western workflow
Maximize Your Western Blotting Results Superior products for every step of the Western workflow Let Millipore s Western Blotting Expertise Help Keep Your Research On Track. One way to improve the quality
This Document Contains:
This Document Contains: 1. In-Cell Western Protocol II. Cell Seeding and Stimulation Supplemental Protocol III. Complete Assay Example: Detailing the Seeding, Stimulation and Detection of the A431 Cellular
Supplemental Information. Lithocholic Acid Hydroxyamide Destabilizes. Cyclin D1 and Induces G 0 /G 1 Arrest by Inhibiting. Deubiquitinase USP2a
Cell Chemical Biology, Volume 24 Supplemental Information Lithocholic Acid Hydroxyamide Destabilizes Cyclin D1 and Induces G 0 /G 1 Arrest by Inhibiting Deubiquitinase USP2a Katarzyna Magiera, Marcin Tomala,
sirna Transfection Into Primary Neurons Using Fuse-It-siRNA
sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative
C-type natriuretic peptide signalling and cardiovascular disease Adrian Hobbs
C-type natriuretic peptide signalling and cardiovascular disease Adrian Hobbs Professor of Cardiovascular Pharmacology William Harvey Research Institute Barts & The London School of Medicine & Dentistry
64 CuCl 2 in 50 µl 0.1N NaOAc buffer, and 20 µg of each DOTA-antibody conjugate in 40 µl
Number of DOTA per antibody The average number of DOTA chelators per antibody was measured using a reported procedure with modifications (1,2). Briefly, nonradioactive CuCl 2 (80-fold excess of DOTA antibodies)
ab SUMOylation Assay Kit
ab139470 SUMOylation Assay Kit Instructions for Use For the generation and detection of SUMOylated proteins in vitro. This product is for research use only and is not intended for diagnostic use. Version
1. Cross-linking and cell harvesting
ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine
In-Cell Western Kits I and II
Odyssey and Aerius Infrared Imaging Systems In-Cell Western Assay Kits I and II Published November, 2006. The most recent version of this protocol is posted at http://biosupport.licor.com/protocols.jsp
INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807
INOS Colorimetric Cell-Based ELISA Kit Catalog #: OKAG00807 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only. Not Intended
pgbkt7 Anti- Myc AH109 strain (KDa) 50
pgbkt7 (KDa) 50 37 Anti- Myc AH109 strain Supplementary Figure 1. Protein expression of CRN and TDR in yeast. To analyse the protein expression of CRNKD and TDRKD, total proteins extracted from yeast culture
Modeling Cardiac Hypertrophy: Endothelin-1 Induction with qrt-pcr Analysis
icell Cardiomyocytes Application Protocol Modeling Cardiac Hypertrophy: Endothelin-1 Induction with qrt-pcr Analysis Introduction Cardiac hypertrophy is characterized by several different cellular changes,
QS S Assist KINASE_MSA Kit
QS S Assist KINASE_MSA Kit Description KINASE MSA Kit is designed for use in pharmacological assays for KINASE based on Off-chip mobility shift assay (MSA). This kit includes Assay Buffer, Termination